Chondrogenische Pelletvorming van Koord Bloed afgeleide geïnduceerde Pluripotente Stamcellen

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Hier stellen wij een protocol voor chondrogenische differentiatie voor van bloedbloedmononucleaire cellen afgeleide door mensen geïnduceerde pluripotente stamcellen.

Cite this Article

Copy Citation | Download Citations

Nam, Y., Rim, Y. A., Ju, J. H. Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells. J. Vis. Exp. (124), e55988, doi:10.3791/55988 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Menselijke kraakbeen ontbreekt aan het vermogen zich te herstellen. De degeneratie van kraakbeen wordt dus niet behandeld door curatieve maar door conservatieve behandelingen. Momenteel worden inspanningen gedaan om beschadigd kraakbeen te regenereer met ex vivo geëxpandeerde chondrocyten of beenmerg afgeleide mesenchymale stamcellen (BMSC's). De beperkte levensvatbaarheid en instabiliteit van deze cellen beperken echter hun toepassing bij kraakbeenherstructurering. Menselijke geïnduceerde pluripotente stamcellen (hiPSCs) hebben wetenschappelijke aandacht ontvangen als een nieuw alternatief voor regeneratieve toepassingen. Met onbeperkte zelfvernieuwingsvermogen en multipotency, zijn hiPSCs gemarkeerd als een nieuwe vervangende celbron voor kraakbeenherstel. Het verkrijgen van een hoge hoeveelheid chondrogeenpellets van hoge kwaliteit is echter een belangrijke uitdaging voor hun klinische toepassing. In deze studie hebben we embryoïde lichaams- (EB) -uitgevoerde uitgroeicellen gebruikt voor chondrogeen differentiatie. Succesvolle chondrogenese werd bevestigd door PCR anD vlekken met alcia blauw, toluidine blauw en antilichamen tegen respectievelijk collageen typen I en II (respectievelijk COL1A1 en COL2A1). Wij bieden een gedetailleerde methode voor de differentiatie van bloedmononucleaire cel afgeleide iPSCs (CBMC-hiPSCs) in chondrogeenpellets.

Introduction

Het gebruik van hiPSC's vertegenwoordigt een nieuwe strategie voor drugscreening en mechanistische studies van diverse ziekten. Uit een regeneratief perspectief zijn hiPSCs ook een potentiële bron voor de vervanging van beschadigde weefsels die beperkte geneeskracht hebben, zoals articulair kraakbeen 1 , 2 .

De regeneratie van inheemse gewrichtskraakbeen is al enkele decennia een uitdaging geweest. Articulair kraakbeen is een zacht, wit weefsel dat het einde van de botten bekleedt, beschermt tegen wrijving. Het heeft echter beperkte regeneratieve capaciteit bij beschadiging, waardoor zelfherstel bijna onmogelijk is. Daarom is onderzoek gericht op kraakbeenregeneratie al enkele decennia doorlopend.

Vroeger werd in vitro differentiatie in de chondrogeen lijn meestal uitgevoerd met BMSC's of natieve chondrocyten die uit het kniegewricht 3 werden geïsoleerd. Wegens tO hun chondrogeenpotentieel, BMSC's en natieve chondrocyten hebben talrijke verdiensten die hun gebruik bij chondrogenese ondersteunen. Door hun beperkte expansie en instabiele fenotype worden deze cellen echter geconfronteerd met verschillende beperkingen bij de reconstructie van articulaire kraakbeenafwijkingen. Onder de in vitro- kweekomstandigheden hebben deze cellen de neiging om hun eigen karakteristieken na 3-4 passages te verliezen, wat uiteindelijk hun differentieringsvermogen beïnvloedt 4 . Ook bij nierlijke chondrocyten is extra schade aan het kniegewricht onvermijdelijk bij het verkrijgen van deze cellen.

In tegenstelling tot BMSC's of natieve chondrocyten kunnen hiPSCs onbepaald in vitro uitbreiden. Met de juiste cultuuromstandigheden hebben hiPSCs een groot potentieel als vervangende bron voor chondrogeen differentiatie. Het is echter uitdagend om de intrinsieke eigenschappen van hiPSCs 5 te wijzigen . Bovendien duurt het een aantal ingewikkelde in vitro stePs om het lot van hiPSCs naar een specifiek celtype te leiden. Ondanks deze complicaties, wordt het gebruik van hiPSCs nog steeds aanbevolen door hun hoge zelfvernieuwingsvermogen en hun capaciteit om te onderscheiden in gerichte cellen, waaronder chondrocyten 6 .

Chondrogene differentiatie wordt gewoonlijk gedaan met driedimensionale cultuursystemen, zoals de pelletkweek- of micromassa-cultuur, met behulp van MSC-achtige stamcellen. Als u hiPSC's gebruikt, verschilt het protocol voor het genereren van MSC-achtige stamcellen van de bestaande protocollen. Sommige groepen gebruiken een monolaagse cultuur van hiPSCs om het fenotype direct in MSC-achtige cellen 7 om te zetten . Echter, de meeste studies gebruiken EB's om opgroei cellen te genereren die lijken op MSCs 8 , 9 , 10 , 11 .

Verschillende soorten groeifactoren worden gebruikt om chondroge te veroorzakenNesis. Gewoonlijk worden BMP- en TGFβ-familieproteïnen, alleen of in combinatie gebruikt. Differentiatie is ook geïnduceerd met andere factoren, zoals GDF5, FGF2 en IGF1 12 , 13 , 14 , 15 . TGFβ1 is aangetoond dat chondrogenese op een dosisafhankelijke manier in MSCs 16 wordt gestimuleerd. In vergelijking met het andere isotype, TGFβ3 induceert TGFβ1 chondrogenese door de pre-kraakbeen mesenchymale cel condensatie te verhogen. TGFβ3 induceert chondrogenese door de mesenchymale cel proliferatie 17 aanzienlijk te verhogen. TGFβ3 wordt echter vaker gebruikt door onderzoekers dan TGFβ1 7 , 10 , 18 , 19 . BMP2 versterkt de expressie van genen gerelateerd aan de chondrogeen matrixcomponenten in het menselijkArticulaire chondrocyten onder in vitro condities 20 . BMP2 verhoogt de expressie van genen die kritiek zijn op kraakbeenvorming in MSC's in combinatie met TGFβ-eiwitten 21 . Het is ook aangetoond dat BMP2 het effect van TGFβ3 synergistisch verbetert via de Smad- en MAPK-pathways 22 .

In deze studie werden CBMC-hiPSC's geaggregeerd in EB's met behulp van EB-medium in een Petri-schotel met lage gehechtheid. Uitgroei cellen werden geïnduceerd door de EB's aan een gelatine gecoate schotel te bevestigen. Chondrogene differentiatie met behulp van uitgroeicellen werd uitgevoerd door pelletkweek. Behandeling met zowel BMP2 als TGFβ3 heeft de cellen succesvol gecondenseerd en geïnduceerde extracellulaire matrix (ECM) eiwit accumulatie voor chondrogeen pelletvorming. Deze studie suggereert een simpele, maar efficiënte chondrogene differentiatieprotocol met behulp van CBMC-hiPSCs.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Dit protocol is goedgekeurd door het institutionele review board van de Katholieke Universiteit van Korea (KC12TISI0861). CBMC's die worden gebruikt voor herprogrammering, werden direct verkregen uit de Cord Blood Bank van het Seoel St. Mary's Hospital.

1. Chondrogeen Differentiatie van iPSCs

  1. CBMC-iPSC generatie
    1. Genereer CBMC-hiPSCs met behulp van het protocol dat is weergegeven in ons vorige werk 23 .
    2. Verzamel de bloedcellen in een 15 ml conische buis en tel ze met een hemocytometer.
    3. Bereid 3 x 10 5 cellen en centrifugeer ze gedurende 5 minuten bij 515 xg en RT. Verwijder de supernatant door zuigkracht en resuspendeer de cellen in 0,5 ml bloedcelmedium.
    4. Breng de cellen naar een putje van een niet-gecoate 24-putjesplaat en voeg het Sendai-virusmengsel toe volgens de aanbevelingen van de fabrikant.
    5. Centrifugeer de plaat gedurende 30 minuten bij 1.150 xg en 30 ° C.
    6. achteruitCentrifugeren, incubeer de cellen gedurende een nacht (O / N) bij 37 ° C in 5% CO2.
    7. De volgende dag, overdragen de getransduceerde cellen naar een matrix beklede put. Centrifugeer de plaat bij 1,150 xg gedurende 30 minuten bij 30 ° C.
    8. Na centrifugeren, verwijder de supernatant, voeg 1 ml iPSC medium toe en houd de cellen O / N bij 37 ° C in 5% CO 2 .
    9. Houd de bijgeleverde cellen bij 37 ° C en 5% CO2 vast. Verander het medium dagelijks, vervang het met vers iPSC-medium.
      OPMERKING: Kolonies verschijnen op dag 14-21 na transductie.
  2. EB generatie
    1. Houd de hiPSCs bij 37 ° C en 5% CO 2 . Verander het medium dagelijks, vervang het met verse Essential 8 (E8) medium.
    2. Bereid 2 x 10 6 hiPSC's in een vitronectine gecoate, 100 mm schaal in E8 medium.
    3. Verwijder het E8-medium uit de kweekschotel en wassen met steriele fosfaatgebufferde zoutoplossing (PBS).
    4. Voeg 1 toeMl 1 mM ethylendiaminetetraazijnzuur (EDTA) en incubeer bij 37 ° C en 5% CO 2 gedurende 2 minuten.
    5. Oog de cellen met 3 ml E8-medium en breng ze over naar een nieuwe 15-ml conische buis. Centrifugeer de cellen bij 250 xg bij kamertemperatuur (RT) gedurende 2 minuten.
    6. Aspirateer de supernatant zonder de celpellet te storen en de cellen opnieuw te suspenderen in 5 ml E8-medium.
    7. Tel de cellen met behulp van een hemocytometer en berei 2 x 10 6 cellen voor elke 100 mm Petri schotel. Resuspendeer de bereide cellen in een 10 ml mengsel van E8 en EB medium (1: 1) met 10 μM rho geassocieerde kinase (ROCK) inhibitor.
    8. Incubeer de cellen O / N voor aggregatie bij 37 ° C en 5% CO2.
    9. Op de volgende dag, geoogst de geaggregeerde EB's door pipettering. Centrifugeer de cellen bij 250 xg gedurende 1 minuut. Verwijder de supernatant en resuspendeer de EB's in 10 ml vers E8 medium.
    10. Vergroot de gegenereerde EB's gedurende 5 dagen, met dagelijkse veranderingen met fresH E8 medium. Voor verdere rijping, verander het kweekmedium naar E7 medium. Houd de EB's bij 37 ° C en 5% CO 2 gedurende nog eens 5 dagen, en voer dagelijkse medium veranderingen uit met vers E7 medium.
      OPMERKING: E7 medium is E8 medium zonder FGF2.
  3. Uitgroei celinductie van EB's
    1. Voeg 6 ml 1% gelatine toe aan een 100 mm schaal en incubeer bij 37 ° C en 5% CO 2 gedurende 30 minuten.
    2. Verwijder de gelatine en droog de schotel volledig gedurende 2-3 uur voor gebruik.
    3. Breng de EB's over naar een 50 ml conische buis. Laat de EB's losmaken op de bodem van de conische buis. Verwijder de supernatant zonder de EB's te storen.
    4. Resuspendeer de EB's in 10 ml medium van Dulbecco's Modified Eagle (DMEM) met 20% foetaal runder serum (FBS). Breng de EB's naar de gelatine gecoate, 100 mm schotel. Voeg 10 μM ROCK remmer toe.
    5. Incubeer en onderhou de cellen bij 37 ° C en 5% CO2 gedurende 7 dagen. Thema veranderenDium elke andere dag zonder toevoeging van ROCK-remmer.
  4. Chondrogeen pelletvorming
    1. Aspiratie van het kweekmedium uit de schotel en wassen de cellen drie keer met PBS.
    2. Breng 1 ml 1 mM EDTA aan en incubeer bij 37 ° C en 5% CO 2 gedurende 2 minuten.
    3. Oog de cellen met 5 ml DMEM met 20% FBS en verplaats ze naar een nieuwe 15-ml conische buis.
    4. Centrifugeer de cellen gedurende 2 minuten bij 250 xg en RT. Gooi de supernatant weg en verwijder de pellet in 10 ml DMEM met 20% FBS.
    5. Filter en wis de celklompen met behulp van een 40 μm celfilter en oog de enkele cellen op. Tel de enkele cellen met behulp van een hemocytometer.
    6. Centrifugeer de cellen gedurende 2 minuten bij 250 xg en RT. Verwijder de supernatant en zaad 3 x 10 5 cellen per pellet in een 15 ml conische buis met 300 μl chondrogeen differentiatie medium (CDM).
    7. Centrifugeer de cellen gedurende 5 minuten bij pelletvorming680 xg en RT.
      OPMERKING: De pellets worden gehandhaafd in 15 ml conische buizen tijdens de differentiatie van de chondrogeenpellets.
    8. Incubeer de cellen gedurende de nacht bij 37 ° C en 5% CO2.
    9. Verander de CDM om de 2-3 dagen. Binnen 3 dagen zullen pellets versteekte, bolvormige morfologieën vertoonden. Houd de pellets gedurende 21 dagen bij 37 ° C en 5% CO 2 .

2. Chondrogeen Pellet Karakterisering Door Staining

  1. Chondrogeen embedding
    1. Voor het inbedden, bereiden en smelten paraffine bij 58 ° C.
    2. Bevestig de pellets in 1 ml 4% paraformaldehyde gedurende 2 uur bij RT in een 1,5 ml buis.
      Voorzichtigheid: paraformaldehyde is zeer giftig. Vermijd contact met de ogen, de huid of de slijmvliezen. Vermijd blootstelling en vermijd inademing tijdens het bereiden.
    3. Plaats een laag gaas op de cassette en zet de vaste pellets over met een pipet. Bedek de pellet door te vouwenE gaas en sluit de cassette deksel.
    4. Begin dehydrering in 100 ml 70% ethanol (EtOH) tweemaal, 10 minuten elk. De pellets uitdrogen door opeenvolgende 10 minuten wassen in 80% en 95% EtOH.
    5. Breng de pellets over 10 minuten naar 100% EtOH. Herhaal driemaal met verse EtOH.
    6. Voor "clearing", wissel de oplossing voor een 100 ml, 1: 1 mengsel van EtOH en xyleen, gevolgd door een 1: 2 mengsel van EtOH en xyleen gedurende 10 minuten elk. Verwijder de resterende EtOH door de pellets tweemaal in 100% xyleen, 10 minuten elk, te incuberen.
    7. Voor paraffine-infiltratie, incubateer de pellets in opeenvolgende xyleen- en paraffine mengsels. Voer het volledige paraffine-infiltratieproces bij 58 ° C uit. Incubeer de pellets in 100 ml van een 2: 1 mengsel van xyleen en paraffine gedurende 30 minuten.
    8. Vervang de oplossing voor 100 ml van een 1: 1 mengsel van xyleen en paraffine en incubeer gedurende 30 minuten.
    9. Vervang de oplossing voor 100 ml van een 1: 2 mengsel van xyleen en paraffine en incubeer voor 30 min.
    10. Voor de laatste infiltratie, breng de pellets over naar het eerste bad van 100% paraffine en incubeer gedurende 2 uur.
    11. Breng de pellets over naar het tweede bad van 100% paraffine en incubeer O / N bij 58 ° C.
    12. Vervolg de volgende dag de pellets voorzichtig door middel van een pincet. Voeg paraffine toe aan de mal uit de paraffine dispenser. Stabiliseer de paraffine gedurende 30 min bij 4 ° C.
    13. Snijd de secties op 7 μm en plaats de secties op de glijbaan. Laat de glijbanen overnacht drogen en sla de glijbanen op RT totdat ze klaar zijn voor gebruik.
  2. Slide voorbereiding
    1. Deparaffinize de glijbanen door ze gedurende 5 minuten per 100 ml 100%, 90%, 80% en 70% EtOH achtereenvolgens te bewegen.
    2. Plaats de glijbanen in een glazen pot en spoel met kraanwater gedurende 5 minuten.
  3. Alcian blauw kleuring
    1. Incubeer de dia's in 50 ml 1% alcianblauwe oplossing gedurende 30 minuten.
      NIETE: Alcian blauw wordt verdund in 3% azijnzuuroplossing. Pas de pH op 2,5 met azijnzuur aan.
    2. Plaats de glijbanen in een glazen pot en spoel met kraanwater gedurende 2 minuten.
    3. Spoel de glijbanen in gedeïoniseerd water (DW) en tegenstain met nucleaire snel rode oplossing gedurende 2 minuten.
    4. Plaats de glijbanen in een glazen pot en spoel met kraanwater gedurende 1 minuut.
    5. 2.3.5) Ga verder met dehydratie en bevestig de glijbanen in stap 2.6.
  4. Toluidine blue staining
    1. Incubeer glijbanen in 50 ml toluidine blauwe oplossing gedurende 4 minuten.
    2. Plaats de glijbanen in een glazen pot en spoel met kraanwater gedurende 5 minuten.
    3. Ga verder met dehydratie en monteer de dia's in stap 2.6.
  5. Immunohistochemische kleuring
    1. Incubeer de dia's in 3% H202 gedurende 15 minuten voor endogene peroxidase-blokkering.
    2. Breng 200 μL primair antilichaam (anti-COL1A1 en -COL2A1) op 1: 100 verdund in tris-buGefrituurde zoutoplossing (TBS) die 1% boviene serumalbumine (BSA) en 5% normaal geiten serum (NGS) op de glijbanen bevat en incubatie O / N bij 4 ° C.
    3. De volgende dag plaatst u de glijbanen in een glazen pot en wast u deze met 50 ml TBS, die 0,1% polysorbaat 20 (TBST) drie keer per 5 minuten bevatten.
    4. Breng 200 μl secundair antilichaam (geit anti-konijn IgG-antilichaam, verdund 1: 200 in TBS bevattende 1% BSA en 5% NGS) aan de glijbanen toe en incubeer bij 40 minuten bij kamertemperatuur.
    5. Plaats de glijbanen in een glazen pot en was ze drie keer met 50 ml, 5 min elk.
    6. Voor signaalversterking, gebruik HRP-conjugaat streptavidine oplossing op de glijbanen en incubeer gedurende 10 minuten.
    7. Plaats de glijbanen in een glazen pot en was ze drie keer met 50 ml, 5 min elk.
    8. Meng de DAB-peroxidase substraatoplossing, breng 200 μL oplossing aan elke dia, en incubeer gedurende 1 minuut.
    9. Plaats de glijbanen in een glazen pot en spoel met kraanwater gedurende 5 minuten.
    10. tegenkleuringMet Mayer's hematoxyline gedurende 1 minuut.
    11. Was de glijbanen met DW.
    12. Ga verder met dehydratie en monteer de dia's in stap 2.6.
  6. Uitdroging en montage
    1. Ontduik de glijbanen door ze achtereenvolgens te bewegen door 100 ml 70%, 80%, 90% en 100% EtOH, 30 s elk.
    2. Dip de dia's in twee veranderingen van xyleen gedurende 1 min elk.
    3. Voeg 50 μL montageoplossing toe aan de deklagen en plaats de glijbanen bovenop.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

In deze studie hebben we chondrogeenpellets van CBMC-hiPSCs gegenereerd door uitgroei cellen van EB's te induceren. Chondrogene differentiatie werd geïnduceerd door middel van CBMC-hiPSC's met bevestigde hoge pluripotentie 11 . Een eenvoudige regeling van ons protocol is weergegeven in figuur 1A . Vóór differentiatie werden iPSC kolonies uitgebreid ( Figuur 1B ). De uitgebreide iPSCs werden samengesteld als EBs om differentiatie te initiëren ( Figuur 1C ). De gegenereerde EB's werden bevestigd aan gelatine-gecoate gerechten om uitgroei cellen te induceren ( Figuur 1D ). Vervolgens werden de uitgroeicellen geoogst en gebruikt om chondrogeenpellets te genereren. Na 21 dagen van differentiatie werden kleine, kraalachtige chondrogeenpellets verkregen en gebruikt voor verdere karakterisering ( Figuur 1E ). De kwaliteit van de in vitro gegenereerde chonDroge pellets werden bevestigd door middel van verschillende assays.

We hebben histologisch de kwaliteit van de chondrogeenpellets op dag 21 geëvalueerd. BMSC chondrogeenpellets werden gebruikt als de positieve controle. De accumulatie van ECM-eiwitten, gescheiden door de gedifferentieerde chondrocyten, werd bevestigd door alcianblauw en toluidine blauwkleuren in figuur 2A . De belangrijkste kenmerken van gezond kraakbeen, zoals lacuna en proteoglycanproductie, toegenomen, aangezien het differentiatieproces gedurende 21 dagen voortgezet werd. Chondrogen pellets gegenereerd uit CBMC-hiPSC's uiten COL2A1, die de belangrijkste ECM component in gezond kraakbeen is ( Figuur 2B ). De COL2A1 expressie van CBMC-hiPSC afgeleide pellets was hoger dan die van BMSC afgeleide pellets. De expressie van collageen type I, een marker voor fibrotische kraakbeen, was lager in CBMC-hiPSC afgeleide pellets vergeleken met de expressie van COL2A1. De gen expressie van kraakbeen ECM eiwitten in dag 21 chondrogeen pellets werd bevestigd door real-time PCR. De aggrecan (ACAN) expressie van CBMC-hiPSC afgeleide pellets was vergelijkbaar met die van BMSC-afgeleide pellets ( Figuur 3A ). De expressie van COL2A1 was significant hoger in CBMC-hiPSC-afgeleide pellets ( Figuur 3B ). De expressie van geslachtsbepalende regio Y-box 9 (Sox9), een chondrogeen stamvader, werd ook geëvalueerd. Pellets gegenereerd uit CBMC-hiPSCs uiten hoge niveaus van Sox9 ( Figuur 3C ). We hebben bevestigd dat deze genen in dag 21 aanzienlijk werden geherreguleerd in CBMC-hiPSC chondrogeenpellets in vergelijking met BMSC controlepellets. De expressie van een hypertrofe marker, COL1A1, werd geëvalueerd ( Figuur 3D ). De expressie van COL1A1 in CBMC-hiPSC-afgeleide pellets werd verlaagd vergeleken met die in BMSC-deriVed pellets. De differentiatie-efficiëntie werd geanalyseerd door de verhouding van COL2A1 tot COL1A1 ( Figuur 3E ). De toename van de verhouding in CBMC-hiPSC-afgeleide pellets toonde de relatief hoge expressie van COL2A1 in vergelijking met COL1A1. Ten slotte hebben we de chondrogeen differentiatiecapaciteit van CBMC-hiPSC's bevestigd. De kwaliteit van de gegenereerde chondrogeenpellets van CBMC-hiPSC had een kwaliteit die compatibel is met die van BMSC's.

Figuur 1
Figuur 1: Chondrogenische differentiatie van hiPSCs. ( A ) Schema van chondrogeenpelletengeneratie uit hiPSCs. ( B ) Morfologie van de gegenereerde CBMC-hiPSC. ( C ) Morfologie van gegenereerde EB's. ( D ) Uitgroei cellen afgeleid van EB's gehecht aan een gelatine gecoate kweekschotel. ( E ) Afbeelding van t Hij chondrogeen pellet na 21 dagen van differentiatie. De eenheden van de intervallen worden in millimeter weergegeven. Schaalstaven = 200 μm. Klik hier om een ​​grotere versie van deze figuur te bekijken.

Figuur 2
Figuur 2: Histologische analyse van de chondrogeenpelletje. ( A ) Histologische evaluatie van chondrogeenpellets op dag 21 met behulp van alcianblauw en toluidine blauwkleuring. ( B ) Immunohistochemie beeld van chondrogeenpellets gekleurd met COL1A1 en COL2A1 antilichamen. Schaalstaven = 100 μm. Klik hier om een ​​grotere versie van deze figuur te bekijken.

1" > Figuur 3
Figuur 3: Gene expressie van de chondrogeenpelletje. ( A ) Relatieve genuitdrukking van ACAN. ( B ) Relatieve genuitdrukking van COL2A1. ( C ) Relatieve genuitdrukking van SOX9. ( D ) Relatieve genuitdrukking van COL1A1. ( E ) Gene expressie van COL1A1. ( F ) Gene expressie van COL10A1. ( G ) De verhouding van COL2A1: COL1A1 genuitdrukking. Pellets werden geoogst en geanalyseerd na 21 dagen van differentiatie. Gegevens werden verkregen met real-time PCR en weergegeven als de gemiddelde standaardfout van drievoudige experimenten per monster (n = 3). De genuitdrukking werd genormaliseerd aan GAPDH als een interne controle. (* P <0,05, ** p <0,01, *** p <0,001).K "> Klik hier om een ​​grotere versie van deze figuur te zien.

Gsm-nummer Uitgroei cel opbrengst Pelletopbrengst
hiPSCs 2 x 10 6 2-5 x 10 7 70-150
MSC 2 x 10 6 - 6

Tabel 1: Opbrengstvergelijking van MSC en hiPSCs.

Doelnaam Richting Primer Sequence Grootte
Vooruit TTCCGCGACGTGGACAT 77 bp
Omgekeerde TCAAACTCGTTGACATCGAAGGT
EEN BLIKJE Vooruit AGCCTGCGCTCCAATGACT 107 bp
Omgekeerde TAATGGAACACGATGCCTTTCA
COL2A1 Vooruit GGCAATAGCAGGTTCACGTACA 79 bp
Omgekeerde CGATAACAGTCTTGCCCCACTTA
COL1A1 Vooruit CCCCTGGAAAGAATGGAGATG 148 bp
Omgekeerde TCCAAACCACTGAAACCTCTG

Tabel 2: Sequenties van primers tegen chondrogeen markers in real-time PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Dit protocol heeft succesvolle hiPSC's van CBMC's gegenereerd. We herprogrammeerde CBMC's aan hiPSCs met behulp van een Sendai virale vector die Yamanaka-factoren 24 bevat . Drie gevallen werden gebruikt in differentiatie, en alle experimenten hebben succesvol chondrogeenpellets op basis van dit protocol gegenereerd. Talrijke studies hebben protocols voor de differentiatie van hiPSCs gemeld in chondrocyten 25 , 26 , 27 , 28 . Echter, extra onderzoek is nodig om het gebruik van CBMC-hiPSCs een kandidaat voor kraakbeenregeneratie en herstel te bevestigen.

Chondrogenese werd bevestigd met behulp van hiPSCs gegenereerd uit verschillende somatische cel typen 11 , 25 , 26 , 27 , 29 . Vele rapporten tonen aanDat de oorsprong van de somatische cel die bij herprogrammering wordt gebruikt, het differentiatie-resultaat van de hiPSCs 30 , 31 , 32 , 33 kan beïnvloeden. Snoerbloed is een bron verrijkt met HSC's en MSC's. Er is geen melding gemaakt van het verschil tussen bloedcellen van bloedkoord, zoals bloedcellen of MSC's. Echter, eerdere studies hebben aangetoond dat articulair chondrocyt-afgeleide hiPSC's meer kans hebben op chondrogenese dan hiPSC's die worden gegenereerd uit koordbloed of huidfibroblasten 29 . Resultaten van endotheliale differentiatie met behulp van hiPSC's gegenereerd uit fibroblasten, hartprogenitorcellen en endotheliale cellen aangetoond dat het weefsel van herkomst het weefselspecifieke somatische geheugen kan weerspiegelen in terminale gedifferentieerde iPSC-afleiding, in het bijzonder bij vroege gangen, tussen 10 en 20 34 . In vroege gangen van hiPSCs, endotheliale cel-deriBij hiPSCs gedifferentieerd meer efficiënt in de endotheliale lijn. Het significante verschil tussen deze cellijnen verdween echter in hiPSCs over 20 passages. Daarom is het belangrijk om de somatische herinnering die in de vroege gangen door de hiPSC's wordt gedragen, zorgvuldig te overwegen wanneer ze worden gebruikt in klinisch onderzoek.

Onlangs zijn verschillende procedures ontwikkeld om defecte gewrichtskraakbeen te herstellen. Microfractuur wordt gedaan door meerdere gaten in het bot te boren om de instroming van beenmerg voor natuurlijke herstel 35 te veroorzaken. Knievervanging, ook bekend als knie-artroplastie, wordt gebruikt om de beschadigde kraakbeen te vervangen. Microfractuur is echter niet bruikbaar voor ernstige gewrichtskraakbeenbeschadiging, en het instrument dat wordt gebruikt voor knievervangingen moet elke 10-15 jaar worden gewijzigd.

Tegenwoordig zijn celtherapieën een veelbelovende alternatieve methode voor kraakbehandeling. Autologe chondrocyt implantatie (ACI) is breedHet is gebruikt voor cellulaire kraakbeenherstel. ACI wordt gedaan door autologe chondrocyten direct in het defect te injecteren. Autologe chondrocyten veranderen echter in fibroblastachtige cellen onder in vitro kweekomstandigheden. Extra schade is ook onvermijdelijk tijdens het oogsten van autologe chondrocyten. MSC's zijn voorgesteld als celbron voor kraakbeenherstel. Koord bloed is een nuttige en toegankelijke celbron van MSC's voor ingenieursbrekens 36 . De succesfrequentie voor het isoleren van koord-bloed-MSC's is echter controversieel 37 , 38 . Talrijke studies rapporteren over de succesvolle isolatie van cord-blood MSCs. Verscheidene studies hebben aangetoond dat het bloedvolume van het koord een kritische parameter is die het opbrengstpercentage van MSC-isolatie 36 , 39 kan beïnvloeden. Om hoge kwaliteit MSC's te verwerven, is de doorgang van de cellen ook kritisch. Vorige studies geven aan datT MSC's hebben een beperkte levensduur na een bepaald celverdelingsnummer. Door de senescence binnen te gaan, worden MSC's gekenmerkt door verminderde proliferatie, zoals bij elke normale somatische cel 40 . Daarom moeten bloedcirculatie-MSC's worden gebruikt voor de zesde passage om celzences en chromosomale afwijkingen te voorkomen 41 .

Om deze beperkingen te vermijden, heeft de menselijke iPSCs een nieuwe mogelijkheid geopend voor gepersonaliseerde, cel-gebaseerde therapie met hoge productiviteit 11 . Gevestigde hiPSC's kunnen theoretisch onbeperkte verspreiden. Ook, met dezelfde immuunidentiteit als de donor, kunnen ze afwijzing en lagere bijwerkingen vermijden wanneer ze in vivo worden geïmplanteerd. De overgang van bloedbloedbanken naar hiPSC-banken voor allogene medische behandeling heeft een enorme mogelijkheid en potentieel 42 . De screening van homozygote HLA-getypeerde CBMC's voor herprogrammering kan op grote schaal de allogene iPSC lijnen gebruiken voorKlinische behandeling. Homozygote iPSC lijnen kunnen immunologische reacties na de transplantatie van de transplantatie vermijden. Dit concept kan ook toegepast worden op kraakbeenregeneratie door HLA-homozygote kraakbeen 11 te genereren.

Gewoonlijk wordt chondrogene differentiatie uitgevoerd door twee kritische stappen: de inductie van EB-afgeleide uitgroei cellen en pelletvorming. De initiële differentiatie van hiPSC's in EB-afgeleide uitgroeicellen is van cruciaal belang om hun chondrogeen differentiatiepotentieel te verhogen. Uitgroei cellen die zijn onderscheiden van hiPSCs functioneel en molecuul vergelijkbaar met native BMSCs 7 , 43 . Eerdere studies gebruikten monolaagcultuur of EB-cultuur als een pre-differentiatie stap om mesenchymale-achtige cellen 10 , 43 te induceren. Directe differentiatie door monolaagcultuur is echter tijdrovend in vergelijking met het gebruik van EB's en ch Ondrogene pellets hebben de neiging om te onderscheiden in fibrocartilage met hypertrofe eigenschappen. Er werd gemeld dat celmorfologie en het chondrogeen differentiatiepotentieel van gegenereerde mesenchymal-achtige stamcellen sterk verschillen naargelang de celdichtheid van de celmonolaag 9 .

We hebben EB's gebruikt om uitgroei cellen te induceren, wat een relatief snelle en eenvoudige methode is in vergelijking met de monolayer cultuur. Met behulp van dit protocol kunnen we veel pellets genereren met een relatief klein aantal hiPSC's ( tabel 1 ). De grootte en het aantal EB's waren van cruciaal belang voor succesvolle chondrogeenpelletmassa productie. Om die reden hebben we de geaggregeerde EB's in E8-medium vergroot, tot meer dan de helft van de gegenereerde EB's groter was dan 100 μm. Na de EB-uitbreiding behouden we de EB's in E8-medium zonder FGF2. Eerder bevonden onderzoekers gegenereerde EB's zonder FGF2 voor mesodermale lijninductieXref "> 9.

Hoewel we geprobeerd hebben om de gegenereerde uitgroei cellen op een hoge dichtheid te behouden voor betere kwaliteit, blijven er nog enkele beperkingen. Terwijl we hebben bevestigd dat de gegenereerde uitgroei cellen een soortgelijke morfologie delen, kunnen de cellen nog steeds heterogeen zijn. Vorige studies hebben geprobeerd te sorteren voor een specifiek celtype; Deze procedure heeft echter geleid tot het verzamelen van een laag aantal cellen. Een nieuwe poging om homogene uitgroei cellen op grotere schaal te isoleren zal nodig zijn om een ​​grote hoeveelheid chondrogeenpellets te genereren met verbeterde eigenschappen.

Verschillende groepen stimuleren stamcellen van hiPSCs door gebruik te maken van monolaag- of EB-cultuur. De inductie van stamcellen met een hoge gelijkenis met MSC's kan de sleutel zijn voor het verkrijgen van chondrogeenpellets van hogere kwaliteit. Deze stamcellen afgeleid van EB's hebben kenmerken die vergelijkbaar zijn met die van MSC's. Dit kan echter door deIr fibroblastische aard. Daarom is een gedetailleerde validatie studie op de uitgroei cellen nodig.

In deze studie stellen wij voor een protocol dat een relatief grote hoeveelheid chondrogeenpellets kan genereren. We hebben bevestigd dat het kraakbeen dat door middel van CBMC-hiPSC's is geregenereerd, een gezond fenotype heeft getoond en kan gebruikt worden als materiaal voor weefselregeneratie. Echter, een verbeterde methode met een kortere differentiatie tijdlijn is nodig voor verdere toepassing. De verdere ontwikkeling van kwaliteitscontrole normen voor het valideren van kraakbeen met een hoger niveau van hyaline is ook nodig voor toekomstige toepassingen van CBMC-hiPSCs als celmateriaal voor kraakbeenregeneratie. Het protocol is eenvoudig maar effectief en vereist geen extra sorteerprocessen voor pelletvorming. Concluderend, door gebruik te maken van dit protocol, kunnen hoogwaardige chondrogeenpellets gegenereerd worden voor studies over ziekte-modellering, drugscreening en regeneratieve geneeskunde om ons begrip van t te bevorderenHij de aard van kraakbeen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgements

Dit werk werd ondersteund door een subsidie ​​van het Koreaanse Gezondheidszorg Technology R & D project, ministerie van Volksgezondheid, Welzijn & Gezin, Republiek Korea (HI16C2177).

Materials

Name Company Catalog Number Comments
Plasticware
100 mm Dish TPP 93100
6-well Plate TPP 92006
50 mL Cornical Tube SPL 50050
15 mL Cornical Tube SPL 50015
10 mL Disposable Pipette Falcon 7551
5 mL Disposable Pipette Falcon 7543
12-well Plate TPP 92012
Name Company Catalog Number Description
E8 Medium Materials
DMEM/F12, HEPES Life Technologies 11330-057 E8 Medium (500 mL)
Sodium Bicarbonate Life Technologies 25080-094 E8 Medium (Conc.: 543 μg/mL)
Sodium Selenite Sigma Aldrich S5261 E8 Medium  (Conc.: 14 ng/mL)
Human Transfferin Sigma Aldrich T3705 E8 Medium (Conc.: 10.7 μg/mL)
Basic FGF2 Peprotech 100-18B E8 Medium  (Conc.: 100 ng/mL)
Human Insulin Life Technologies 12585-014 E8 Medium (Conc.: 20 μg/mL)
Human TGFβ1 Peprotech 100-21 E8 Medium (Conc.: 2 ng/mL)
Ascorbic Acid Sigma Aldrich A8960 E8 Medium  (Conc.: 64 μg/mL)
DPBS Life Technologies 14190-144
Vitronectin Life Technologies A14700
ROCK Inhibitor Sigma Aldrich Y0503
Name Company Catalog Number Description
Quality Control Materials
18 mm Cover Glass Superior HSU-0111580
4% Paraformaldyhyde Tech & Innovation BPP-9004
Triton X-100 BIOSESANG 9002-93-1
Bovine Serum Albumin Vector Lab SP-5050
Anti-SSEA4 Antibody Millipore MAB4304
Anti-Oct4 Antibody Santa Cruz SC9081
Anti-TRA-1-60 Antibody Millipore MAB4360
Anti-Sox2 Antibody Biolegend 630801
Anti-TRA-1-81 Antibody Millipore MAB4381
Anti-Klf4 Antibody Abcam ab151733
Alexa Fluor 488 goat anti-mouse IgG (H+L) antibody Molecular Probe A11029
Alexa Fluor 594 goat anti-rabbit IgG (H+L) antibody Molecular Probe A11037
DAPI Molecular Probe D1306
Prolong gold antifade reagent Invitrogen P36934
4% Paraformaldyhyde Tech & Innovation BPP-9004
Tween 20 BIOSESANG T1027
Bovine Serum Albumin Vector Lab SP-5050
Anti-Collagen II antibody abcam  ab34712 1:100
Alcian blue Sigma Aldrich A3157-10G
Fast Green FCF Sigma Aldrich F7252-25G
Safranin O Sigma Aldrich 090m0039v
Nuclear fast red Americanmastertech STNFR100 
xylene Duksan 115 
Ethanol Duksan 64-17-5
Mayer's hematoxylin solution wako pure chemical industries LAK7534
DAP VECTOR LABORATORIES SK-4100
Slide Glass, Coated Hyun Il Lab-Mate HMA-S9914
Trizol Invitrogen 15596-018
Chloroform Sigma Aldrich 366919
Isoprypylalcohol Millipore 109634
Ethanol Duksan 64-17-5
RevertAid First Strand cDNA Synthesis kit Thermo Scientfic K1622
Name Company Catalog Number Description
Chondrogenic Differentiation Materials
DMEM Life Technologies 11885 Chondrogenic media component (500 mL)
Penicilin Streptomycin Life Technologies P4333 Chondrogenic media component (Conc.: 1%)
Ascorbic Acid Sigma Aldrich A8960 Chondrogenic media component (Conc.: 64 μg/mL) 
MEM Non-Essential Amino Acids Solution (100x) Life Technologies 11140-050 Chondrogenic media component (Conc.: 100 mM)
rhBMP-2 R&D 355-BM-050 Chondrogenic media component (Conc.:100 ng/ml)
Recombinant Hman TGF-beta3 R&D 243-B3-002 Chondrogenic media component (Conc.:10 ng/ml)
KnockOut Serum Replacement Life Technologies 10828-028 Chondrogenic media component (Conc.: 1%)
ITS+ Premix BD 354352 Chondrogenic media component (Conc.: 1%)
Dexamethasone-Water Soluble  Sigma Aldrich D2915-100MG Chondrogenic media component (Conc.:10-7 M)
GlutaMAX Supplement Life Technologies 35050-061 Chondrogenic media component (Conc.: 1%)
Sodium pyruvate solution Sigma Aldrich S8636 Chondrogenic media component (Conc.: 1%)
L-Proline Sigma Aldrich P5607-25G Chondrogenic media component (40 μg/ml)

DOWNLOAD MATERIALS LIST

References

  1. van Osch, G. J., et al. Cartilage repair: past and future--lessons for regenerative medicine. J Cell Mol Med. 13, (5), 792-810 (2009).
  2. Ahmed, T. A., Hincke, M. T. Strategies for articular cartilage lesion repair and functional restoration. Tissue Eng Part B Rev. 16, (3), 305-329 (2010).
  3. Diekman, B. O., et al. Cartilage tissue engineering using differentiated and purified induced pluripotent stem cells. Proc Natl Acad Sci USA. 109, (47), 19172-19177 (2012).
  4. Solchaga, L. A., Penick, K., Goldberg, V. M., Caplan, A. I., Welter, J. F. Fibroblast growth factor-2 enhances proliferation and delays loss of chondrogenic potential in human adult bone-marrow-derived mesenchymal stem cells. Tissue Eng Part A. 16, (3), 1009-1019 (2010).
  5. Guzzo, R. M., Drissi, H. Differentiation of Human Induced Pluripotent Stem Cells to Chondrocytes. Methods Mol Biol. 1340, 79-95 (2015).
  6. Drissi, H., Gibson, J. D., Guzzo, R. M., Xu, R. H. Derivation and Chondrogenic Commitment of Human Embryonic Stem Cell-Derived Mesenchymal Progenitors. Methods Mol Biol. 1340, 65-78 (2015).
  7. Nejadnik, H., et al. Improved approach for chondrogenic differentiation of human induced pluripotent stem cells. Stem Cell Rev. 11, (2), 242-253 (2015).
  8. Teramura, T., et al. Induction of mesenchymal progenitor cells with chondrogenic property from mouse-induced pluripotent stem cells. Cell Reprogram. 12, (3), 249-261 (2010).
  9. Koyama, N., et al. Human induced pluripotent stem cells differentiated into chondrogenic lineage via generation of mesenchymal progenitor cells. Stem Cells Dev. 22, (1), 102-113 (2013).
  10. Ko, J. Y., Kim, K. I., Park, S., Im, G. I. In vitro chondrogenesis and in vivo repair of osteochondral defect with human induced pluripotent stem cells. Biomaterials. 35, (11), 3571-3581 (2014).
  11. Nam, Y., Rim, Y. A., Jung, S. M., Ju, J. H. Cord blood cell-derived iPSCs as a new candidate for chondrogenic differentiation and cartilage regeneration. Stem Cell Res Ther. 8, (1), 16 (2017).
  12. Hotten, G. C., et al. Recombinant human growth/differentiation factor 5 stimulates mesenchyme aggregation and chondrogenesis responsible for the skeletal development of limbs. Growth Factors. 13, (1-2), 65-74 (1996).
  13. Murphy, M. K., Huey, D. J., Hu, J. C., Athanasiou, K. A. TGF-beta1, GDF-5, and BMP-2 stimulation induces chondrogenesis in expanded human articular chondrocytes and marrow-derived stromal cells. Stem Cells. 33, (3), 762-773 (2015).
  14. Shintani, N., Siebenrock, K. A., Hunziker, E. B. TGF-ss1 enhances the BMP-2-induced chondrogenesis of bovine synovial explants and arrests downstream differentiation at an early stage of hypertrophy. PLoS One. 8, (1), e53086 (2013).
  15. Fukumoto, T., et al. Combined effects of insulin-like growth factor-1 and transforming growth factor-beta1 on periosteal mesenchymal cells during chondrogenesis in vitro. Osteoarthritis Cartilage. 11, (1), 55-64 (2003).
  16. Worster, A. A., Nixon, A. J., Brower-Toland, B. D., Williams, J. Effect of transforming growth factor beta1 on chondrogenic differentiation of cultured equine mesenchymal stem cells. Am J Vet Res. 61, (9), 1003-1010 (2000).
  17. Knippenberg, M., et al. Differential effects of bone morphogenetic protein-2 and transforming growth factor-beta1 on gene expression of collagen-modifying enzymes in human adipose tissue-derived mesenchymal stem cells. Tissue Eng Part A. 15, (8), 2213-2225 (2009).
  18. Jang, Y., et al. Centrifugal gravity-induced BMP4 induces chondrogenic differentiation of adipose-derived stem cells via SOX9 upregulation. Stem Cell Res Ther. 7, (1), 184 (2016).
  19. Kang, R., et al. Mesenchymal stem cells derived from human induced pluripotent stem cells retain adequate osteogenicity and chondrogenicity but less adipogenicity. Stem Cell Res Ther. 6, 144 (2015).
  20. Tao, H., et al. Biological evaluation of human degenerated nucleus pulposus cells in functionalized self-assembling peptide nanofiber hydrogel scaffold. Tissue Eng Part A. 20, (11-12), 1621-1631 (2014).
  21. Sekiya, I., Larson, B. L., Vuoristo, J. T., Reger, R. L., Prockop, D. J. Comparison of effect of BMP-2, -4, and -6 on in vitro cartilage formation of human adult stem cells from bone marrow stroma. Cell Tissue Res. 320, (2), 269-276 (2005).
  22. Shen, B., Wei, A., Tao, H., Diwan, A. D., Ma, D. D. BMP-2 enhances TGF-beta3-mediated chondrogenic differentiation of human bone marrow multipotent mesenchymal stromal cells in alginate bead culture. Tissue Eng Part A. 15, (6), 1311-1320 (2009).
  23. Rim, Y. A., Nam, Y., Ju, J. H. Induced Pluripotent Stem Cell Generation from Blood Cells Using Sendai Virus and Centrifugation. J Vis Exp. (118), (2016).
  24. Kim, Y., et al. The Generation of Human Induced Pluripotent Stem Cells from Blood Cells: An Efficient Protocol Using Serial Plating of Reprogrammed Cells by Centrifugation. Stem Cells Int. 2016, 1329459 (2016).
  25. Oldershaw, R. A., et al. Directed differentiation of human embryonic stem cells toward chondrocytes. Nat Biotechnol. 28, (11), 1187-1194 (2010).
  26. Toh, W. S., et al. Differentiation and enrichment of expandable chondrogenic cells from human embryonic stem cells in vitro. J Cell Mol Med. 13, (9B), 3570-3590 (2009).
  27. Hwang, N. S., Varghese, S., Elisseeff, J. Derivation of chondrogenically-committed cells from human embryonic cells for cartilage tissue regeneration. PLoS One. 3, (6), e2498 (2008).
  28. Nakagawa, T., Lee, S. Y., Reddi, A. H. Induction of chondrogenesis from human embryonic stem cells without embryoid body formation by bone morphogenetic protein 7 and transforming growth factor beta1. Arthritis Rheum. 60, (12), 3686-3692 (2009).
  29. Guzzo, R. M., Scanlon, V., Sanjay, A., Xu, R. H., Drissi, H. Establishment of human cell type-specific iPS cells with enhanced chondrogenic potential. Stem Cell Rev. 10, (6), 820-829 (2014).
  30. Rim, Y. A., Park, N., Nam, Y., Ju, J. H. Generation of Induced-pluripotent Stem Cells Using Fibroblast-like Synoviocytes Isolated from Joints of Rheumatoid Arthritis Patients. J Vis Exp. (116), (2016).
  31. Pfaff, N., et al. Efficient hematopoietic redifferentiation of induced pluripotent stem cells derived from primitive murine bone marrow cells. Stem Cells Dev. 21, (5), 689-701 (2012).
  32. Xu, H., et al. Highly efficient derivation of ventricular cardiomyocytes from induced pluripotent stem cells with a distinct epigenetic signature. Cell Res. 22, (1), 142-154 (2012).
  33. Lee, S. B., et al. Contribution of hepatic lineage stage-specific donor memory to the differential potential of induced mouse pluripotent stem cells. Stem Cells. 30, (5), 997-1007 (2012).
  34. Hu, S., et al. Effects of cellular origin on differentiation of human induced pluripotent stem cell-derived endothelial cells. JCI Insight. 1, (8), 1-12 (2016).
  35. Vonk, L. A., de Windt, T. S., Slaper-Cortenbach, I. C., Saris, D. B. Autologous, allogeneic, induced pluripotent stem cell or a combination stem cell therapy? Where are we headed in cartilage repair and why: a concise review. Stem Cell Res Ther. 6, (94), 1-11 (2015).
  36. Gomez-Leduc, T., et al. Chondrogenic commitment of human umbilical cord blood-derived mesenchymal stem cells in collagen matrices for cartilage engineering. Sci Rep. 6, 32786 (2016).
  37. Mareschi, K., et al. Isolation of human mesenchymal stem cells: bone marrow versus umbilical cord blood. Haematologica. 86, (10), 1099-1100 (2001).
  38. Wexler, S. A., et al. Adult bone marrow is a rich source of human mesenchymal 'stem' cells but umbilical cord and mobilized adult blood are not. Br J Haematol. 121, (2), 368-374 (2003).
  39. Zhang, X., et al. Isolation and characterization of mesenchymal stem cells from human umbilical cord blood: reevaluation of critical factors for successful isolation and high ability to proliferate and differentiate to chondrocytes as compared to mesenchymal stem cells from bone marrow and adipose tissue. J Cell Biochem. 112, (4), 1206-1218 (2011).
  40. Wagner, W., et al. Replicative senescence of mesenchymal stem cells: a continuous and organized process. PLoS One. 3, (5), e2213 (2008).
  41. Tarte, K., et al. Clinical-grade production of human mesenchymal stromal cells: occurrence of aneuploidy without transformation. Blood. 115, (8), 1549-1553 (2010).
  42. Chen, W. C., et al. Prediction of poor survival by cyclooxygenase-2 in patients with T4 nasopharyngeal cancer treated by radiation therapy: clinical and in vitro studies. Head Neck. 27, (6), 503-512 (2005).
  43. Guzzo, R. M., Gibson, J., Xu, R. H., Lee, F. Y., Drissi, H. Efficient differentiation of human iPSC-derived mesenchymal stem cells to chondroprogenitor cells. J Cell Biochem. 114, (2), 480-490 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics