Formazione di pellet condensato da cellule staminali pluripotenti indotte dal sangue

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Qui proponiamo un protocollo di differenziazione condrogenica da cellule staminali pluripotenti indotte da cellule mononucleate del sangue cordonale.

Cite this Article

Copy Citation | Download Citations

Nam, Y., Rim, Y. A., Ju, J. H. Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells. J. Vis. Exp. (124), e55988, doi:10.3791/55988 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La cartilagine articolare umana manca la capacità di ripararsi. La degenerazione di cartilagine viene quindi trattata non da curative ma da trattamenti conservatori. Attualmente si stanno impegnando a rigenerare la cartilagine danneggiata con condrociti espansi ex vivo o cellule staminali mesenchimali derivate dal midollo osseo (BMSCs). Tuttavia, la restrittività e l'instabilità di queste cellule limitano la loro applicazione nella ricostruzione della cartilagine. Le cellule staminali pluripotenti indotte dall'uomo (hiPSCs) hanno ricevuto l'attenzione scientifica come una nuova alternativa per le applicazioni rigenerative. Con abilità illimitate di auto-rinnovamento e multipotenza, i hiPSCs sono stati evidenziati come una nuova sorgente di sostituzione cellulare per la riparazione della cartilagine. Tuttavia, l'ottenimento di un'elevata quantità di pellets condizionati di alta qualità è una sfida importante per la loro applicazione clinica. In questo studio abbiamo usato cellule embrionali (EB) derivate per la differenziazione condrogenica. La chondrogenesi di successo è stata confermata da PCRD con blu alcian, toluidina blu e anticorpi contro i tipi di collagene I e II (COL1A1 e COL2A1 rispettivamente). Forniamo un metodo dettagliato per la differenziazione dei iPSC (CBMC-hiPSCs) derivati ​​da cellule mononucleari di sangue del cordone in pellet condondenso.

Introduction

L'uso di hiPSC rappresenta una nuova strategia per lo screening dei farmaci e studi meccanistici di varie malattie. Da una prospettiva rigenerativa, i hiPSC sono anche una potenziale fonte per la sostituzione di tessuti danneggiati che hanno capacità di guarigione limitata, come la cartilagine articolare 1 , 2 .

La rigenerazione della cartilagine articolare nativa è stata una sfida per diversi decenni. La cartilagine articolare è un morbido tessuto bianco che copre la fine delle ossa, proteggendole dall'attrito. Tuttavia, ha una capacità di rigenerazione limitata quando è danneggiata, rendendo quasi impossibile l'auto-riparazione. Pertanto, la ricerca incentrata sulla rigenerazione della cartilagine è stata in corso per diversi decenni.

In precedenza, la differenziazione in vitro nel linfodondrogeno è stata normalmente eseguita con BMSC o condrociti naturali isolati dall'articolazione del ginocchio 3 . DovutoO il loro potenziale condrogenico, BMSC e condrociti nativi hanno numerosi meriti che sostengono il loro utilizzo nella condogenesi. Tuttavia, a causa della loro limitata espansione e del fenotipo instabile, queste cellule presentano numerose limitazioni nella ricostruzione dei difetti della cartilagine articolare. Sotto le condizioni di coltura in vitro , queste cellule tendono a perdere le proprie caratteristiche dopo 3-4 passaggi, che infine influenzano le loro capacità di differenziazione 4 . Inoltre, nel caso dei condrociti nativi, un danno aggiuntivo per il ginocchio è inevitabile quando si ottiene queste cellule.

A differenza di BMSC o di condrociti nativi, i hiPSCs possono espandersi indefinitamente in vitro . Con le condizioni di coltura adeguate, i hiPSC hanno un grande potenziale come fonte di ricambio per la differenziazione condrogenica. Tuttavia, è impegnativo cambiare le caratteristiche intrinseche di hiPSCs 5 . Inoltre, ci sono diversi complicati in vitro stePs per dirigere il destino di hiPSCs a un tipo specifico di cella. Nonostante queste complicazioni, l'uso di hiPSC è ancora raccomandato a causa delle loro elevate capacità di auto-rinnovamento e della loro capacità di differenziarsi in cellule mirate, compresi i condrociti 6 .

La differenziazione condrogenica è di solito effettuata con sistemi di coltura tridimensionali, come la coltura di pellet o la coltura di micromassi, utilizzando le cellule progenitrici MSC. Se si usa hiPSCs, il protocollo per generare le cellule progenie di MSC è diverso dai protocolli esistenti. Alcuni gruppi usano la cultura monolayer di hiPSC per convertire direttamente il fenotipo in cellule simili a MSC 7 . Tuttavia, la maggior parte degli studi utilizza EB per generare cellule di crescita che assomigliano a MSCs 8 , 9 , 10 , 11 .

Vari tipi di fattori di crescita sono utilizzati per indurre il chondrogeNesis. Di solito, le proteine ​​familiari BMP e TGFβ vengono utilizzate, da soli o in combinazione. La differenziazione è stata anche indotta con altri fattori, come GDF5, FGF2 e IGF1 12 , 13 , 14 , 15 . TGFβ1 è stato dimostrato di stimolare la condogenesi in modo dose-dipendente nei MSC 16 . Rispetto all'altro isotipo, TGFβ3, TGFβ1 induce la condogenesi aumentando la condensazione delle cellule mesenchimali pre-cartilagine. TGFβ3 induce la condogenesi aumentando significativamente la proliferazione cellulare mesenchimale 17 . Tuttavia, TGFβ3 viene utilizzato più frequentemente dai ricercatori di TGFβ1 7 , 10 , 18 , 19 . BMP2 aumenta l'espressione di geni relativi ai componenti della matrice condrogenica nell'uomoCondrociti articolari sotto condizioni in vitro 20 . BMP2 aumenta l'espressione di geni critici alla formazione di cartilagine nei MSC in combinazione con le proteine ​​TGFβ 21 . È stato inoltre dimostrato che BMP2 valorizza sinergicamente l'effetto di TGFβ3 attraverso i percorsi Smad e MAPK 22 .

In questo studio CBMC-hiPSCs sono stati aggregati in EB utilizzando mezzo EB in un piatto di Petri a basso assorbimento. Le cellule di crescita sono state indotte collegando i EB a un piatto rivestito di gelatina. La differenziazione condrogenica usando le cellule di crescita è stata eseguita con la coltura del pellet. Il trattamento con entrambi BMP2 e TGFβ3 ha condensato con successo le cellule e l'accumulo di proteine ​​della matrice extracellulare (ECM) indotta per la formazione di pellet condrogenico. Questo studio suggerisce un semplice ma efficace protocollo di differenziazione dei condensatori usando CBMC-hiPSCs.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Questo protocollo è stato approvato dal consiglio di revisione istituzionale dell'Università Cattolica della Corea (KC12TISI0861). I CBMC utilizzati per la riprogrammazione sono stati direttamente ottenuti dalla Banca di Cord Blood del Seoul St. Mary's Hospital.

1. Differenziazione condensata da iPSC

  1. Generazione CBMC-iPSC
    1. Generare CBMC-hiPSC utilizzando il protocollo mostrato nel nostro lavoro precedente 23 .
    2. Raccogliere le cellule del sangue in un tubo conico da 15 ml e contare con un emocitometro.
    3. Preparare 3 x 10 5 cellule e centrifugare per 5 minuti a 515 xg e RT. Scartare il surnatante aspirando e risospendere le cellule in 0,5 ml di mezzo di cellule del sangue.
    4. Trasferire le cellule in un pozzetto di una piastra non verniciata a 24 pozzetti e aggiungere la miscela di virus Sendai, seguendo le raccomandazioni del produttore.
    5. Centrifugare la piastra per 30 minuti a 1.150 xg e 30 ° C.
    6. A poppaCentrifugazione, incubare le cellule durante la notte (O / N) a 37 ° C in 5% CO 2 .
    7. Il giorno successivo, trasferire le cellule trasdotte in un pozzetto rivestito in matrice. Centrifugare la piastra a 1.150 xg per 30 minuti a 30 ° C.
    8. Dopo la centrifugazione, rimuovere il surnatante, aggiungere 1 mL di mezzo iPSC e mantenere le cellule O / N a 37 ° C in 5% CO 2 .
    9. Mantenere le cellule collegate a 37 ° C e 5% CO 2 . Cambiare il supporto giornaliero, sostituendolo con il nuovo mezzo iPSC.
      NOTA: le colonie appaiono il giorno 14-21 dopo la trasduzione.
  2. Generazione di EB
    1. Mantenere i hiPSC a 37 ° C e 5% CO 2 . Cambiare il supporto giornaliero, sostituendolo con un nuovo supporto Essential 8 (E8).
    2. Preparare 2 x 10 6 hiPSC in un piatto da 100 mm rivestito in vitronectina nel mezzo E8.
    3. Rimuovere il mezzo E8 dal piatto di coltura e lavare con la soluzione salina fosfata tamponata sterile (PBS).
    4. Aggiungi 1Ml di 1 mM di acido etilendiammina-tetraacetico (EDTA) e incubare a 37 ° C e 5% di CO 2 per 2 min.
    5. Raccogliere le cellule con 3 ml di media E8 e trasferirle in un nuovo tubo conico da 15 ml. Centrifugare le cellule a 250 xg a temperatura ambiente (RT) per 2 min.
    6. Aspirare il surnatante senza disturbare il pellet cellulare e risospendere le cellule in 5 ml di mezzo E8.
    7. Conte le cellule usando un emocitometro e preparare 2 x 10 6 cellule per ogni piatto di Petri da 100 mm. Resuspendere le cellule preparate in una miscela da 10 mL di E8 ed EB (1: 1) con 10 μM inibitore rho-associato chinasi (ROCK).
    8. Incubare le cellule O / N per l'aggregazione a 37 ° C e 5% CO 2 .
    9. Il giorno successivo, raccogliere le EB aggregate pipettando. Centrifugare le cellule a 250 xg per 1 min. Rimuovere il surnatante e riposizionare i EB in 10 ml di mezzo fresco E8.
    10. Ingrandire gli EB generati per 5 giorni, eseguendo le modifiche quotidiane con fresH Medio E8. Per ulteriore maturazione, cambiare il terreno di coltura nel mezzo E7. Mantenere i EB a 37 ° C e 5% di CO 2 per altri 5 giorni, effettuando variazioni giornaliere medi con il mezzo fresco E7.
      NOTA: il medium E7 è il mezzo E8 senza FGF2.
  3. Induzione delle cellule di crescita da EB
    1. Aggiungere 6 ml di gelatina 1% a un piatto da 100 mm e incubare a 37 ° C e 5% di CO 2 per 30 min.
    2. Rimuovere la gelatina e asciugare completamente il piatto per 2-3 ore prima dell'uso.
    3. Trasferire l'EB in un tubo conico da 50 ml. Lasciare che i EB si stabiliscano nella parte inferiore del tubo conico. Rimuovere il surnatante senza disturbare le EB.
    4. Resuspendere i EB in 10 ml di Dulbecco's Modified Eagle's Medium (DMEM) con 20% di siero fetale fetale (FBS). Trasferire le EB al piatto da 100 mm rivestito di gelatina. Aggiungere 10 μM inibitore ROCK.
    5. Incubare e mantenere le cellule a 37 ° C e 5% CO 2 per 7 giorni. Cambi la miaDium ogni altro giorno senza aggiungere inibitore di ROCK.
  4. Formazione di pellet condensato
    1. Aspirare il mezzo di coltura dal piatto e lavare le cellule tre volte con PBS.
    2. Applicare 1 mL di 1 mM EDTA e incubare a 37 ° C e 5% CO 2 per 2 min.
    3. Raccogliere le cellule usando 5 ml di DMEM con il 20% di FBS e trasferirle in un nuovo tubo conico da 15 ml.
    4. Centrifugare le cellule per 2 min a 250 xg e RT. Scartare il surnatante e risospendere il pellet in 10 ml di DMEM con il 20% di FBS.
    5. Filtrare e scartare i cluster di cellule utilizzando un filtro da 40 μm e raccogliere le singole cellule. Conte le singole cellule usando un emocitometro.
    6. Centrifugare le cellule per 2 min a 250 xg e RT. Rimuovere il surnatante e le sementi da 3 x 10 5 cellule per pellet in un tubo conico da 15 ml con 300 μl di mezzo di differenziazione condizionale (CDM).
    7. Per la formazione di pellet, centrifugare le cellule per 5 minuti a680 xg e RT.
      NOTA: I pellets vengono mantenuti in tubi conici da 15 ml durante la differenziazione dei pellet condensatori.
    8. Incubare le cellule durante la notte a 37 ° C e 5% CO 2 .
    9. Modificare il CDM ogni 2-3 giorni. Entro 3 giorni, i pellet esporranno morfologie sferoidali appiattite. Mantenere i pellets per 21 giorni a 37 ° C e 5% CO 2 .

2. Caratterizzazione di pellet condensato mediante colorazione

  1. Incorporazione condrogenica
    1. Prima di incollare, preparare e sciogliere la paraffina a 58 ° C.
    2. Fissare i pellets in 1 ml di 4% di paraformaldeide per 2 ore a RT in un tubo da 1,5 ml.
      Attenzione: la paraformaldeide è altamente tossica. Evitare il contatto con gli occhi, la pelle o le mucose. Ridurre al minimo l'esposizione e evitare l'inalazione durante la preparazione.
    3. Posizionare uno strato di garza sulla cassetta e trasferire i pellet fissi utilizzando una pipetta. Coprire il pellet piegando thE garza e chiudere il coperchio della cassetta.
    4. Avviare la disidratazione in 100 mL di etanolo al 70% (EtOH) due volte, 10 minuti ciascuno. Dehidrate i pellet attraverso lavaggi sequenziali di 10 min in 80% e 95% EtOH.
    5. Trasferire i pellets al 100% EtOH per 10 min. Ripetere tre volte con EtOH fresco.
    6. Per "compensazione", scambiare la soluzione per una miscela di EtOH e xilene da 100 mL, 1: 1, seguita da una miscela 1: 2 di EtOH e xilene per 10 minuti ciascuno. Eliminare il restante EtOH incubando i pellet due volte in 100% xilene, 10 minuti ciascuno.
    7. Per l'infiltrazione di paraffina, incubare i pellet in miscele sequenziali di xilene e paraffine. Eseguire l'intero processo di infiltrazione di paraffina a 58 ° C. Incubare i pellets in 100 ml di una miscela di xilene e paraffina 2: 1 per 30 min.
    8. Scambiare la soluzione per 100 ml di una miscela 1: 1 di xilene e paraffina e incubare per 30 min.
    9. Scambiare la soluzione per 100 ml di miscela 1: 2 di xilene e paraffina e incubare per 30 min.
    10. Per l'infiltrazione finale, trasferire i pellet al primo bagno di 100% paraffina e incubare per 2 ore.
    11. Trasferire i pellet al secondo bagno di 100% paraffina e incubare O / N a 58 ° C.
    12. Il giorno dopo, delicatamente trasferire i pellet in uno stampo con un tweezer. Aggiungere paraffina allo stampo dall'erogatore di paraffina. Rafforzare la paraffina per 30 minuti a 4 ° C.
    13. Fate tagliare le sezioni a 7 μm e trasferire le sezioni sulla slitta. Lasciare che le diapositive si asciugano durante la notte e conservino le diapositive a RT finché non siano pronte per l'uso.
  2. Preparazione di diapositive
    1. Deparaffinare le diapositive spostandole attraverso 100 mL di 100%, 90%, 80% e 70% EtOH in sequenza per 5 minuti ciascuno.
    2. Posizionare le diapositive in un vaso di vetro e sciacquare con acqua del rubinetto per 5 minuti.
  3. Colorazione blu alciana
    1. Incubare le diapositive in 50 ml di soluzione 1% di azoto blu per 30 min.
      NONE: l'azzurro alciano viene diluito in soluzione al 3% di acido acetico. Regolare il pH a 2,5 usando acido acetico.
    2. Posizionare le diapositive in un vaso di vetro e sciacquare con acqua del rubinetto per 2 min.
    3. Sciacquare le diapositive in acqua deionizzata (DW) e contare con soluzione nucleare veloce rapida per 2 min.
    4. Posizionare le diapositive in un vaso di vetro e sciacquare con acqua del rubinetto per 1 minuto.
    5. 2.3.5) Procedere per disidratare e montare le diapositive nella fase 2.6.
  4. Toluidine blu colorazione
    1. Incubare le diapositive in 50 ml di soluzione toluidina blu per 4 min.
    2. Posizionare le diapositive in un vaso di vetro e sciacquare con acqua del rubinetto per 5 minuti.
    3. Procedere per disidratare e montare le diapositive nella fase 2.6.
  5. Colorazione immunohistochemica
    1. Incubare le diapositive in 3% di H 2 O 2 per 15 minuti per bloccare la perossidasi endogena.
    2. Applicare 200 μL di anticorpi primari (anti-COL1A1 e -COL2A1) diluiti 1: 100 in tris-bu(TBS) contenente 1% di albumina bovina serba (BSA) e 5% di siero di capra normale (NGS) alle diapositive e incubare O / N a 4 ° C.
    3. Il giorno dopo, posizionare le diapositive in un vaso di vetro e lavare con 50 ml di TBS contenente 0,1% di polisorbato 20 (TBST) tre volte per 5 minuti ciascuno.
    4. Applicare 200 μL di anticorpi secondari (anticorpi IgG anti-coniglio caprino, diluiti 1: 200 in TBS contenente 1% BSA e 5% NGS) e incubare a RT per 40 min.
    5. Posizionare le diapositive in un vaso di vetro e lavarle tre volte con 50 ml, 5 minuti ciascuno.
    6. Per l'amplificazione del segnale, applicare la soluzione streptavidina coniugata con HRP alle diapositive e incubare per 10 min.
    7. Posizionare le diapositive in un vaso di vetro e lavarle tre volte con 50 ml, 5 minuti ciascuno.
    8. Mescolare la soluzione di substrato DAB-perossidasi, applicare 200 μL di soluzione a ciascuna scivola e incubare per 1 min.
    9. Posizionare le diapositive in un vaso di vetro e sciacquare con acqua del rubinetto per 5 minuti.
    10. di contrastoCon l'ematossilina di Mayer per 1 minuto.
    11. Lavare le diapositive con DW.
    12. Procedere per disidratare e montare le diapositive nella fase 2.6.
  6. Disidratazione e montaggio
    1. Dehidrate le diapositive spostandole sequenzialmente attraverso 100 mL di 70%, 80%, 90% e 100% EtOH, 30 sec ciascuno.
    2. Immergere le diapositive in due cambi di xilene per 1 min ciascuno.
    3. Aggiungere 50 μL di soluzione di montaggio ai coperchi e posizionare le diapositive in alto.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

In questo studio, abbiamo generato pellet condensatori da CBMC-hiPSCs indurre cellule outgrowth da EBs. La differenziazione condrogenica è stata indotta usando CBMC-hiPSC con elevata pluripotenza 11 confermata. Uno schema semplice del nostro protocollo è mostrato in Figura 1A . Prima della differenziazione, le colonie iPSC sono state ampliate ( Figura 1B ). IPSC espansi sono stati assemblati come EB per iniziare la differenziazione ( Figura 1C ). I EB generati sono stati fissati a piatti rivestiti in gelatina per indurre le cellule di crescita ( Figura 1D ). Quindi, le cellule di crescita sono state raccolte e usate per generare pellet condensatori. Dopo 21 giorni di differenziazione sono stati ottenuti piccoli pellet condensati simili a perline e utilizzati per ulteriori caratterizzazioni ( Figura 1E ). La qualità del chon in vitro generatoPellets drogenic è stato confermato attraverso varie prove.

Abbiamo valutato istologicamente la qualità dei pellet condrodotti nel giorno 21. I pellets condensatori BMSC sono stati utilizzati come controllo positivo. L'accumulo di proteine ​​ECM secreto dai condrociti differenziati è stato confermato dalla colorazione blu alcian e toluidina blu nella figura 2A . Le principali caratteristiche della cartilagine sana, come la lacuna e la produzione di proteoglicani, sono aumentate in quanto il processo di differenziazione è proseguito in 21 giorni. I pellet condensati generati da CBMC-hiPSC hanno espresso COL2A1, il principale componente ECM in cartilagine sana ( Figura 2B ). L'espressione COL2A1 di pellets di CBMC-hiPSC è stata superiore a quella dei pellets derivati ​​da BMSC. L'espressione del collagene di tipo I, un marker per la cartilagine fibrosa, era minore nei campioni derivanti da CBMC-hiPSC rispetto all'espressione di COL2A1. L'espressione genica delle proteine ​​ECM della cartilagine nei pellet condrumi del giorno 21 è stata confermata da PCR in tempo reale. L'espressione di aggrecan (ACAN) di pellets di CBMC-hiPSC è risultata simile a quella dei pellets derivati ​​da BMSC ( Figura 3A ). L'espressione di COL2A1 era significativamente più elevata in pellets di CBMC-hiPSC ( Figura 3B ). È stata anche valutata l'espressione della regione Y-box 9 determinante del sesso (Sox9), un marcatore progenitorico condrogenico. I pellet generati da CBMC-hiPSC hanno espresso livelli elevati di Sox9 ( Figura 3C ). Abbiamo confermato che questi geni sono stati significativamente regolati in pellet condensatori CBMC-hiPSC rispetto ai pellets di controllo BMSC il giorno 21. L'espressione di un marker ipertrofico, COL1A1, è stata valutata ( Figura 3D ). L'espressione di COL1A1 in pellet di CBMC-hiPSC è stata ridotta rispetto a quella in BMSC-upVed pellets. L'efficienza di differenziazione è stata analizzata dal rapporto tra COL2A1 e COL1A1 ( figura 3E ). L'incremento del rapporto in pellets di CBMC-hiPSC ha dimostrato l'espressione relativamente alta di COL2A1 rispetto a COL1A1. In conclusione, abbiamo confermato la capacità di differenziazione condizionale dei CBMC-hiPSCs. La qualità dei pellet condensati ottenuti da CBMC-hiPSC ha una qualità compatibile con quella dei BMSC.

Figura 1
Figura 1: differenziazione condrogenica di hiPSCs. ( A ) Schema di generazione di pellet condensato da hiPSCs. ( B ) Morfologia del CBMC-hiPSC generato. ( C ) Morfologia dei EB generati. ( D ) Cellule di crescita derivate da EB attaccate ad un piatto di coltura rivestito con gelatina. ( E ) Immagine di t Lui pellet condrogenico dopo 21 giorni di differenziazione. Le unità degli intervalli sono mostrate in millimetri. Barre di scala = 200 μm. Clicca qui per visualizzare una versione più grande di questa figura.

figura 2
Figura 2: Analisi istologica del pellet condrogenico. ( A ) Valutazione istologica dei pellet condrodotti nel giorno 21 utilizzando la colorazione azotica blu e toluidina blu. ( B ) Immagine immunoistochimica di pellet condrumi colorati con COL1A1 e COL2A1 anticorpi. Barre scala = 100 μm. Clicca qui per visualizzare una versione più grande di questa figura.

1" > Figura 3
Figura 3: Espressione del gene della pellet condrogenica. ( A ) espressione genica relativa di ACAN. ( B ) espressione genica relativa del COL2A1. ( C ) espressione genica relativa di SOX9. ( D ) espressione genica relativa di COL1A1. ( E ) Espressione del gene di COL1A1. ( F ) Espressione del gene di COL10A1. ( G ) Il rapporto dell'espressione genica COL2A1: COL1A1. I pellets sono stati raccolti e analizzati dopo 21 giorni di differenziazione. I dati sono stati ottenuti utilizzando PCR in tempo reale e mostrati come l'errore medio standard di esperimenti triplicati per campione (n = 3). L'espressione genica è stata normalizzata a GAPDH come controllo interno. (* P <0,05, ** p <0,01, *** p <0,001).K "> Clicca qui per visualizzare una versione più grande di questa figura.

Numero di cellulare Rendimento delle cellule di crescita Produzione di pellet
hiPSCs 2 x 10 6 2-5 x 10 7 70-150
MSC 2 x 10 6 - 6

Tabella 1: confronto di rendimento di MSC e hiPSCs.

Nome destinazione Direzione Sequenza di primer Dimensione
Inoltrare TTCCGCGACGTGGACAT 77 bp
Inverso TCAAACTCGTTGACATCGAAGGT
UNA LATTINA Inoltrare AGCCTGCGCTCCAATGACT 107 bp
Inverso TAATGGAACACGATGCCTTTCA
COL2A1 Inoltrare GGCAATAGCAGGTTCACGTACA 79 bp
Inverso CGATAACAGTCTTGCCCCACTTA
COL1A1 Inoltrare CCCCTGGAAAGAATGGAGATG 148 bp
Inverso TCCAAACCACTGAAACCTCTG

Tabella 2: Sequenze di primer contro marcatori bidimensionali in PCR in tempo reale.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Questo protocollo ha generato hiPSC da CBMC. Abbiamo riprogrammato i CBMC a hiPSC utilizzando un vettore virale Sendai contenente fattori Yamanaka 24 . Tre casi sono stati utilizzati nella differenziazione, e tutti gli esperimenti hanno generato con successo i pellet condrodotti utilizzando questo protocollo. Numerosi studi hanno riportato protocolli per la differenziazione dei hiPSC nei condrociti 25 , 26 , 27 , 28 . Tuttavia, è necessaria una ricerca supplementare per confermare l'uso di CBMC-hiPSCs un candidato per la rigenerazione e il recupero della cartilagine.

La condrogenesi è stata confermata usando hiPSC generate da vari tipi di cellule somatiche 11 , 25 , 26 , 27 , 29 . Molti rapporti dimostranoChe l'origine della cellula somatica utilizzata nella riprogrammazione può influenzare l'esito di differenziazione dei hiPSCs 30 , 31 , 32 , 33 . Il sangue del cordone è una fonte arricchita con HSC e MSC. Non esiste alcuna relazione sulla differenza tra cellule del sangue derivate dal cavo, come le cellule del sangue o le cellule del sangue. Tuttavia, studi precedenti hanno dimostrato che i hiPSC derivanti dalla condrociti articolare hanno maggiori probabilità di attraversare la condogenesi rispetto agli hiPSC generati dal sangue del cordone o dai fibroblasti della pelle 29 . Risultati della differenziazione endoteliale usando hiPSC generati da fibroblasti, cellule progenitrici cardiache e cellule endoteliali hanno dimostrato che il tessuto di origine può riflettere la memoria somatica specifica del tessuto in derivazione iPSC differenziata terminalmente, in particolare nei passaggi iniziali, tra 10 e 20 34 . Nei passaggi iniziali di hiPSCs, cellule endoteliali finoVed hiPSCs differenziati in modo più efficiente nel linfatico endoteliale. Tuttavia, la differenza significativa tra queste linee cellulari è scomparsa in hiPSC su 20 passaggi. Pertanto, è importante considerare attentamente la memoria somatica trasportata dai hiPSC nei passaggi iniziali quando vengono utilizzati nella ricerca clinica.

Recentemente sono state sviluppate varie procedure per riparare la cartilagine articolare difettosa. La microfratturazione avviene perforando più fori nell'osso per indurre l'afflusso di midollo osseo per la riparazione naturale 35 . La sostituzione del ginocchio, nota anche come artroplastica al ginocchio, viene usata per sostituire la cartilagine danneggiata. Tuttavia, la microfrattura non è utile per i danni gravi della cartilagine articolare e lo strumento utilizzato per le sostituzioni al ginocchio deve essere modificato ogni 10-15 anni.

In questi giorni, le terapie a base di cellule sono un metodo alternativo promettente per la riparazione della cartilagine. L'impianto chondrocyte autologo (ACI) è ampioUtilizzata per il recupero delle cartilagini a base cellulare. L'ACI viene fatto direttamente iniettando condrociti autologhi nel difetto. Tuttavia, i condrociti autologhi si trasformano in cellule fibroblastiche in condizioni di coltura in vitro . Altri danni sono anche inevitabili durante il processo di raccolta di condrociti autologhi. MSC sono stati suggeriti come una fonte cellulare per il recupero di cartilagine. Il sangue del cordone è una fonte cellulare utile e accessibile di MSC per la cartilagine 36 . Il tasso di successo per l'isolamento di MSC del cavo-sangue, tuttavia, è controverso 37 , 38 . Numerosi studi riportano l'isolamento efficace di MSC a cordone-sangue. Diversi studi hanno dimostrato che il volume del sangue del cavo è un parametro critico che può influenzare il tasso di resa dell'isolamento MSC 36 , 39 . Per acquisire MSC di elevata qualità, il passaggio delle cellule è anche critico. Studi precedenti indicano thaT MSC hanno una durata limitata di vita dopo un certo numero di divisione delle cellule. Entrando nella senescenza, i MSC sono caratterizzati da diminuita proliferazione, come con qualsiasi normale cellula somatica 40 . Pertanto, i MSC derivanti dal sangue del cordone devono essere utilizzati prima del sesto passaggio per evitare la senescenza cellulare e le anomalie cromosomiche 41 .

Per evitare queste limitazioni, iPSC umani hanno aperto una nuova possibilità per una terapia personalizzata basata su cellule ad alta produttività 11 . I hiPSC stabiliti possono proliferare teoricamente senza limiti. Inoltre, con la stessa identità immunitaria del donatore, possono evitare il rifiuto e gli effetti collaterali inferiori quando vengono impiantati in vivo . La transizione delle banche del sangue del cordone nelle banche hiPSC per un trattamento medico allogenico ha enorme possibilità e potenzialità 42 . Lo screening di CBMC homozygosi HLA-typed prima di riprogrammare può ampiamente utilizzare le linee iPSC allogeneic perR trattamenti clinici. Le linee iPSC omozigote possono evitare reazioni immunologiche dopo il trapianto di allograft. Questo concetto può essere applicato anche alla rigenerazione della cartilagine generando la cartilagine HLA-omozigote 11 .

Di solito, la differenziazione condrogenica viene effettuata attraverso due fasi critiche: l'induzione delle cellule di crescita di derivazione EB e la formazione di pellet. La differenziazione iniziale di hiPSCs nelle cellule di outgrowth derivate da EB è fondamentale per aumentare il loro potenziale di differenziazione condrogenica. Le cellule di crescita sono differenziate da hiPSCs sono funzionalmente e molecolarmente simili a BMSC native 7 , 43 . Studi precedenti hanno utilizzato la cultura monolayer o la cultura EB come fase di pre-differenziazione per indurre cellule simili a mesenchimali 10 , 43 . Tuttavia, la differenziazione diretta con la cultura monolayer richiede molto tempo rispetto all'uso di EB e ch I pellet ondrogenici tendono a differenziarsi in fibrocartilage con caratteristiche ipertrofiche. È stato riferito che la morfologia delle cellule e il potenziale di differenziazione condrogenata delle cellule progenitrici simili a mesenchimali differiscono molto in base alla densità cellulare del monolayer 9 .

Abbiamo usato EB per indurre le cellule di crescita, che è un metodo relativamente veloce e semplice rispetto alla coltura monolayer. Utilizzando questo protocollo, siamo stati in grado di generare molti pellet utilizzando un numero relativamente piccolo di hiPSCs ( Tabella 1 ). La dimensione e il numero di EBs erano critici per la produzione di massa di pellet condensata di successo. Per questo motivo, abbiamo ingrandito le EB aggregate nel mezzo E8, finché più della metà degli EB generati era superiore a 100 μm. Dopo l'allargamento del EB, abbiamo mantenuto la EB nel mezzo E8 senza FGF2. In precedenza, i ricercatori hanno mantenuto EB generati senza FGF2 per l'induzione lineage mesodermicaXref "> 9.

Anche se abbiamo cercato di mantenere le cellule di crescita delle generazioni ad alta densità per una migliore qualità, restano ancora molte limitazioni. Mentre abbiamo confermato che le cellule di crescita delle generazioni condividono una simile morfologia, le cellule possono essere ancora eterogenee. Studi precedenti hanno cercato di ordinare per un tipo di cellula specifica; Tuttavia, questa procedura ha portato alla raccolta di un basso numero di cellule. Sarà richiesto un nuovo tentativo di isolare le cellule di crescita di omogene su larga scala per generare una grande quantità di pellet condrumi con caratteristiche avanzate.

Vari gruppi inducono le cellule progenitrici dei hiPSC usando la coltura monolayer o EB. L'induzione di cellule progenitrici con un'elevata somiglianza con MSC può essere la chiave per ottenere pellet condrogenici di elevata qualità. Queste cellule progenitrici derivate da EB hanno caratteristiche simili a quelle di MSC. Tuttavia, questo potrebbe essere dovuto alIr natura fibroblastica. Pertanto, è necessario uno studio di convalida dettagliato sulle cellule di crescita.

In questo studio suggeriamo un protocollo in grado di generare una quantità relativamente grande di pellet condrumi. Abbiamo confermato che la cartilagine rigenerata usando CBMC-hiPSC ha mostrato un fenotipo sano e può essere utilizzato come materiale per la rigenerazione dei tessuti. Tuttavia, è necessario un metodo migliorato con una più breve timeline di differenziazione per un'ulteriore applicazione. L'ulteriore sviluppo di standard di controllo della qualità per la convalida della cartilagine con un livello superiore di ialina è anche necessario per future applicazioni di CBMC-hiPSCs come materiale cellulare per la rigenerazione della cartilagine. Il protocollo è semplice ma efficace e non richiede ulteriori processi di smistamento prima della formazione di pellet. In conclusione, usando questo protocollo, possono essere generati pellet condizionati di alta qualità per studi su modelli di malattia, screening di farmaci e medicina rigenerativa per aumentare la nostra comprensioneLa natura della cartilagine.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno niente da rivelare.

Acknowledgements

Questo lavoro è stato sostenuto da una sovvenzione del progetto R & D di tecnologia della Corea del Sud, Ministero della Sanità, del Welfare & Famiglia, della Repubblica di Corea (HI16C2177).

Materials

Name Company Catalog Number Comments
Plasticware
100 mm Dish TPP 93100
6-well Plate TPP 92006
50 mL Cornical Tube SPL 50050
15 mL Cornical Tube SPL 50015
10 mL Disposable Pipette Falcon 7551
5 mL Disposable Pipette Falcon 7543
12-well Plate TPP 92012
Name Company Catalog Number Description
E8 Medium Materials
DMEM/F12, HEPES Life Technologies 11330-057 E8 Medium (500 mL)
Sodium Bicarbonate Life Technologies 25080-094 E8 Medium (Conc.: 543 μg/mL)
Sodium Selenite Sigma Aldrich S5261 E8 Medium  (Conc.: 14 ng/mL)
Human Transfferin Sigma Aldrich T3705 E8 Medium (Conc.: 10.7 μg/mL)
Basic FGF2 Peprotech 100-18B E8 Medium  (Conc.: 100 ng/mL)
Human Insulin Life Technologies 12585-014 E8 Medium (Conc.: 20 μg/mL)
Human TGFβ1 Peprotech 100-21 E8 Medium (Conc.: 2 ng/mL)
Ascorbic Acid Sigma Aldrich A8960 E8 Medium  (Conc.: 64 μg/mL)
DPBS Life Technologies 14190-144
Vitronectin Life Technologies A14700
ROCK Inhibitor Sigma Aldrich Y0503
Name Company Catalog Number Description
Quality Control Materials
18 mm Cover Glass Superior HSU-0111580
4% Paraformaldyhyde Tech & Innovation BPP-9004
Triton X-100 BIOSESANG 9002-93-1
Bovine Serum Albumin Vector Lab SP-5050
Anti-SSEA4 Antibody Millipore MAB4304
Anti-Oct4 Antibody Santa Cruz SC9081
Anti-TRA-1-60 Antibody Millipore MAB4360
Anti-Sox2 Antibody Biolegend 630801
Anti-TRA-1-81 Antibody Millipore MAB4381
Anti-Klf4 Antibody Abcam ab151733
Alexa Fluor 488 goat anti-mouse IgG (H+L) antibody Molecular Probe A11029
Alexa Fluor 594 goat anti-rabbit IgG (H+L) antibody Molecular Probe A11037
DAPI Molecular Probe D1306
Prolong gold antifade reagent Invitrogen P36934
4% Paraformaldyhyde Tech & Innovation BPP-9004
Tween 20 BIOSESANG T1027
Bovine Serum Albumin Vector Lab SP-5050
Anti-Collagen II antibody abcam  ab34712 1:100
Alcian blue Sigma Aldrich A3157-10G
Fast Green FCF Sigma Aldrich F7252-25G
Safranin O Sigma Aldrich 090m0039v
Nuclear fast red Americanmastertech STNFR100 
xylene Duksan 115 
Ethanol Duksan 64-17-5
Mayer's hematoxylin solution wako pure chemical industries LAK7534
DAP VECTOR LABORATORIES SK-4100
Slide Glass, Coated Hyun Il Lab-Mate HMA-S9914
Trizol Invitrogen 15596-018
Chloroform Sigma Aldrich 366919
Isoprypylalcohol Millipore 109634
Ethanol Duksan 64-17-5
RevertAid First Strand cDNA Synthesis kit Thermo Scientfic K1622
Name Company Catalog Number Description
Chondrogenic Differentiation Materials
DMEM Life Technologies 11885 Chondrogenic media component (500 mL)
Penicilin Streptomycin Life Technologies P4333 Chondrogenic media component (Conc.: 1%)
Ascorbic Acid Sigma Aldrich A8960 Chondrogenic media component (Conc.: 64 μg/mL) 
MEM Non-Essential Amino Acids Solution (100x) Life Technologies 11140-050 Chondrogenic media component (Conc.: 100 mM)
rhBMP-2 R&D 355-BM-050 Chondrogenic media component (Conc.:100 ng/ml)
Recombinant Hman TGF-beta3 R&D 243-B3-002 Chondrogenic media component (Conc.:10 ng/ml)
KnockOut Serum Replacement Life Technologies 10828-028 Chondrogenic media component (Conc.: 1%)
ITS+ Premix BD 354352 Chondrogenic media component (Conc.: 1%)
Dexamethasone-Water Soluble  Sigma Aldrich D2915-100MG Chondrogenic media component (Conc.:10-7 M)
GlutaMAX Supplement Life Technologies 35050-061 Chondrogenic media component (Conc.: 1%)
Sodium pyruvate solution Sigma Aldrich S8636 Chondrogenic media component (Conc.: 1%)
L-Proline Sigma Aldrich P5607-25G Chondrogenic media component (40 μg/ml)

DOWNLOAD MATERIALS LIST

References

  1. van Osch, G. J., et al. Cartilage repair: past and future--lessons for regenerative medicine. J Cell Mol Med. 13, (5), 792-810 (2009).
  2. Ahmed, T. A., Hincke, M. T. Strategies for articular cartilage lesion repair and functional restoration. Tissue Eng Part B Rev. 16, (3), 305-329 (2010).
  3. Diekman, B. O., et al. Cartilage tissue engineering using differentiated and purified induced pluripotent stem cells. Proc Natl Acad Sci USA. 109, (47), 19172-19177 (2012).
  4. Solchaga, L. A., Penick, K., Goldberg, V. M., Caplan, A. I., Welter, J. F. Fibroblast growth factor-2 enhances proliferation and delays loss of chondrogenic potential in human adult bone-marrow-derived mesenchymal stem cells. Tissue Eng Part A. 16, (3), 1009-1019 (2010).
  5. Guzzo, R. M., Drissi, H. Differentiation of Human Induced Pluripotent Stem Cells to Chondrocytes. Methods Mol Biol. 1340, 79-95 (2015).
  6. Drissi, H., Gibson, J. D., Guzzo, R. M., Xu, R. H. Derivation and Chondrogenic Commitment of Human Embryonic Stem Cell-Derived Mesenchymal Progenitors. Methods Mol Biol. 1340, 65-78 (2015).
  7. Nejadnik, H., et al. Improved approach for chondrogenic differentiation of human induced pluripotent stem cells. Stem Cell Rev. 11, (2), 242-253 (2015).
  8. Teramura, T., et al. Induction of mesenchymal progenitor cells with chondrogenic property from mouse-induced pluripotent stem cells. Cell Reprogram. 12, (3), 249-261 (2010).
  9. Koyama, N., et al. Human induced pluripotent stem cells differentiated into chondrogenic lineage via generation of mesenchymal progenitor cells. Stem Cells Dev. 22, (1), 102-113 (2013).
  10. Ko, J. Y., Kim, K. I., Park, S., Im, G. I. In vitro chondrogenesis and in vivo repair of osteochondral defect with human induced pluripotent stem cells. Biomaterials. 35, (11), 3571-3581 (2014).
  11. Nam, Y., Rim, Y. A., Jung, S. M., Ju, J. H. Cord blood cell-derived iPSCs as a new candidate for chondrogenic differentiation and cartilage regeneration. Stem Cell Res Ther. 8, (1), 16 (2017).
  12. Hotten, G. C., et al. Recombinant human growth/differentiation factor 5 stimulates mesenchyme aggregation and chondrogenesis responsible for the skeletal development of limbs. Growth Factors. 13, (1-2), 65-74 (1996).
  13. Murphy, M. K., Huey, D. J., Hu, J. C., Athanasiou, K. A. TGF-beta1, GDF-5, and BMP-2 stimulation induces chondrogenesis in expanded human articular chondrocytes and marrow-derived stromal cells. Stem Cells. 33, (3), 762-773 (2015).
  14. Shintani, N., Siebenrock, K. A., Hunziker, E. B. TGF-ss1 enhances the BMP-2-induced chondrogenesis of bovine synovial explants and arrests downstream differentiation at an early stage of hypertrophy. PLoS One. 8, (1), e53086 (2013).
  15. Fukumoto, T., et al. Combined effects of insulin-like growth factor-1 and transforming growth factor-beta1 on periosteal mesenchymal cells during chondrogenesis in vitro. Osteoarthritis Cartilage. 11, (1), 55-64 (2003).
  16. Worster, A. A., Nixon, A. J., Brower-Toland, B. D., Williams, J. Effect of transforming growth factor beta1 on chondrogenic differentiation of cultured equine mesenchymal stem cells. Am J Vet Res. 61, (9), 1003-1010 (2000).
  17. Knippenberg, M., et al. Differential effects of bone morphogenetic protein-2 and transforming growth factor-beta1 on gene expression of collagen-modifying enzymes in human adipose tissue-derived mesenchymal stem cells. Tissue Eng Part A. 15, (8), 2213-2225 (2009).
  18. Jang, Y., et al. Centrifugal gravity-induced BMP4 induces chondrogenic differentiation of adipose-derived stem cells via SOX9 upregulation. Stem Cell Res Ther. 7, (1), 184 (2016).
  19. Kang, R., et al. Mesenchymal stem cells derived from human induced pluripotent stem cells retain adequate osteogenicity and chondrogenicity but less adipogenicity. Stem Cell Res Ther. 6, 144 (2015).
  20. Tao, H., et al. Biological evaluation of human degenerated nucleus pulposus cells in functionalized self-assembling peptide nanofiber hydrogel scaffold. Tissue Eng Part A. 20, (11-12), 1621-1631 (2014).
  21. Sekiya, I., Larson, B. L., Vuoristo, J. T., Reger, R. L., Prockop, D. J. Comparison of effect of BMP-2, -4, and -6 on in vitro cartilage formation of human adult stem cells from bone marrow stroma. Cell Tissue Res. 320, (2), 269-276 (2005).
  22. Shen, B., Wei, A., Tao, H., Diwan, A. D., Ma, D. D. BMP-2 enhances TGF-beta3-mediated chondrogenic differentiation of human bone marrow multipotent mesenchymal stromal cells in alginate bead culture. Tissue Eng Part A. 15, (6), 1311-1320 (2009).
  23. Rim, Y. A., Nam, Y., Ju, J. H. Induced Pluripotent Stem Cell Generation from Blood Cells Using Sendai Virus and Centrifugation. J Vis Exp. (118), (2016).
  24. Kim, Y., et al. The Generation of Human Induced Pluripotent Stem Cells from Blood Cells: An Efficient Protocol Using Serial Plating of Reprogrammed Cells by Centrifugation. Stem Cells Int. 2016, 1329459 (2016).
  25. Oldershaw, R. A., et al. Directed differentiation of human embryonic stem cells toward chondrocytes. Nat Biotechnol. 28, (11), 1187-1194 (2010).
  26. Toh, W. S., et al. Differentiation and enrichment of expandable chondrogenic cells from human embryonic stem cells in vitro. J Cell Mol Med. 13, (9B), 3570-3590 (2009).
  27. Hwang, N. S., Varghese, S., Elisseeff, J. Derivation of chondrogenically-committed cells from human embryonic cells for cartilage tissue regeneration. PLoS One. 3, (6), e2498 (2008).
  28. Nakagawa, T., Lee, S. Y., Reddi, A. H. Induction of chondrogenesis from human embryonic stem cells without embryoid body formation by bone morphogenetic protein 7 and transforming growth factor beta1. Arthritis Rheum. 60, (12), 3686-3692 (2009).
  29. Guzzo, R. M., Scanlon, V., Sanjay, A., Xu, R. H., Drissi, H. Establishment of human cell type-specific iPS cells with enhanced chondrogenic potential. Stem Cell Rev. 10, (6), 820-829 (2014).
  30. Rim, Y. A., Park, N., Nam, Y., Ju, J. H. Generation of Induced-pluripotent Stem Cells Using Fibroblast-like Synoviocytes Isolated from Joints of Rheumatoid Arthritis Patients. J Vis Exp. (116), (2016).
  31. Pfaff, N., et al. Efficient hematopoietic redifferentiation of induced pluripotent stem cells derived from primitive murine bone marrow cells. Stem Cells Dev. 21, (5), 689-701 (2012).
  32. Xu, H., et al. Highly efficient derivation of ventricular cardiomyocytes from induced pluripotent stem cells with a distinct epigenetic signature. Cell Res. 22, (1), 142-154 (2012).
  33. Lee, S. B., et al. Contribution of hepatic lineage stage-specific donor memory to the differential potential of induced mouse pluripotent stem cells. Stem Cells. 30, (5), 997-1007 (2012).
  34. Hu, S., et al. Effects of cellular origin on differentiation of human induced pluripotent stem cell-derived endothelial cells. JCI Insight. 1, (8), 1-12 (2016).
  35. Vonk, L. A., de Windt, T. S., Slaper-Cortenbach, I. C., Saris, D. B. Autologous, allogeneic, induced pluripotent stem cell or a combination stem cell therapy? Where are we headed in cartilage repair and why: a concise review. Stem Cell Res Ther. 6, (94), 1-11 (2015).
  36. Gomez-Leduc, T., et al. Chondrogenic commitment of human umbilical cord blood-derived mesenchymal stem cells in collagen matrices for cartilage engineering. Sci Rep. 6, 32786 (2016).
  37. Mareschi, K., et al. Isolation of human mesenchymal stem cells: bone marrow versus umbilical cord blood. Haematologica. 86, (10), 1099-1100 (2001).
  38. Wexler, S. A., et al. Adult bone marrow is a rich source of human mesenchymal 'stem' cells but umbilical cord and mobilized adult blood are not. Br J Haematol. 121, (2), 368-374 (2003).
  39. Zhang, X., et al. Isolation and characterization of mesenchymal stem cells from human umbilical cord blood: reevaluation of critical factors for successful isolation and high ability to proliferate and differentiate to chondrocytes as compared to mesenchymal stem cells from bone marrow and adipose tissue. J Cell Biochem. 112, (4), 1206-1218 (2011).
  40. Wagner, W., et al. Replicative senescence of mesenchymal stem cells: a continuous and organized process. PLoS One. 3, (5), e2213 (2008).
  41. Tarte, K., et al. Clinical-grade production of human mesenchymal stromal cells: occurrence of aneuploidy without transformation. Blood. 115, (8), 1549-1553 (2010).
  42. Chen, W. C., et al. Prediction of poor survival by cyclooxygenase-2 in patients with T4 nasopharyngeal cancer treated by radiation therapy: clinical and in vitro studies. Head Neck. 27, (6), 503-512 (2005).
  43. Guzzo, R. M., Gibson, J., Xu, R. H., Lee, F. Y., Drissi, H. Efficient differentiation of human iPSC-derived mesenchymal stem cells to chondroprogenitor cells. J Cell Biochem. 114, (2), 480-490 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics