Kondrogen pelletsbildning från Cord Blood-härledda inducerade Pluripotenta stamceller

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Här föreslår vi ett protokoll för kondrogenisk differentiering från blodmononukleära cell-härledda humana inducerade pluripotenta stamceller.

Cite this Article

Copy Citation | Download Citations

Nam, Y., Rim, Y. A., Ju, J. H. Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells. J. Vis. Exp. (124), e55988, doi:10.3791/55988 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Humant ledbrusk saknar förmågan att reparera sig själv. Bruskdegeneration behandlas således inte genom härdande men genom konservativa behandlingar. För närvarande görs ansträngningar för att återbilda skadat brosk med ex vivo expanderade kondrocyter eller benmärgsavledda mesenkymala stamceller (BMSCs). Den begränsade livskraften och instabiliteten hos dessa celler begränsar emellertid deras tillämpning vid bruskrekonstruktion. Människanducerade pluripotenta stamceller (hiPSCs) har fått vetenskaplig uppmärksamhet som ett nytt alternativ för regenerativa applikationer. Med obegränsad självförnyelse och multipotens har hiPSCs markerats som en ny ersättningskälla för bruskreparation. Att erhålla en hög mängd högkvalitativa kondrogena pellets är emellertid en stor utmaning för deras kliniska tillämpning. I denna studie använde vi embryoidkroppar (EB) -avledda tillväxtväxter för kondrogenisk differentiering. Framgångsrik kondrogenes bekräftades av PCR anD färgning med alcianblått, toluidinblått och antikroppar mot kollagentyperna I och II (respektive COL1A1 respektive COL2A1). Vi tillhandahåller en detaljerad metod för differentiering av blodmononukleära cell-härledda iPSCs (CBMC-hiPSCs) till kondrogena pellets.

Introduction

Användningen av hiPSC representerar en ny strategi för läkemedelsscreening och mekanistiska studier av olika sjukdomar. Från ett regenerativt perspektiv är hiPSC också en potentiell källa för ersättning av skadade vävnader som har begränsad läkning förmåga, såsom ledbrusk 1 , 2 .

Regenerering av infödda ledbrusk har varit en utmaning i flera årtionden. Artikulär brosk är en mjuk, vit vävnad som täcker benets ände, skyddar dem mot friktion. Det har emellertid begränsad regenerativ förmåga när den skadas, vilket gör självreparation nästan omöjligt. Därför har forskning som fokuseras på bruskregenerering pågått i flera årtionden.

Tidigare utfördes in vitro- differentiering i den kondrogena linjen vanligtvis med BMSC eller nativa kondrocyter isolerade från knäleden 3 . På grund av tO deras kondrogena potential, BMSC och nativa kondrocyter har många fördelar som stöder deras användning vid kondrogenes. På grund av deras begränsade expansion och instabil fenotyp möter dessa celler emellertid flera begränsningar vid rekonstruktionen av ledbruskdefekter. Under in vitro odlingsförhållanden tenderar dessa celler att förlora sina egna egenskaper efter 3-4 passager, vilket i sin tur påverkar deras differentieringsförmåga 4 . Också i fallet med nativa kondrocyter är ytterligare skada på knäleden oundviklig när man erhåller dessa celler.

Till skillnad från BMSC eller nativa kondrocyter kan hiPSCs expandera obestämt in vitro . Med de korrekta odlingsförhållandena har hiPSCs stor potential som ersättningskälla för kondrogenisk differentiering. Det är emellertid utmanande att ändra de inbyggda egenskaperna hos hiPSCs 5 . Dessutom tar det flera komplicerade in vitro stePs för att styra hiPSCs öde till en specifik celltyp. Trots dessa komplikationer rekommenderas användningen av hiPSCs fortfarande på grund av deras höga självförnyelsevärden och deras förmåga att skilja sig åt inriktade celler, inklusive kondrocyter 6 .

Kondrogen differentiering görs vanligen med tredimensionella odlingssystem, såsom pelletskulturen eller mikromasskulturen, med användning av MSC-liknande stamceller. Om du använder hiPSCs skiljer sig protokollet för att generera MSC-liknande stamceller från de befintliga protokollen. Vissa grupper använder monolagskultur av hiPSCs för direkt omvandling av fenotypen till MSC-liknande celler 7 . De flesta studier använder emellertid EBs för att generera utväxtceller som liknar MSCs 8 , 9 , 10 , 11 .

Olika typer av tillväxtfaktorer används för att inducera kondrogeNesis. Vanligtvis används BMP- och TGFp-familjeproteiner, ensamma eller i kombination. Differentiering har också inducerats med andra faktorer, såsom GDF5, FGF2 och IGFl 12 , 13 , 14 , 15 . TGFβ1 har visats stimulera kondrogenes på ett dosberoende sätt i MSCs 16 . Jämfört med den andra isotypen, TGFβ3, inducerar TGFβ1 kondrogenes genom att öka kondensationen för förbrusk mesenkymcell. TGFβ3 inducerar kondrogenes genom att signifikant öka mesenkymcellproliferationen 17 . TGFβ3 används emellertid oftare av forskare än TGFβ1 7 , 10 , 18 , 19 . BMP2 förstärker uttrycket av gener relaterade till kondrogena matriskomponenterna i människaArtikulära kondrocyter under in vitro- betingelser 20 . BMP2 ökar uttrycket av gener som är kritiska för broskbildning i MSC i kombination med TGFp-proteiner 21 . Det har också visat sig att BMP2 synergistiskt ökar effekten av TGFβ3 genom Smad- och MAPK-banorna 22 .

I denna studie aggregerades CBMC-hiPSCs i EBs med användning av EB-medium i en Petri-skål med låg fastighet. Utväxtceller inducerades genom att fästa EB: erna till en gelatinbelagd maträtt. Kondrogen differentiering med användning av utväxtceller utfördes genom pellets kultur. Behandling med både BMP2 och TGFβ3 kondenserade framgångsrikt cellerna och inducerad extracellulär matris (ECM) proteinackumulering för kondrogen pelletsbildning. Denna studie tyder på ett enkelt men ändå effektivt chondrogeniskt differentieringsprotokoll med användning av CBMC-hiPSC.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Detta protokoll godkändes av den institutionella översynen av det katolska universitetet i Korea (KC12TISI0861). CBMCs som användes för omprogrammering erhölls direkt från Cord Blood Bank i Seoul St. Mary's Hospital.

1. Kondrogen Differensiering från iPSCs

  1. CBMC-iPSC generation
    1. Generera CBMC-hiPSCs med hjälp av det protokoll som visas i vårt tidigare arbete 23 .
    2. Samla blodcellerna i ett 15 ml koniskt rör och räkna dem med en hemocytometer.
    3. Förbered 3 x 10 5 celler och centrifugera dem i 5 min vid 515 xg och RT. Kassera supernatanten genom sugning och resuspendera cellerna i 0,5 ml blodcellsmedium.
    4. Överför cellerna till en brunn i en icke-belagd 24-brunnsplatta och tillsätt Sendai-virusblandningen enligt tillverkarens rekommendationer.
    5. Centrifugera plattan i 30 min vid 1,150 xg och 30 ° C.
    6. AkterCentrifugering, inkubera cellerna över natten (O / N) vid 37 ° C i 5% CO2.
    7. Nästa dag, överför de transducerade cellerna till en matrisbelagd brunn. Centrifugera plattan vid 1,150 xg under 30 minuter vid 30 ° C.
    8. Efter centrifugering, avlägsna supernatanten, tillsätt 1 ml iPSC-medium och behåll cellerna O / N vid 37 ° C i 5% CO2.
    9. Underhåll de bifogade cellerna vid 37 ° C och 5% CO2. Byt mediet dagligen och byt ut det med nytt iPSC-medium.
      OBS: Kolonier kommer att visas på dag 14-21 efter transduktion.
  2. EB generation
    1. Håll hiPSCs vid 37 ° C och 5% CO2. Byt mediet dagligen, ersätt det med färskt Essential 8 (E8) medium.
    2. Förbered 2 x 10 6 hiPSCs i en vitronektinbelagd 100 mm skål i E8-medium.
    3. Ta bort E8-mediet från odlingsskålen och tvätta med sterilt fosfatbuffrad saltlösning (PBS).
    4. Lägg till 1Ml 1 mM etylendiamintetraättiksyra (EDTA) och inkubera vid 37 ° C och 5% CO2 i 2 minuter.
    5. Skörda cellerna med 3 ml E8-medium och överför dem till ett nytt 15-ml koniskt rör. Centrifugera cellerna vid 250 xg vid rumstemperatur (RT) i 2 min.
    6. Aspirera supernatanten utan att störa cellpelleten och resuspendera cellerna i 5 ml E8-medium.
    7. Räkna cellerna med hjälp av en hemocytometer och förbered 2 x 10 6 celler för varje 100 mm petriskål. Resuspendera de beredda cellerna i en 10 ml blandning av E8 och EB-medium (1: 1) med 10 | im Rho-associerad kinas (ROCK) -inhibitor.
    8. Inkubera cellerna O / N för aggregering vid 37 ° C och 5% CO2.
    9. Påföljande dag skörda de aggregerade EB: erna genom pipettering. Centrifugera cellerna vid 250 xg under 1 min. Ta bort supernatanten och resuspendera EB i 10 ml friskt E8-medium.
    10. Förstora de genererade EB i 5 dagar, utföra dagliga ändringar med fresarH E8-medium. För vidare modning, byt odlingsmedium till E7-medium. Bibehålla EB-värdena vid 37 ° C och 5% CO 2 i ytterligare 5 dagar. Utför dagliga mediumförändringar med nytt E7-medium.
      OBS: E7-medium är E8-medium utan FGF2.
  3. Utväxtcellinduktion från EBs
    1. Tillsätt 6 ml 1% gelatin till en 100 mm skål och inkubera vid 37 ° C och 5% CO2 i 30 minuter.
    2. Ta bort gelatin och torka skålen helt i 2-3 timmar före användning.
    3. Överför EB till ett 50 ml koniskt rör. Låt EB: erna sätta sig i botten av det koniska röret. Ta bort supernatanten utan att störa EB: erna.
    4. Resuspendera EB: erna i 10 ml Dulbecco's Modified Eagle's Medium (DMEM) med 20% fetalt bovint serum (FBS). Överför EB: erna till den gelatinbelagda 100 mm-skålen. Tillsätt 10 μM ROCK-hämmare.
    5. Inkubera och underhålla cellerna vid 37 ° C och 5% CO2 i 7 dagar. Byta temaDium varannan dag utan att tillsätta ROCK-hämmare.
  4. Kondrogen pelletsbildning
    1. Aspirera odlingsmediet från skålen och tvätta cellerna tre gånger med PBS.
    2. Applicera 1 ml 1 mM EDTA och inkubera vid 37 ° C och 5% CO2 i 2 minuter.
    3. Skörda cellerna med 5 ml DMEM med 20% FBS och överföra dem till ett nytt 15 ml koniskt rör.
    4. Centrifugera cellerna i 2 minuter vid 250 xg och RT. Kassera supernatanten och resuspendera pelleten i 10 ml DMEM med 20% FBS.
    5. Filtrera och kassera cellklumparna med en 40 μm cellfilm och skörda de enskilda cellerna. Räkna de enskilda cellerna med hjälp av en hemocytometer.
    6. Centrifugera cellerna i 2 minuter vid 250 xg och RT. Ta bort supernatanten och frö 3 x 10 ^ celler per pellets i ett 15 ml koniskt rör med 300 | j, l kondrogeniskt differentieringsmedium (CDM).
    7. För pelletsbildning centrifugera cellerna i 5 minuter vid680 xg och RT.
      OBS: Pellets bibehålls i 15 ml koniska rör under differentieringen av kondrogena pellets.
    8. Inkubera cellerna över natten vid 37 ° C och 5% CO2.
    9. Byt CDM varannan 2-3 dagar. Inom 3 dagar uppvisar pellets platta, sfäriska morfologier. Håll pelletsna i 21 dagar vid 37 ° C och 5% CO2.

2. Kondrogen pelletskarakterisering genom färgning

  1. Kondrogen inbäddning
    1. Före inbäddning, förbered och smält paraffin vid 58 ° C.
    2. Fixa pellets i 1 ml 4% paraformaldehyd i 2 timmar vid RT i ett 1,5 ml rör.
      Varning: Paraformaldehyd är mycket giftigt. Undvik kontakt med ögon, hud eller slemhinnor. Minimera exponeringen och undvik inandning vid förberedelse.
    3. Placera ett lager av gasbind på kassetten och överför de fasta pelletsna med en pipett. Täck pelleten genom att vikta denE gasbind och stäng kassettlocket.
    4. Initiera dehydrering i 100 ml 70% etanol (EtOH) två gånger, 10 min vardera. Dehydrat pellets genom sekventiella 10 min tvättar i 80% och 95% EtOH.
    5. Överför pellets till 100% EtOH i 10 minuter. Upprepa tre gånger med färsk EtOH.
    6. För "clearing" byt lösningen för en 100 ml, 1: 1-blandning av EtOH och xylen, följt av en 1: 2-blandning av EtOH och xylen i 10 min vardera. Rensa resterande EtOH genom att inkubera pellets två gånger i 100% xylen, 10 min vardera.
    7. För paraffininfiltrering inkuberas pelleten i sekventiella xylen- och paraffinblandningar. Utför hela paraffininfiltreringsprocessen vid 58 ° C. Inkubera pellets i 100 ml av en 2: 1-blandning av xylen och paraffin i 30 min.
    8. Byt lösningen för 100 ml av en 1: 1-blandning av xylen och paraffin och inkubera i 30 min.
    9. Byt lösningen för 100 ml av en 1: 2-blandning av xylen och paraffin och inkubera i 30 min.
    10. För den sista infiltrationen överför pellets till det första badet av 100% paraffin och inkubera i 2 timmar.
    11. Överför pellets till det andra badet med 100% paraffin och inkubera O / N vid 58 ° C.
    12. Nästa dag, försiktigt överföra pellets till en form med en pincett. Tillsätt paraffin till formen från paraffindispensern. Stärk paraffinen i 30 minuter vid 4 ° C.
    13. Skär sektionerna på 7 μm och överför sektionerna på bilden. Låt glidorna torka över natten och lagra glidarna vid RT tills de är klara att användas.
  2. Slide preparation
    1. Deparaffinisera glidbanorna genom att flytta dem genom 100 ml 100%, 90%, 80% och 70% EtOH sekventiellt i 5 min vardera.
    2. Placera bilderna i en glasburk och skölj med kranvatten i 5 minuter.
  3. Alcian blå färgning
    1. Inkubera glidbanorna i 50 ml 1% alcianblå lösning under 30 minuter.
      INTEE: Alcian blue späds i 3% ättiksyra lösning. Justera pH till 2,5 med ättiksyra.
    2. Placera bilderna i en glasburk och skölj med kranvatten i 2 minuter.
    3. Skölj skivorna i avjoniserat vatten (DW) och motståndet med kärnfärgad röd lösning under 2 minuter.
    4. Placera bilderna i en glasburk och skölj med kranvatten i 1 min.
    5. 2.3.5) Fortsätt att dehydrera och montera diabilderna i steg 2.6.
  4. Toluidine blå färgning
    1. Inkubera diabilder i 50 ml toluidinblåttlösning i 4 min.
    2. Placera bilderna i en glasburk och skölj med kranvatten i 5 minuter.
    3. Fortsätt att dehydrera och montera diabilderna i steg 2.6.
  5. Immunohistokemisk färgning
    1. Inkubera diabilden i 3% H2O2 i 15 minuter för endogen peroxidasblockering.
    2. Applicera 200 μl primär antikropp (anti-COL1A1 och -COL2A1) utspädd 1: 100 i tris-buFerserad saltlösning (TBS) innehållande 1% bovint serumalbumin (BSA) och 5% normalt getserum (NGS) till glidbanorna och inkubera O / N vid 4 ° C.
    3. Nästa dag placerar du objektglasen i en glasburk och tvättar dem med 50 ml TBS innehållande 0,1% polysorbat 20 (TBST) tre gånger i 5 min vardera.
    4. Applicera 200 μL sekundär antikropp (get anti-kanin IgG antikropp, utspädd 1: 200 i TBS innehållande 1% BSA och 5% NGS) till glidbanorna och inkubera vid RT i 40 min.
    5. Placera bilderna i en glasburk och tvätta dem tre gånger med 50 ml, 5 min vardera.
    6. För signalförstärkning, applicera HRP-konjugat streptavidinlösning till glidbanorna och inkubera i 10 min.
    7. Placera bilderna i en glasburk och tvätta dem tre gånger med 50 ml, 5 min vardera.
    8. Blanda DAB-peroxidas-substratlösningen, applicera 200 μl lösning på varje bild och inkubera i 1 min.
    9. Placera bilderna i en glasburk och skölj med kranvatten i 5 minuter.
    10. kontrast~~POS=TRUNCMed Mayers hematoxylin i 1 min.
    11. Tvätta bilderna med DW.
    12. Fortsätt att dehydrera och montera diabilderna i steg 2.6.
  6. Dehydrering och montering
    1. Dehydrera glidbanorna genom att flytta dem i följd genom 100 ml 70%, 80%, 90% och 100% EtOH, 30 s vardera.
    2. Doppa glidorna i två ändringar av xylen i 1 min vardera.
    3. Lägg till 50 μL monteringslösning på täckglasen och placera glidbanorna ovanpå.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

I denna studie genererade vi kondrogena pellets från CBMC-hiPSCs genom att framkalla tillväxtväxter från EBs. Kondrogen differentiering inducerades med användning av CBMC-hiPSCs med bekräftad hög pluripotens 11 . Ett enkelt schema av vårt protokoll visas i figur 1A . Före differentiering expanderades iPSC-kolonier ( Figur 1B ). De expanderade iPSC: erna monterades som EB för initiering av differentiering ( Figur 1C ). De genererade EB: erna fästes på gelatinbelagda rätter för att inducera utväxtceller ( Figur 1D ). Därefter skördades utväxtcellerna och användes för att generera kondrogena pellets. Efter 21 dygn differentiering erhölls små, pärlliknande kondrogena pellets och användes för ytterligare karaktärisering ( Figur 1E ). Kvaliteten hos den in vitro-genererade chonenDrogeniska pellets bekräftades genom olika analyser.

Vi utvärderade histologiskt kvaliteten på de kondrogena pelletsna på dag 21. BMSC-kondrogena pellets användes som positiv kontroll. Sammanställningen av ECM-proteiner utsöndrade av de differentierade kondrocyterna bekräftades genom alcianblå och toluidinblåfärgning i figur 2A . De viktigaste egenskaperna hos friskt brusk, såsom lacuna och proteoglykanproduktion, ökade då differentieringsprocessen fortsatte över 21 dagar. Kondrogena pellets genererade från CBMC-hiPSCs uttryckte COL2A1, vilket är den huvudsakliga ECM-komponenten i friskt brosk ( Figur 2B ). COL2A1-uttrycket av CBMC-hiPSC-härledda pellets var högre än för BMSC-härledda pellets. Expressionen av kollagen typ I, en markör för fibrotisk brosk, var lägre i CBMC-hiPSC-härledda pellets jämfört med uttrycket av COL2A1. Genuttrycket av brosk-ECM-proteiner i dag-21 kondrogena pellets bekräftades genom realtids-PCR. Agrecan (ACAN) -uttrycket av CBMC-hiPSC-härledda pellets liknade det för BMSC-härledda pellets ( Figur 3A ). Expressionen av COL2A1 var signifikant högre i CBMC-hiPSC-härledda pellets ( Figur 3B ). Uttrycket av könsbestämande region Y-box 9 (Sox9), en kondrogen progenitormarkör, utvärderades också. Pellets genererade från CBMC-hiPSCs uttryckte höga nivåer av Sox9 ( Figur 3C ). Vi bekräftade att dessa gener var signifikant uppreglerade i CBMC-hiPSC-kondrogena pellets jämfört med BMSC-kontrollpellets på dag 21. Expressionen av en hypertrofisk markör, COL1A1, utvärderades ( Figur 3D ). Uttrycket av COL1A1 i CBMC-hiPSC-härledda pellets reducerades jämfört med det i BMSC-deriVedpellets. Differentieringseffektiviteten analyserades genom förhållandet COL2A1 till COL1A1 ( Figur 3E ). Ökningen av förhållandet i CBMC-hiPSC-härledda pellets visade det relativt höga uttrycket av COL2A1 jämfört med COL1A1. Sammanfattningsvis har vi bekräftat den kondrogena differentieringskapaciteten hos CBMC-hiPSC. Kvaliteten hos de genererade CBMC-hiPSC-härledda kondrogena pelletsna hade en kvalitet kompatibel med den hos BMSCs.

Figur 1
Figur 1: Kondrogen differentiering av hiPSCs. ( A ) Schema för kondrogen pelletsgenerering från hiPSCs. ( B ) Morfologi för den genererade CBMC-hiPSC. ( C ) Morfologi av genererade EBs. ( D ) Odlingsceller härledda från EBs bundna till en gelatinbelagd odlingsskål. ( E ) Bild av t Han kondrogena pelleten efter 21 dagar av differentiering. Enheterna i intervallerna visas i millimeter. Skalstänger = 200 μm. Vänligen klicka här för att se en större version av denna figur.

Figur 2
Figur 2: Histologisk analys av kondrogenpelleten. ( A ) Histologisk utvärdering av kondrogena pellets på dag 21 med användning av alcianblå och toluidinblåfärgning. ( B ) Immunohistokemibild av kondrogena pellets färgade med COL1A1- och COL2A1-antikroppar. Skalstänger = 100 μm. Vänligen klicka här för att se en större version av denna figur.

1" > Figur 3
Figur 3: Genuttryck av kondrogenpelleten. ( A ) Relativt genuttryck av ACAN. ( B ) Relativt genuttryck av COL2A1. ( C ) Relativt genuttryck av SOX9. ( D ) Relativt genuttryck av COL1A1. ( E ) Genuttryck av COL1A1. ( F ) genuttryck av COL10A1. ( G ) Förhållandet mellan COL2A1: COL1A1-genuttryck. Pellets skördades och analyserades efter 21 dagar differentiering. Data erhölls med realtids-PCR och visades som medelvärdet för standardproblemet av triplikata experiment per prov (n = 3). Genuttrycket normaliserades till GAPDH som en intern kontroll. (* P <0,05, ** p <0,01, *** p <0,001).K "> Vänligen klicka här för att se en större version av denna figur.

Mobilnummer Utväxtcellutbyte Pelletsutbyte
hiPSCs 2 x 10 6 2-5 x 10 7 70-150
MSC 2 x 10 6 - 6

Tabell 1: Utbytesjämförelse av MSC och hiPSCs.

Målnamn Riktning Primer sekvens Storlek
Fram TTCCGCGACGTGGACAT 77 bp
Omvänd TCAAACTCGTTGACATCGAAGGT
EN BURK Fram AGCCTGCGCTCCAATGACT 107 bp
Omvänd TAATGGAACACGATGCCTTTCA
COL2A1 Fram GGCAATAGCAGGTTCACGTACA 79 bp
Omvänd CGATAACAGTCTTGCCCCACTTA
COL1A1 Fram CCCCTGGAAAGAATGGAGATG 148 bp
Omvänd TCCAAACCACTGAAACCTCTG

Tabell 2: Sekvenser av primrar mot kondrogenmarkörer i realtids-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Detta protokoll genererade framgångsrikt hiPSCs från CBMCs. Vi programmerade CBMCs till hiPSCs med en Sendai-viral vektor innehållande Yamanaka-faktorer 24 . Tre fall användes i differentiering, och alla experiment lyckades generera kondrogena pellets med användning av detta protokoll. Många studier har rapporterat protokoll för differentiering av hiPSCs till kondrocyter 25 , 26 , 27 , 28 . Ytterligare forskning krävs dock för att bekräfta användningen av CBMC-hiPSCs som en kandidat för regenerering och återvinning av brosk.

Kondrogenes bekräftades med användning av hiPSC genererade från olika somatiska celltyper 11 , 25 , 26 , 27 , 29 . Många rapporter visarAtt ursprunget för den somatiska cellen som används vid omprogrammering kan påverka differentieringsutbytet av hiPSCs 30 , 31 , 32 , 33 . Sladdblod är en källa som berikats med HSC och MSC. Det finns ingen rapport om skillnaden mellan blodceller som leder blod, som blodceller eller MSC. Tidigare studier har dock visat att artikulära kondrocyt-härledda hiPSCs är mer benägna att gå genom kondrogenes än hiPSCs genererade från trådblod eller hudfibroblaster 29 . Resultat från endoteldifferentiering med hjälp av hiPSC genererade från fibroblaster, hjärtprogenitorceller och endotelceller visade att vävnaden av ursprung kan reflektera det vävnadspecifika somatiska minnet i terminalt differentierad iPSC-derivat, särskilt vid tidiga passager, mellan 10 och 20 34 . I tidiga passager av hiPSCs, endotelcell-deriVid hiPSCs differentierade mer effektivt i endoteliala linjen. Den signifikanta skillnaden mellan dessa cellinjer försvann dock i hiPSCs över 20 passager. Därför är det viktigt att noggrant överväga det somatiska minnet som bärs av hiPSC i tidiga passager när de används i klinisk forskning.

Nyligen har olika förfaranden utvecklats för att reparera defekterad ledbrusk. Mikrofraktur görs genom att borra flera hål i benet för att inducera tillströmning av benmärg för naturlig reparation 35 . Knäbyte, även känd som knäartroplastisk, används för att ersätta det skadade brosket. Mikrofraktur är emellertid inte användbar för allvarlig skada på ledbrusk och instrumentet som används för knäbyte måste ändras var 10-15 år.

Numera är cellbaserade terapier en lovande alternativ metod för bruskreparation. Autolog chondrocytimplantation (ACI) är bredAnvänds för cellbaserad broskåtervinning. ACI görs genom att direkt injicera autologa kondrocyter i defekten. Autologa kondrocyter blir emellertid till fibroblastliknande celler under odlingsbetingelser in vitro . Ytterligare skador är också oundvikliga under skördprocessen av autologa kondrocyter. MSC har föreslagits som en cellkälla för bruskåtervinning. Sladdblod är en användbar och tillgänglig cellkälla för MSC för brusk 36 . Succesfrekvensen för isolering av sladd-blod-MSC är emellertid kontroversiell 37 , 38 . Många studier rapporterar om framgångsrik isolering av sladd-blod-MSC. Flera studier har visat att blodvolymen är en kritisk parameter som kan påverka utbytet av MSC-isolering 36 , 39 . För att erhålla högkvalitativa MSC är också cellernas passage kritisk. Tidigare studier indikerar thaT MSC har en begränsad livslängd efter ett visst cellfördelningsnummer. Genom att gå in i senescens kännetecknas MSC av minskad proliferation, som med någon vanlig somatisk cell 40 . Därför måste ledningsblod-härledda MSC användas före den sjätte gången för att undvika cellernas senescens och kromosomala avvikelser 41 .

För att undvika dessa begränsningar öppnade mänskliga iPSCs en ny möjlighet till personlig, cellbaserad terapi med hög produktivitet 11 . Etablerade hiPSCs kan teoretiskt sprida sig obegränsat. Även med samma immunidentitet som givaren kan de undvika avstötning och lägre biverkningar när de implanteras in vivo . Övergången av trådblodbanker till hiPSC-banker för allogen medicinsk behandling har en enorm möjlighet och potential 42 . Screeningen av homozygote HLA-typade CBMC före omprogrammering kan i stor utsträckning utnyttja de allogena iPSC-linjerna foR klinisk behandling. Homozygotiska iPSC-linjer kan undvika immunologiska reaktioner efter allograftransplantation. Detta koncept kan också tillämpas på broskregenerering genom att generera HLA-homozygot brosk 11 .

Vanligtvis utförs chondrogen differentiering genom två kritiska steg: induktionen av EB-härledda odlingsceller och pelletsbildning. Den initiala differentieringen av hiPSCs i EB-härledda utväxtceller är kritisk för att öka sin kondrogena differentieringspotential. Utväxtväxtceller differentierade från hiPSCs är funktionellt och molekylärt likartade med nativa BMSCs 7 , 43 . Tidigare studier använde monolagskultur eller EB-kultur som ett pre-differentieringssteg för att inducera mesenkymliknande celler 10 , 43 . Direkt differentiering av monolagskultur är emellertid tidskrävande jämfört med användningen av EB och ch Ondrogena pellets tenderar att differentiera till fibrocartilage med hypertrofa egenskaper. Det rapporterades att cellmorfologi och den kondrogena differentieringspotentialen hos genererade mesenkymliknande progenitorceller skiljer sig mycket beroende på celldensiteten hos cellmonolagret 9 .

Vi använde EBs för att inducera tillväxtväxter, vilket är en relativt snabb och enkel metod jämfört med monolagskulturen. Med hjälp av detta protokoll kunde vi generera många pellets med ett relativt litet antal hiPSCs ( tabell 1 ). Storleken och antalet EBs var kritiska för framgångsrik kondrogen pelletsmassaproduktion. Därför utvidgade vi de aggregerade EB: erna i E8-medium, tills mer än hälften av de genererade EB: erna var större än 100 μm. Efter EB-utvidgning upprätthöll vi EBs i E8-medium utan FGF2. Tidigare upprätthöll forskare genererade EBs utan FGF2 för mesodermal linjelinduktionXref "> 9.

Trots att vi försökte bibehålla de genererade tillväxtväxtcellerna med en hög densitet för bättre kvalitet kvarstår det fortfarande flera begränsningar. Medan vi har bekräftat att de genererade tillväxtväxtcellerna delar en liknande morfologi, kan cellerna fortfarande vara heterogena. Tidigare studier har försökt sortera för en viss celltyp; Emellertid har denna procedur resulterat i insamling av ett lågt antal celler. Ett nytt försök att isolera homogena tillväxtväxter i större skala kommer att krävas för att generera en stor mängd kondrogena pellets med förbättrade egenskaper.

Olika grupper inducerar progenitorceller från hiPSCs med användning av monoskikt eller EB-kultur. Induktionen av stamceller med hög likhet med MSC kan vara nyckeln till att erhålla chondrogena pellets av högre kvalitet. Dessa stamceller som härrör från EBs har egenskaper liknande dem hos MSC. Detta kan dock vara på grund avIr fibroblastisk natur. Därför krävs en detaljerad valideringsstudie på utväxtcellerna.

I denna studie föreslår vi ett protokoll som kan generera en relativt stor mängd kondrogena pellets. Vi bekräftade att brusk regenererat med hjälp av CBMC-hiPSCs visade en hälsosam fenotyp och kan användas som material för vävnadsregenerering. En förbättrad metod med en kortare differentierings tidslinje krävs emellertid för vidare tillämpning. Den vidare utvecklingen av kvalitetskontrollstandarder för att validera brosk med högre hyalinivå krävs också för framtida tillämpningar av CBMC-hiPSCs som cellmaterial för bruskregenerering. Protokollet är enkelt men ändå effektivt och kräver inga ytterligare sorteringsprocesser före pelletsbildning. Sammanfattningsvis kan man med hjälp av detta protokoll producera högkvalitativa kondrogena pellets för studier av sjukdomsmodellering, läkemedelsscreening och regenerativ medicin för att ytterligare förstå vår tHan broskets natur.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har ingenting att avslöja.

Acknowledgements

Detta arbete stöddes av ett bidrag från Korea Healthcare Technology FoU-projektet, ministeriet för hälsa, välfärd och familjefrågor, Republiken Korea (HI16C2177).

Materials

Name Company Catalog Number Comments
Plasticware
100 mm Dish TPP 93100
6-well Plate TPP 92006
50 mL Cornical Tube SPL 50050
15 mL Cornical Tube SPL 50015
10 mL Disposable Pipette Falcon 7551
5 mL Disposable Pipette Falcon 7543
12-well Plate TPP 92012
Name Company Catalog Number Description
E8 Medium Materials
DMEM/F12, HEPES Life Technologies 11330-057 E8 Medium (500 mL)
Sodium Bicarbonate Life Technologies 25080-094 E8 Medium (Conc.: 543 μg/mL)
Sodium Selenite Sigma Aldrich S5261 E8 Medium  (Conc.: 14 ng/mL)
Human Transfferin Sigma Aldrich T3705 E8 Medium (Conc.: 10.7 μg/mL)
Basic FGF2 Peprotech 100-18B E8 Medium  (Conc.: 100 ng/mL)
Human Insulin Life Technologies 12585-014 E8 Medium (Conc.: 20 μg/mL)
Human TGFβ1 Peprotech 100-21 E8 Medium (Conc.: 2 ng/mL)
Ascorbic Acid Sigma Aldrich A8960 E8 Medium  (Conc.: 64 μg/mL)
DPBS Life Technologies 14190-144
Vitronectin Life Technologies A14700
ROCK Inhibitor Sigma Aldrich Y0503
Name Company Catalog Number Description
Quality Control Materials
18 mm Cover Glass Superior HSU-0111580
4% Paraformaldyhyde Tech & Innovation BPP-9004
Triton X-100 BIOSESANG 9002-93-1
Bovine Serum Albumin Vector Lab SP-5050
Anti-SSEA4 Antibody Millipore MAB4304
Anti-Oct4 Antibody Santa Cruz SC9081
Anti-TRA-1-60 Antibody Millipore MAB4360
Anti-Sox2 Antibody Biolegend 630801
Anti-TRA-1-81 Antibody Millipore MAB4381
Anti-Klf4 Antibody Abcam ab151733
Alexa Fluor 488 goat anti-mouse IgG (H+L) antibody Molecular Probe A11029
Alexa Fluor 594 goat anti-rabbit IgG (H+L) antibody Molecular Probe A11037
DAPI Molecular Probe D1306
Prolong gold antifade reagent Invitrogen P36934
4% Paraformaldyhyde Tech & Innovation BPP-9004
Tween 20 BIOSESANG T1027
Bovine Serum Albumin Vector Lab SP-5050
Anti-Collagen II antibody abcam  ab34712 1:100
Alcian blue Sigma Aldrich A3157-10G
Fast Green FCF Sigma Aldrich F7252-25G
Safranin O Sigma Aldrich 090m0039v
Nuclear fast red Americanmastertech STNFR100 
xylene Duksan 115 
Ethanol Duksan 64-17-5
Mayer's hematoxylin solution wako pure chemical industries LAK7534
DAP VECTOR LABORATORIES SK-4100
Slide Glass, Coated Hyun Il Lab-Mate HMA-S9914
Trizol Invitrogen 15596-018
Chloroform Sigma Aldrich 366919
Isoprypylalcohol Millipore 109634
Ethanol Duksan 64-17-5
RevertAid First Strand cDNA Synthesis kit Thermo Scientfic K1622
Name Company Catalog Number Description
Chondrogenic Differentiation Materials
DMEM Life Technologies 11885 Chondrogenic media component (500 mL)
Penicilin Streptomycin Life Technologies P4333 Chondrogenic media component (Conc.: 1%)
Ascorbic Acid Sigma Aldrich A8960 Chondrogenic media component (Conc.: 64 μg/mL) 
MEM Non-Essential Amino Acids Solution (100x) Life Technologies 11140-050 Chondrogenic media component (Conc.: 100 mM)
rhBMP-2 R&D 355-BM-050 Chondrogenic media component (Conc.:100 ng/ml)
Recombinant Hman TGF-beta3 R&D 243-B3-002 Chondrogenic media component (Conc.:10 ng/ml)
KnockOut Serum Replacement Life Technologies 10828-028 Chondrogenic media component (Conc.: 1%)
ITS+ Premix BD 354352 Chondrogenic media component (Conc.: 1%)
Dexamethasone-Water Soluble  Sigma Aldrich D2915-100MG Chondrogenic media component (Conc.:10-7 M)
GlutaMAX Supplement Life Technologies 35050-061 Chondrogenic media component (Conc.: 1%)
Sodium pyruvate solution Sigma Aldrich S8636 Chondrogenic media component (Conc.: 1%)
L-Proline Sigma Aldrich P5607-25G Chondrogenic media component (40 μg/ml)

DOWNLOAD MATERIALS LIST

References

  1. van Osch, G. J., et al. Cartilage repair: past and future--lessons for regenerative medicine. J Cell Mol Med. 13, (5), 792-810 (2009).
  2. Ahmed, T. A., Hincke, M. T. Strategies for articular cartilage lesion repair and functional restoration. Tissue Eng Part B Rev. 16, (3), 305-329 (2010).
  3. Diekman, B. O., et al. Cartilage tissue engineering using differentiated and purified induced pluripotent stem cells. Proc Natl Acad Sci USA. 109, (47), 19172-19177 (2012).
  4. Solchaga, L. A., Penick, K., Goldberg, V. M., Caplan, A. I., Welter, J. F. Fibroblast growth factor-2 enhances proliferation and delays loss of chondrogenic potential in human adult bone-marrow-derived mesenchymal stem cells. Tissue Eng Part A. 16, (3), 1009-1019 (2010).
  5. Guzzo, R. M., Drissi, H. Differentiation of Human Induced Pluripotent Stem Cells to Chondrocytes. Methods Mol Biol. 1340, 79-95 (2015).
  6. Drissi, H., Gibson, J. D., Guzzo, R. M., Xu, R. H. Derivation and Chondrogenic Commitment of Human Embryonic Stem Cell-Derived Mesenchymal Progenitors. Methods Mol Biol. 1340, 65-78 (2015).
  7. Nejadnik, H., et al. Improved approach for chondrogenic differentiation of human induced pluripotent stem cells. Stem Cell Rev. 11, (2), 242-253 (2015).
  8. Teramura, T., et al. Induction of mesenchymal progenitor cells with chondrogenic property from mouse-induced pluripotent stem cells. Cell Reprogram. 12, (3), 249-261 (2010).
  9. Koyama, N., et al. Human induced pluripotent stem cells differentiated into chondrogenic lineage via generation of mesenchymal progenitor cells. Stem Cells Dev. 22, (1), 102-113 (2013).
  10. Ko, J. Y., Kim, K. I., Park, S., Im, G. I. In vitro chondrogenesis and in vivo repair of osteochondral defect with human induced pluripotent stem cells. Biomaterials. 35, (11), 3571-3581 (2014).
  11. Nam, Y., Rim, Y. A., Jung, S. M., Ju, J. H. Cord blood cell-derived iPSCs as a new candidate for chondrogenic differentiation and cartilage regeneration. Stem Cell Res Ther. 8, (1), 16 (2017).
  12. Hotten, G. C., et al. Recombinant human growth/differentiation factor 5 stimulates mesenchyme aggregation and chondrogenesis responsible for the skeletal development of limbs. Growth Factors. 13, (1-2), 65-74 (1996).
  13. Murphy, M. K., Huey, D. J., Hu, J. C., Athanasiou, K. A. TGF-beta1, GDF-5, and BMP-2 stimulation induces chondrogenesis in expanded human articular chondrocytes and marrow-derived stromal cells. Stem Cells. 33, (3), 762-773 (2015).
  14. Shintani, N., Siebenrock, K. A., Hunziker, E. B. TGF-ss1 enhances the BMP-2-induced chondrogenesis of bovine synovial explants and arrests downstream differentiation at an early stage of hypertrophy. PLoS One. 8, (1), e53086 (2013).
  15. Fukumoto, T., et al. Combined effects of insulin-like growth factor-1 and transforming growth factor-beta1 on periosteal mesenchymal cells during chondrogenesis in vitro. Osteoarthritis Cartilage. 11, (1), 55-64 (2003).
  16. Worster, A. A., Nixon, A. J., Brower-Toland, B. D., Williams, J. Effect of transforming growth factor beta1 on chondrogenic differentiation of cultured equine mesenchymal stem cells. Am J Vet Res. 61, (9), 1003-1010 (2000).
  17. Knippenberg, M., et al. Differential effects of bone morphogenetic protein-2 and transforming growth factor-beta1 on gene expression of collagen-modifying enzymes in human adipose tissue-derived mesenchymal stem cells. Tissue Eng Part A. 15, (8), 2213-2225 (2009).
  18. Jang, Y., et al. Centrifugal gravity-induced BMP4 induces chondrogenic differentiation of adipose-derived stem cells via SOX9 upregulation. Stem Cell Res Ther. 7, (1), 184 (2016).
  19. Kang, R., et al. Mesenchymal stem cells derived from human induced pluripotent stem cells retain adequate osteogenicity and chondrogenicity but less adipogenicity. Stem Cell Res Ther. 6, 144 (2015).
  20. Tao, H., et al. Biological evaluation of human degenerated nucleus pulposus cells in functionalized self-assembling peptide nanofiber hydrogel scaffold. Tissue Eng Part A. 20, (11-12), 1621-1631 (2014).
  21. Sekiya, I., Larson, B. L., Vuoristo, J. T., Reger, R. L., Prockop, D. J. Comparison of effect of BMP-2, -4, and -6 on in vitro cartilage formation of human adult stem cells from bone marrow stroma. Cell Tissue Res. 320, (2), 269-276 (2005).
  22. Shen, B., Wei, A., Tao, H., Diwan, A. D., Ma, D. D. BMP-2 enhances TGF-beta3-mediated chondrogenic differentiation of human bone marrow multipotent mesenchymal stromal cells in alginate bead culture. Tissue Eng Part A. 15, (6), 1311-1320 (2009).
  23. Rim, Y. A., Nam, Y., Ju, J. H. Induced Pluripotent Stem Cell Generation from Blood Cells Using Sendai Virus and Centrifugation. J Vis Exp. (118), (2016).
  24. Kim, Y., et al. The Generation of Human Induced Pluripotent Stem Cells from Blood Cells: An Efficient Protocol Using Serial Plating of Reprogrammed Cells by Centrifugation. Stem Cells Int. 2016, 1329459 (2016).
  25. Oldershaw, R. A., et al. Directed differentiation of human embryonic stem cells toward chondrocytes. Nat Biotechnol. 28, (11), 1187-1194 (2010).
  26. Toh, W. S., et al. Differentiation and enrichment of expandable chondrogenic cells from human embryonic stem cells in vitro. J Cell Mol Med. 13, (9B), 3570-3590 (2009).
  27. Hwang, N. S., Varghese, S., Elisseeff, J. Derivation of chondrogenically-committed cells from human embryonic cells for cartilage tissue regeneration. PLoS One. 3, (6), e2498 (2008).
  28. Nakagawa, T., Lee, S. Y., Reddi, A. H. Induction of chondrogenesis from human embryonic stem cells without embryoid body formation by bone morphogenetic protein 7 and transforming growth factor beta1. Arthritis Rheum. 60, (12), 3686-3692 (2009).
  29. Guzzo, R. M., Scanlon, V., Sanjay, A., Xu, R. H., Drissi, H. Establishment of human cell type-specific iPS cells with enhanced chondrogenic potential. Stem Cell Rev. 10, (6), 820-829 (2014).
  30. Rim, Y. A., Park, N., Nam, Y., Ju, J. H. Generation of Induced-pluripotent Stem Cells Using Fibroblast-like Synoviocytes Isolated from Joints of Rheumatoid Arthritis Patients. J Vis Exp. (116), (2016).
  31. Pfaff, N., et al. Efficient hematopoietic redifferentiation of induced pluripotent stem cells derived from primitive murine bone marrow cells. Stem Cells Dev. 21, (5), 689-701 (2012).
  32. Xu, H., et al. Highly efficient derivation of ventricular cardiomyocytes from induced pluripotent stem cells with a distinct epigenetic signature. Cell Res. 22, (1), 142-154 (2012).
  33. Lee, S. B., et al. Contribution of hepatic lineage stage-specific donor memory to the differential potential of induced mouse pluripotent stem cells. Stem Cells. 30, (5), 997-1007 (2012).
  34. Hu, S., et al. Effects of cellular origin on differentiation of human induced pluripotent stem cell-derived endothelial cells. JCI Insight. 1, (8), 1-12 (2016).
  35. Vonk, L. A., de Windt, T. S., Slaper-Cortenbach, I. C., Saris, D. B. Autologous, allogeneic, induced pluripotent stem cell or a combination stem cell therapy? Where are we headed in cartilage repair and why: a concise review. Stem Cell Res Ther. 6, (94), 1-11 (2015).
  36. Gomez-Leduc, T., et al. Chondrogenic commitment of human umbilical cord blood-derived mesenchymal stem cells in collagen matrices for cartilage engineering. Sci Rep. 6, 32786 (2016).
  37. Mareschi, K., et al. Isolation of human mesenchymal stem cells: bone marrow versus umbilical cord blood. Haematologica. 86, (10), 1099-1100 (2001).
  38. Wexler, S. A., et al. Adult bone marrow is a rich source of human mesenchymal 'stem' cells but umbilical cord and mobilized adult blood are not. Br J Haematol. 121, (2), 368-374 (2003).
  39. Zhang, X., et al. Isolation and characterization of mesenchymal stem cells from human umbilical cord blood: reevaluation of critical factors for successful isolation and high ability to proliferate and differentiate to chondrocytes as compared to mesenchymal stem cells from bone marrow and adipose tissue. J Cell Biochem. 112, (4), 1206-1218 (2011).
  40. Wagner, W., et al. Replicative senescence of mesenchymal stem cells: a continuous and organized process. PLoS One. 3, (5), e2213 (2008).
  41. Tarte, K., et al. Clinical-grade production of human mesenchymal stromal cells: occurrence of aneuploidy without transformation. Blood. 115, (8), 1549-1553 (2010).
  42. Chen, W. C., et al. Prediction of poor survival by cyclooxygenase-2 in patients with T4 nasopharyngeal cancer treated by radiation therapy: clinical and in vitro studies. Head Neck. 27, (6), 503-512 (2005).
  43. Guzzo, R. M., Gibson, J., Xu, R. H., Lee, F. Y., Drissi, H. Efficient differentiation of human iPSC-derived mesenchymal stem cells to chondroprogenitor cells. J Cell Biochem. 114, (2), 480-490 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics