Kondrogen pelletsdannelse fra Cord Blood-avledede Induced Pluripotent Stamceller

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Her foreslår vi en protokoll for kondrogen differensiering fra blodblodmononukleærcelle-avledede, menneskeskapte pluripotente stamceller.

Cite this Article

Copy Citation | Download Citations

Nam, Y., Rim, Y. A., Ju, J. H. Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells. J. Vis. Exp. (124), e55988, doi:10.3791/55988 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Menneskelig leddbrusk mangler evnen til å reparere seg selv. Bruskdegenerasjon behandles således ikke ved kurativ, men ved konservative behandlinger. For tiden er det gjort anstrengelser for å regenerere ødelagt brusk med eks vivo utvidede kondrocytter eller benmarg-avledede mesenkymale stamceller (BMSCs). Den begrensede levedyktighet og ustabilitet av disse cellene begrenser imidlertid deres anvendelse i bruskutbygging. Menneskeinducerte pluripotente stamceller (hiPSCs) har fått vitenskapelig oppmerksomhet som et nytt alternativ for regenerative applikasjoner. Med ubegrenset selvfornyelsesevne og multipotency har hiPSCs blitt uthevet som en ny erstatningscellekilde for brusk reparasjon. Imidlertid er det en stor utfordring for deres kliniske anvendelse å skaffe en høy mengde chondrogenpellets av høy kvalitet. I denne studien brukte vi embryoidlegemer (EB) -avlede utvoksningsceller for kondrogen differensiering. Vellykket kondrogenese ble bekreftet av PCR anD-farvning med alcianblått, toluidinblått og antistoffer mot henholdsvis kollagentyper I og II (henholdsvis COL1A1 og COL2A1). Vi gir en detaljert metode for differensiering av blodmononukleære celle-avledede iPSCs (CBMC-hiPSCs) i kondrogenpellets.

Introduction

Bruken av hiPSCs representerer en ny strategi for narkotika-screening og mekanistiske studier av ulike sykdommer. Fra et regenerativt perspektiv er hiPSCer også en potensiell kilde for erstatning av skadede vev som har begrenset helbredelsesevne , som leddbrusk 1 , 2 .

Regenerering av innfødt leddbrusk har vært en utfordring i flere tiår. Articular brusk er et mykt, hvitt vev som belegger enden av bein, beskytter dem mot friksjon. Imidlertid har den begrenset regenerativ evne når den er skadet, noe som gjør selvreparasjon nesten umulig. Derfor har forskning fokusert på bruskregenerering vært igangsatt i flere tiår.

Tidligere ble in vitro differensiering i kondrogene linjer vanligvis utført med BMSC'er eller native kondrocytter isolert fra knæleddet 3 . DuettO deres kondrogen potensial, BMSC og nasjonale kondrocytter har mange fordeler som støtter deres bruk i kondrogenese. På grunn av deres begrensede ekspansjon og ustabile fenotype står imidlertid disse cellene overfor flere begrensninger i rekonstruksjonen av leddbruskdefekter. Under in vitro kulturbetingelser har disse cellene en tendens til å miste sine egne egenskaper etter 3-4 passasjer, noe som til slutt påvirker deres differensieringsevner 4 . Også i tilfelle av nasjonale kondrocytter er ytterligere skade på kneleddet uunngåelig ved oppnåelse av disse cellene.

I motsetning til BMSCs eller native kondrocytter, kan hiPSCs utvide ubestemt in vitro . Med de rette kulturbetingelsene har hiPSCs stort potensial som en erstatningskilde for kondrogen differensiering. Imidlertid er det utfordrende å endre hjerteegenskapene til hiPSCs 5 . Videre tar det flere kompliserte in vitro stePs å lede skjebnen til hiPSCs til en bestemt celletype. Til tross for disse komplikasjonene anbefales bruk av hiPSCs fortsatt på grunn av deres høye selvfornyelsesevner og deres evne til å skille seg inn i målrettede celler, inkludert kondrocyter 6 .

Kondrogen differensiering gjøres vanligvis med tredimensjonale kultursystemer, slik som pelletkulturen eller mikromasskulturen, ved bruk av MSC-lignende stamceller. Hvis du bruker hiPSCs, er protokollen for å generere MSC-lignende stamceller forskjellig fra de eksisterende protokollene. Noen grupper bruker monolagskultur av hiPSCs for direkte å konvertere fenotypen til MSC-lignende celler 7 . Imidlertid bruker de fleste studier EBs til å generere vekstceller som ligner MSCs 8 , 9 , 10 , 11 .

Ulike typer vekstfaktorer brukes til å indusere kondomNesis. Vanligvis brukes BMP- og TGFβ-familieproteiner, alene eller i kombinasjon. Differensiering har også blitt indusert med andre faktorer, slik som GDF5, FGF2 og IGF1 12 , 13 , 14 , 15 . TGFβ1 har vist seg å stimulere kondrogenese på en doseavhengig måte i MSCs 16 . Sammenlignet med den andre isotypen, TGFβ3, inducerer TGFβ1 kondrogenese ved å øke pre-brusk mesenkymcellekondensasjon. TGFβ3 inducerer kondrogenese ved betydelig økning av mesenkymcelleproliferasjonen 17 . Imidlertid brukes TGFβ3 oftere av forskere enn TGFβ1 7 , 10 , 18 , 19 . BMP2 øker ekspresjonen av gener relatert til kondrogen-matriks-komponentene i menneskerArtikulære kondrocytter under in vitro betingelser 20 . BMP2 øker ekspresjonen av gener som er kritiske for bruskdannelse i MSCs i kombinasjon med TGFβ-proteiner 21 . Det har også blitt vist at BMP2 synergistisk forbedrer effekten av TGFβ3 gjennom Smad og MAPK-veiene 22 .

I denne studien ble CBMC-hiPSCs aggregert i EB'er ved bruk av EB-medium i en petriskål med lav vedlegg. Utvekstceller ble indusert ved å feste EBsene til en gelatine-belagt parabolen. Kondrogen differensiering ved bruk av utvekstceller ble utført ved pelletkultur. Behandling med både BMP2 og TGFβ3 kondenserte vellykket cellene og indusert ekstracellulær matriks (ECM) proteinakkumulering for kondrogen pelletsdannelse. Denne studien antyder en enkel, men effektiv kronondrogen differensieringsprotokoll ved bruk av CBMC-hiPSCs.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Denne protokollen ble godkjent av det institusjonelle gjennomgangskortet til det katolske universitetet i Korea (KC12TISI0861). CBMCs som ble brukt til omprogrammering, ble direkte hentet fra Cord Blood Bank i Seoul St. Marys Hospital.

1. Kondrogen Differensiering fra iPSCs

  1. CBMC-iPSC generasjon
    1. Generer CBMC-hiPSCs ved hjelp av protokollen vist i vårt tidligere arbeid 23 .
    2. Samle blodcellene i et 15 ml konisk rør og telle dem ved hjelp av et hemocytometer.
    3. Klargjør 3 x 10 5 celler og sentrifuger dem i 5 minutter ved 515 xg og RT. Kast supernatanten ved suging og resuspender cellene i 0,5 ml blodcellemedium.
    4. Overfør cellene til en brønn i en ikke-belagt 24-brønn plate og legg til Sendai-virusblandingen, etter produsentens anbefalinger.
    5. Sentrifuger platen i 30 minutter ved 1.150 xg og 30 ° C.
    6. AftCentrifugering inkuberer cellene over natten (O / N) ved 37 ° C i 5% C02.
    7. Neste dag, overfør de transduserte cellene til en matriksbelagt brønn. Sentrifuger platen ved 1,150 xg i 30 minutter ved 30 ° C.
    8. Etter sentrifugering, fjern supernatanten, tilsett 1 ml iPSC-medium, og opprettholde cellene O / N ved 37 ° C i 5% CO 2 .
    9. Vedlikehold de vedlagte cellene ved 37 ° C og 5% CO 2 . Bytt mediet daglig, erstatt det med nytt iPSC-medium.
      MERK: Kolonier vises på dag 14-21 etter transduksjon.
  2. EB generasjon
    1. Opprettholde hiPSCs ved 37 ° C og 5% CO 2 . Bytt mediet daglig, erstatt det med fersk Essential 8 (E8) medium.
    2. Klargjør 2 x 10 6 hiPSCs i en vitronektinbelagt 100 mm rett i E8-medium.
    3. Fjern E8-mediet fra kulturskålen og vask med sterilt fosfatbuffert saltvann (PBS).
    4. Legg til 1Ml 1 mM etylendiamintetraeddiksyre (EDTA) og inkuber ved 37 ° C og 5% CO2 i 2 minutter.
    5. Høst cellene med 3 ml E8-medium og overfør dem til et nytt 15-ml konisk rør. Sentrifuger cellene ved 250 xg ved romtemperatur (RT) i 2 minutter.
    6. Aspirer supernatanten uten å forstyrre cellepellet og resuspender cellene i 5 ml E8-medium.
    7. Telle cellene ved hjelp av et hemocytometer og lag 2 x 10 6 celler for hver 100 mm petriskål. Resuspender de preparerte celler i en 10 ml blanding av E8 og EB medium (1: 1) med 10 μM rho-assosiert kinase (ROCK) inhibitor.
    8. Inkubér cellene O / N for aggregering ved 37 ° C og 5% CO2.
    9. Påfølgende dag høst de aggregerte EB-ene ved pipettering. Sentrifuger cellene ved 250 xg i 1 min. Fjern supernatanten og resuspender EB-ene i 10 ml frisk E8-medium.
    10. Forstør de genererte EB-ene i 5 dager, og utfør daglige endringer med freserH E8 medium. For ytterligere modning, bytt kulturmedium til E7-medium. Opprettholde EBs ved 37 ° C og 5% CO 2 i ytterligere 5 dager, og utfør daglige mediumendringer med nytt E7-medium.
      MERK: E7 medium er E8 medium uten FGF2.
  3. Utvekstcelleinduksjon fra EBs
    1. Tilsett 6 ml 1% gelatin til en 100 mm rett og inkuber ved 37 ° C og 5% CO2 i 30 minutter.
    2. Fjern gelatinen og tørk parabolen helt i 2-3 timer før bruk.
    3. Overfør EB-ene til et 50 ml konisk rør. Tillat at EB-ene settes til bunnen av konisk rør. Fjern supernatanten uten å forstyrre EBs.
    4. Resuspender EB-ene i 10 ml Dulbecco's Modified Eagle's Medium (DMEM) med 20% føtalt bovint serum (FBS). Overfør EB-ene til gelatin-belagt, 100 mm rett. Legg til 10 μM ROCK inhibitor.
    5. Inkuber og vedlikehold cellene ved 37 ° C og 5% CO2 i 7 dager. Bytt temaDium annenhver dag uten å legge til ROCK-hemmer.
  4. Kondrogen pelletdannelse
    1. Aspirer kulturmediet fra parabolen og vaske cellene tre ganger med PBS.
    2. Påfør 1 ml 1 mM EDTA og inkuber ved 37 ° C og 5% CO2 i 2 minutter.
    3. Høst cellene ved å bruke 5 ml DMEM med 20% FBS og overfør dem til et nytt 15 ml konisk rør.
    4. Sentrifuger cellene i 2 minutter ved 250 xg og RT. Kast supernatanten og resuspender pelleten i 10 ml DMEM med 20% FBS.
    5. Filtrer og kast celleklumpene ved hjelp av en 40 μm cellefilter og høst enkeltcellene. Telle enkeltcellene ved hjelp av et hemocytometer.
    6. Sentrifuger cellene i 2 minutter ved 250 xg og RT. Fjern supernatanten og frø 3 x 10 5 celler per pellet i et 15 ml konisk rør med 300 μl kondrogen differensieringsmedium (CDM).
    7. For pelletdannelse, sentrifuger cellene i 5 minutter ved680 xg og RT.
      MERK: Pellets opprettholdes i 15 ml koniske rør under differensiering av kondrogenpellets.
    8. Inkubér cellene over natten ved 37 ° C og 5% CO2.
    9. Endre CDM hver 2-3 dager. Innen 3 dager vil pellets oppvise flattede, sfæriske morfologier. Opprettholde pellets i 21 dager ved 37 ° C og 5% CO 2 .

2. Kondrogen pelletskarakterisering ved farging

  1. Kondrogen innkapsling
    1. Før embedding, forberede og smelte paraffin ved 58 ° C.
    2. Fest pelletsene i 1 ml 4% paraformaldehyd i 2 timer ved RT i et 1,5 ml rør.
      Forsiktig: Paraformaldehyd er svært giftig. Unngå kontakt med øyne, hud eller slimhinner. Minimer eksponering og unngå innånding mens du forbereder det.
    3. Legg ett lag av gasbind på kassetten og overfør de faste pelletsene med en pipette. Dekk pelleten ved å legge den sammenE gauze og lukk kassettlokket.
    4. Start dehydrering i 100 ml 70% etanol (EtOH) to ganger, 10 minutter hver. Dehydrer pelletsene gjennom sekvensielle 10-minutters vask i 80% og 95% EtOH.
    5. Overfør pelletsene til 100% EtOH i 10 minutter. Gjenta tre ganger med fersk EtOH.
    6. For "rydding" byttes løsningen på en 100 ml, 1: 1 blanding av EtOH og xylen, etterfulgt av en 1: 2 blanding av EtOH og xylen i 10 minutter hver. Fjern gjenværende EtOH ved inkubering av pelletsene to ganger i 100% xylen, 10 minutter hver.
    7. Til paraffininfiltrering inkuberer pelletsene i sekvensielle xylen- og paraffinblandinger. Utfør hele paraffininfiltrasjonsprosessen ved 58 ° C. Inkuber pelletsene i 100 ml av en 2: 1 blanding av xylen og paraffin i 30 minutter.
    8. Bytt opp løsningen for 100 ml av en 1: 1 blanding av xylen og paraffin og inkuber i 30 minutter.
    9. Bytt opp løsningen for 100 ml av en 1: 2 blanding av xylen og paraffin og inkuber for 30 min.
    10. For den siste infiltreringen, overfør pelletsene til det første badet med 100% paraffin og inkuber i 2 timer.
    11. Overfør pelletsene til det andre badet med 100% paraffin og inkuber O / N ved 58 ° C.
    12. Neste dag, overfør pellene forsiktig til en mold ved hjelp av en pinsett. Tilsett paraffin til formen fra paraffindispenseren. Stiv paraffinen i 30 minutter ved 4 ° C.
    13. Skjær seksjonene på 7 μm og overfør delene på lysbildet. La lysbildene tørke over natten og lagre lysbildene ved RT til de er klare til bruk.
  2. Slide forberedelse
    1. Deparaffiniser lysbildene ved å flytte dem gjennom 100 ml 100%, 90%, 80% og 70% EtOH sekvensielt i 5 minutter hver.
    2. Plasser lysbildene i en glassbeholder og skyll med vann fra springen i 5 minutter.
  3. Alcian blå flekker
    1. Inkubér lysbildene i 50 ml 1% alcian blå løsning i 30 minutter.
      IKKEE: Alcian blå fortynnes i 3% eddiksyreoppløsning. Juster pH til 2,5 med eddiksyre.
    2. Plasser lysbildene i en glasskurv og skyll med vann fra springen i 2 minutter.
    3. Skyll lysbildene i deionisert vann (DW) og motstøt med kjernefysisk rød rød løsning i 2 minutter.
    4. Plasser lysbildene i en glasskrukke og skyll med kranvann i 1 min.
    5. 2.3.5) Fortsett å dehydrere og montere lysbildene i trinn 2.6.
  4. Toluidine blå farging
    1. Inkubér lysbilder i 50 ml toluidinblåttoppløsning i 4 min.
    2. Plasser lysbildene i en glassbeholder og skyll med vann fra springen i 5 minutter.
    3. Fortsett å dehydrere og montere lysbildene i trinn 2.6.
  5. Immunohistokjemisk farging
    1. Inkubér lysbildene i 3% H202 i 15 minutter for endogen peroksidase blokkering.
    2. Påfør 200 μl primær antistoff (anti-COL1A1 og -COL2A1) fortynnet 1: 100 i tris-buFersket saltvann (TBS) inneholdende 1% bovint serumalbumin (BSA) og 5% normalt geitserum (NGS) til lysbildene og inkuberer O / N ved 4 ° C.
    3. Neste dag, plasser lysbildene i en glassburk og vask dem med 50 ml TBS som inneholder 0,1% polysorbat 20 (TBST) tre ganger i 5 minutter hver.
    4. Påfør 200 μL sekundært antistoff (geit anti-kanin IgG antistoff, fortynnet 1: 200 i TBS inneholdende 1% BSA og 5% NGS) til lysbildene og inkuber ved RT i 40 minutter.
    5. Plasser lysbildene i en glassburk og vask dem tre ganger med 50 ml, 5 min hver.
    6. For signalforsterkning, bruk HRP-konjugat streptavidinløsning til lysbildene og inkuber i 10 minutter.
    7. Plasser lysbildene i en glassburk og vask dem tre ganger med 50 ml, 5 min hver.
    8. Bland DAB-peroksidasubstratoppløsningen, påfør 200 μl løsning til hvert lysbilde og inkuber i 1 min.
    9. Plasser lysbildene i en glassbeholder og skyll med vann fra springen i 5 minutter.
    10. motfargeMed Mayer's hematoksylin i 1 min.
    11. Vask lysbildene med DW.
    12. Fortsett å dehydrere og montere lysbildene i trinn 2.6.
  6. Dehydrering og montering
    1. Dehydrer lysbildene ved å bevege dem sekvensielt gjennom 100 ml 70%, 80%, 90% og 100% EtOH, 30 s hver.
    2. Dyp lysbildene i to endringer av xylen i 1 min hver.
    3. Legg til 50 μL monteringsløsning på dekslene og legg glidene på toppen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

I denne studien genererte vi kondrogenpellets fra CBMC-hiPSCs ved å indusere utvekstceller fra EBs. Kondrogene differensier ble indusert ved bruk av CBMC-hiPSCs med bekreftet høy pluripotens 11 . En enkel ordning av protokollen vår er vist i figur 1A . Før differensiering ble iPSC-kolonier utvidet ( figur 1B ). De utvidede iPSCene ble samlet som EBs for å initiere differensiering ( figur 1C ). De genererte EBs ble festet til gelatin-belagte retter for å indusere vekstceller ( Figur 1D ). Da ble utvoksningscellene høstet og brukt til å danne kondrogenpellets. Etter 21 dager med differensiering ble små, perlelignende kondrogenpellets oppnådd og anvendt for ytterligere karakterisering ( Figur 1E ). Kvaliteten på in vitro-generert chonDroge pellets ble bekreftet gjennom forskjellige analyser.

Vi evaluerte histologisk kvaliteten på kondrogen pellets på dag 21. BMSC kondrogen pellets ble brukt som positiv kontroll. Akkumuleringen av ECM-proteiner utsatt av de differensierte kondrocytter ble bekreftet ved alcianblå og toluidinblå flekker i figur 2A . De viktigste egenskapene ved sunn brusk, som for eksempel lacuna og proteoglykanproduksjon, økte ettersom differensieringsprosessen fortsatte i løpet av 21 dager. Kondrogenpelleter generert fra CBMC-hiPSCs uttrykte COL2A1, som er den viktigste ECM-komponenten i sunn brusk ( figur 2B ). COL2A1-ekspresjonen av CBMC-hiPSC-avledede pellets var høyere enn for BMSC-avledede pellets. Ekspresjonen av kollagen type I, en markør for fibrotisk brusk, var lavere i CBMC-hiPSC-avledede pelleter sammenlignet med uttrykket av COL2A1. Genuttrykket av brusk ECM-proteiner i dag 21-kondrogenpellets ble bekreftet av sanntids-PCR. Agrecan (ACAN) ekspresjonen av CBMC-hiPSC-avledede pellets var lik den for BMSC-avledede pellets ( Figur 3A ). Ekspresjonen av COL2A1 var signifikant høyere i CBMC-hiPSC-avledede pelleter ( Figur 3B ). Ekspresjonen av kjønnsbestemmende region Y-boks 9 (Sox9), en kondrogen progenitormarkør, ble også evaluert. Pellets generert fra CBMC-hiPSCs uttrykte høye nivåer av Sox9 ( figur 3C ). Vi bekreftet at disse genene var signifikant oppregulert i CBMC-hiPSC kondrogen pellets sammenlignet med BMSC kontrollpellets på dag 21. Ekspresjonen av en hypertrofisk markør, COL1A1, ble evaluert ( Figur 3D ). Ekspresjonen av COL1A1 i CBMC-hiPSC-avledede pelleter ble redusert sammenlignet med det i BMSC-deriVed pellets. Differensieringseffektiviteten ble analysert ved forholdet mellom COL2A1 og COL1A1 ( Figur 3E ). Forhøyelsen av forholdet i CBMC-hiPSC-avledede pelleter viste det relativt høye uttrykket av COL2A1 sammenlignet med COL1A1. Til slutt har vi bekreftet den kondrogeniske differensieringskapasiteten til CBMC-hiPSCs. Kvaliteten av de genererte CBMC-hiPSC-avledede kondrogenpellets hadde en kvalitet som var kompatibel med BMSCs.

Figur 1
Figur 1: Kondrogen differensiering av hiPSCs. ( A ) Skjema for kondrogen pelletsgenerering fra hiPSCs. ( B ) Morfologi av den genererte CBMC-hiPSC. ( C ) Morfologi av genererte EBs. ( D ) Utvekstceller avledet fra EBs festet til en gelatine-belagt kulturskål. ( E ) Bilde av t Han kondrogen pelleten etter 21 dager med differensiering. Enhetene av intervaller er vist i millimeter. Skalestenger = 200 μm. Vennligst klikk her for å se en større versjon av denne figuren.

Figur 2
Figur 2: Histologisk analyse av kondrogenpellet. ( A ) Histologisk evaluering av kondrogenpellets på dag 21 ved bruk av alcianblå og toluidinblå flekker. ( B ) Immunohistokjemi bilde av kondrogen pellets farget med COL1A1 og COL2A1 antistoffer. Skalestenger = 100 μm. Vennligst klikk her for å se en større versjon av denne figuren.

1" > Figur 3
Figur 3: Gensekspresjon av kondrogenpelleten. ( A ) Relativ genuttrykk av ACAN. ( B ) Relativ genuttrykk av COL2A1. ( C ) Relativ genuttrykk av SOX9. ( D ) Relativ genuttrykk av COL1A1. ( E ) Genuttrykk av COL1A1. ( F ) Genuttrykk av COL10A1. ( G ) Forholdet til COL2A1: COL1A1-genuttrykk. Pellets ble høstet og analysert etter 21 dagers differensiering. Data ble oppnådd ved bruk av sanntids-PCR og vist som den gjennomsnittlige standardfeilen for tre eksemplarer per prøve (n = 3). Genuttrykket ble normalisert til GAPDH som en intern kontroll. (* P <0,05, ** p <0,01, *** p <0,001).K "> Vennligst klikk her for å se en større versjon av denne figuren.

Telefonnummer Utvoksende celleutbytte Pelletutbytte
hiPSCs 2 x 10 6 2-5 x 10 7 70-150
MSC 2 x 10 6 - 6

Tabell 1: Utbytte sammenligning av MSC og hiPSCs.

Målnavn Retning Primer sekvens Størrelse
Framover TTCCGCGACGTGGACAT 77 bp
Omvendt TCAAACTCGTTGACATCGAAGGT
EN BOKS Framover AGCCTGCGCTCCAATGACT 107 bp
Omvendt TAATGGAACACGATGCCTTTCA
COL2A1 Framover GGCAATAGCAGGTTCACGTACA 79 bp
Omvendt CGATAACAGTCTTGCCCCACTTA
COL1A1 Framover CCCCTGGAAAGAATGGAGATG 148 bp
Omvendt TCCAAACCACTGAAACCTCTG

Tabell 2: Sekvenser av primere mot kondrogenmarkører i sanntids-PCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Denne protokollen har generert hiPSCer fra CBMCs. Vi reprogrammerte CBMCs til hiPSCs ved hjelp av en Sendai viral vektor som inneholder Yamanaka-faktorene 24 . Tre tilfeller ble brukt i differensiering, og alle eksperimenter genererte vellykket kondrogenpellets ved hjelp av denne protokollen. Mange studier har rapportert protokoller for differensiering av hiPSCs i kondrocyter 25 , 26 , 27 , 28 . Imidlertid er det nødvendig med ytterligere forskning for å bekrefte bruken av CBMC-hiPSCs som kandidat for bruskegenerasjon og gjenoppretting.

Kondrogenese ble bekreftet ved hjelp av hiPSCs generert fra forskjellige somatiske celletyper 11 , 25 , 26 , 27 , 29 . Mange rapporter viserAt opprinnelsen til den somatiske cellen som brukes i omprogrammering, kan påvirke differensieringsutfallet av hiPSCs 30 , 31 , 32 , 33 . Ledningsblod er en kilde beriket med HSC og MSC. Det er ingen rapport om forskjellen mellom ledningsblod-avledede celler, som blodceller eller MSC. Tidligere studier har imidlertid vist at leddkondrocyt-avledede hiPSCs er mer sannsynlig å gå gjennom kondrogenese enn hiPSCer generert fra ledningsblod eller hudfibroblaster 29 . Resultater fra endoteldifferensiering ved hjelp av hiPSC generert fra fibroblaster, hjerteprogenitorceller og endotelceller viste at vevet av opprinnelsen kan gjenspeile det vevsspesifikke somatiske minnet i terminalt differensiert iPSC-derivasjon, spesielt ved tidlige passasjer, mellom 10 og 20 34 . I tidlige passasjer av hiPSCs, endotelcelle-deriVed hiPSCs differensiert mer effektivt i endotel-linjen. Den signifikante forskjellen mellom disse cellelinjer forsvant imidlertid i hiPSCs over 20 passasjer. Derfor er det viktig å nøye vurdere det somatiske minnet som bæres av hiPSCene i tidlige passasjer når de brukes i klinisk forskning.

Nylig har ulike prosedyrer blitt utviklet for å reparere defekt leddbrusk. Mikrofraksjon gjøres ved å bore flere hull i beinet for å indusere tilstrømningen av benmarg for naturlig reparasjon 35 . Knæutskiftning, også kjent som knelektroplastisk, brukes til å erstatte den ødelagte brusk. Imidlertid er mikrofraktur ikke nyttig for alvorlig leddbruskskader, og instrumentet som brukes til knæutskifting, må endres hvert 10.-15 år.

Disse dager er cellebaserte terapier en lovende alternativ metode for brusk reparasjon. Autolog chondrocytimplantasjon (ACI) er bredBrukes til cellebasert bruskutvinning. ACI er gjort ved direkte injisering av autologe kondrocyter i defekten. Imidlertid blir autologe kondrocytter til fibroblastlignende celler under in vitro dyrkningsbetingelser. Ytterligere skade er også uunngåelig under høstingsprosessen av autologe kondrocytter. MSC er blitt foreslått som en cellekilde for bruskutvinning. Ledningsblod er en nyttig og tilgjengelig cellekilde for MSCs for ingeniørbrusk 36 . Suksessraten for isolering av lednings-blod-MSC er imidlertid kontroversiell 37 , 38 . Tallrike studier rapporterer om vellykket isolasjon av lednings-blod-MSC-er. Flere studier har vist at blodvolum i ledningen er en kritisk parameter som kan påvirke utbytten på MSC-isolasjon 36 , 39 . For å erverve høyverdige MSC, er passasjen av cellene også kritisk. Tidligere studier angir thaT MSC har en begrenset levetid etter et bestemt celle divisjon nummer. Ved å gå inn i senescens karakteriseres MSCs av redusert proliferasjon, som med hvilken som helst normal somatisk celle 40 . Derfor må ledningsblod-avledede MSCs brukes før den sjette gangen for å unngå celle senescens og kromosomale abnormiteter 41 .

For å unngå disse begrensningene åpnet menneskelig iPSCs en ny mulighet for personlig, cellebasert terapi med høy produktivitet 11 . Etablert hiPSCs kan teoretisk spre seg ubegrenset. Også, med samme immunidentitet som giveren, kan de unngå avvisning og lavere bivirkninger når de implanteres in vivo . Overgangen av ledningsblodbanker til hiPSC-banker for allogen medisinsk behandling har enorm mulighet og potensial 42 . Screeningen av homozygote HLA-typede CBMC'er før omprogrammering kan i stor grad utnytte de allogene iPSC-linjene foR klinisk behandling. Homozygote iPSC-linjer kan unngå immunologiske reaksjoner etter allograftransplantasjon. Dette konseptet kan også anvendes på bruskregenerering ved å generere HLA-homozygot brusk 11 .

Vanligvis utføres chondrogen differensiering gjennom to kritiske trinn: induksjon av EB-avledede vekstceller og pelletdannelse. Den opprinnelige differensieringen av hiPSCs i EB-avledede vekstceller er kritisk for å øke deres kondrogeniske differensieringspotensiale. Utvokstceller differensiert fra hiPSCs er funksjonelt og molekylært lik native BMSCs 7 , 43 . Tidligere studier brukte monolagskultur eller EB-kultur som et pre-differensieringstrinn for å indusere mesenkymlignende celler 10 , 43 . Imidlertid er direkte differensiering ved monolagskultur krevende tid i forhold til bruken av EBs og ch Ondrogene pellets har en tendens til å skille seg inn i fibrocartilag med hypertrofiske egenskaper. Det ble rapportert at cellemorfologi og det kondrogeniske differensieringspotensialet for genererte mesenkymlignende stamceller varierer sterkt i henhold til celletettheten av cellemonolaget 9 .

Vi brukte EBs til å indusere vekstceller, noe som er en relativt rask og enkel metode i forhold til monolagskulturen. Ved hjelp av denne protokollen kunne vi generere mange pellets ved hjelp av et relativt lite antall hiPSCs ( Tabell 1 ). Størrelsen og antall EBs var kritiske for vellykket kondrogen pelletsmasseproduksjon. Derfor utvidet vi de aggregerte EB-ene i E8-medium, til mer enn halvparten av de genererte EB-ene var større enn 100 μm. Etter EB-utvidelse opprettholdte vi EB-ene i E8-medium uten FGF2. Tidligere opprettholdt forskere genererte EB'er uten FGF2 for mesodermisk linjearduksjonXref "> 9.

Selv om vi forsøkte å opprettholde de fremvokste cellene med høy tetthet for bedre kvalitet, forblir flere begrensninger fortsatt. Selv om vi har bekreftet at de genererte utvoksningscellene deler en lignende morfologi, kan cellene fortsatt være heterogene. Tidligere studier har forsøkt å sortere for en bestemt celletype; Denne prosedyren har imidlertid resultert i innsamling av et lite antall celler. Et nytt forsøk på å isolere homogene utgroddceller i større skala vil bli nødvendig for å generere en stor mengde kondrogenpellets med forbedrede egenskaper.

Ulike grupper inducerer stamceller fra hiPSCs ved bruk av monolag eller EB-kultur. Induksjon av stamceller med høy likhet med MSCs kan være nøkkelen til å oppnå chondrogenpellets av høyere kvalitet. Disse stamceller som er avledet fra EB har egenskaper som ligner på MSCs. Dette kan imidlertid være på grunn avIr fibroblastisk natur. Derfor er det nødvendig med en detaljert valideringsstudie på utvekstcellene.

I denne studien foreslår vi en protokoll som kan generere en relativt stor mengde kondrogenpellets. Vi bekreftet at brusk regenerert ved hjelp av CBMC-hiPSCs viste en sunn fenotype og kan brukes som materiale for vevregenerering. Imidlertid er en forbedret metode med kortere differensierings tidslinje nødvendig for videre anvendelse. Den videre utvikling av kvalitetskontrollstandarder for å validere brusk med et høyere nivå av hyalin er også nødvendig for fremtidige bruksområder av CBMC-hiPSC som cellemateriale for bruskregenerering. Protokollen er enkel, men effektiv og krever ingen ytterligere sorteringsprosesser før pelletdannelse. Som konklusjon, ved bruk av denne protokollen kan høykvalente chondrogenpellets bli generert for studier på sykdomsmodellering, medikamentscreening og regenerativ medisin for å fremme vår forståelse av tHan er bruskart.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingenting å avsløre.

Acknowledgements

Dette arbeidet ble støttet av et tilskudd fra Korea Healthcare Technology FoU-prosjektet, departementet for helse, velferd og familie, Republikken Korea (HI16C2177).

Materials

Name Company Catalog Number Comments
Plasticware
100 mm Dish TPP 93100
6-well Plate TPP 92006
50 mL Cornical Tube SPL 50050
15 mL Cornical Tube SPL 50015
10 mL Disposable Pipette Falcon 7551
5 mL Disposable Pipette Falcon 7543
12-well Plate TPP 92012
Name Company Catalog Number Description
E8 Medium Materials
DMEM/F12, HEPES Life Technologies 11330-057 E8 Medium (500 mL)
Sodium Bicarbonate Life Technologies 25080-094 E8 Medium (Conc.: 543 μg/mL)
Sodium Selenite Sigma Aldrich S5261 E8 Medium  (Conc.: 14 ng/mL)
Human Transfferin Sigma Aldrich T3705 E8 Medium (Conc.: 10.7 μg/mL)
Basic FGF2 Peprotech 100-18B E8 Medium  (Conc.: 100 ng/mL)
Human Insulin Life Technologies 12585-014 E8 Medium (Conc.: 20 μg/mL)
Human TGFβ1 Peprotech 100-21 E8 Medium (Conc.: 2 ng/mL)
Ascorbic Acid Sigma Aldrich A8960 E8 Medium  (Conc.: 64 μg/mL)
DPBS Life Technologies 14190-144
Vitronectin Life Technologies A14700
ROCK Inhibitor Sigma Aldrich Y0503
Name Company Catalog Number Description
Quality Control Materials
18 mm Cover Glass Superior HSU-0111580
4% Paraformaldyhyde Tech & Innovation BPP-9004
Triton X-100 BIOSESANG 9002-93-1
Bovine Serum Albumin Vector Lab SP-5050
Anti-SSEA4 Antibody Millipore MAB4304
Anti-Oct4 Antibody Santa Cruz SC9081
Anti-TRA-1-60 Antibody Millipore MAB4360
Anti-Sox2 Antibody Biolegend 630801
Anti-TRA-1-81 Antibody Millipore MAB4381
Anti-Klf4 Antibody Abcam ab151733
Alexa Fluor 488 goat anti-mouse IgG (H+L) antibody Molecular Probe A11029
Alexa Fluor 594 goat anti-rabbit IgG (H+L) antibody Molecular Probe A11037
DAPI Molecular Probe D1306
Prolong gold antifade reagent Invitrogen P36934
4% Paraformaldyhyde Tech & Innovation BPP-9004
Tween 20 BIOSESANG T1027
Bovine Serum Albumin Vector Lab SP-5050
Anti-Collagen II antibody abcam  ab34712 1:100
Alcian blue Sigma Aldrich A3157-10G
Fast Green FCF Sigma Aldrich F7252-25G
Safranin O Sigma Aldrich 090m0039v
Nuclear fast red Americanmastertech STNFR100 
xylene Duksan 115 
Ethanol Duksan 64-17-5
Mayer's hematoxylin solution wako pure chemical industries LAK7534
DAP VECTOR LABORATORIES SK-4100
Slide Glass, Coated Hyun Il Lab-Mate HMA-S9914
Trizol Invitrogen 15596-018
Chloroform Sigma Aldrich 366919
Isoprypylalcohol Millipore 109634
Ethanol Duksan 64-17-5
RevertAid First Strand cDNA Synthesis kit Thermo Scientfic K1622
Name Company Catalog Number Description
Chondrogenic Differentiation Materials
DMEM Life Technologies 11885 Chondrogenic media component (500 mL)
Penicilin Streptomycin Life Technologies P4333 Chondrogenic media component (Conc.: 1%)
Ascorbic Acid Sigma Aldrich A8960 Chondrogenic media component (Conc.: 64 μg/mL) 
MEM Non-Essential Amino Acids Solution (100x) Life Technologies 11140-050 Chondrogenic media component (Conc.: 100 mM)
rhBMP-2 R&D 355-BM-050 Chondrogenic media component (Conc.:100 ng/ml)
Recombinant Hman TGF-beta3 R&D 243-B3-002 Chondrogenic media component (Conc.:10 ng/ml)
KnockOut Serum Replacement Life Technologies 10828-028 Chondrogenic media component (Conc.: 1%)
ITS+ Premix BD 354352 Chondrogenic media component (Conc.: 1%)
Dexamethasone-Water Soluble  Sigma Aldrich D2915-100MG Chondrogenic media component (Conc.:10-7 M)
GlutaMAX Supplement Life Technologies 35050-061 Chondrogenic media component (Conc.: 1%)
Sodium pyruvate solution Sigma Aldrich S8636 Chondrogenic media component (Conc.: 1%)
L-Proline Sigma Aldrich P5607-25G Chondrogenic media component (40 μg/ml)

DOWNLOAD MATERIALS LIST

References

  1. van Osch, G. J., et al. Cartilage repair: past and future--lessons for regenerative medicine. J Cell Mol Med. 13, (5), 792-810 (2009).
  2. Ahmed, T. A., Hincke, M. T. Strategies for articular cartilage lesion repair and functional restoration. Tissue Eng Part B Rev. 16, (3), 305-329 (2010).
  3. Diekman, B. O., et al. Cartilage tissue engineering using differentiated and purified induced pluripotent stem cells. Proc Natl Acad Sci USA. 109, (47), 19172-19177 (2012).
  4. Solchaga, L. A., Penick, K., Goldberg, V. M., Caplan, A. I., Welter, J. F. Fibroblast growth factor-2 enhances proliferation and delays loss of chondrogenic potential in human adult bone-marrow-derived mesenchymal stem cells. Tissue Eng Part A. 16, (3), 1009-1019 (2010).
  5. Guzzo, R. M., Drissi, H. Differentiation of Human Induced Pluripotent Stem Cells to Chondrocytes. Methods Mol Biol. 1340, 79-95 (2015).
  6. Drissi, H., Gibson, J. D., Guzzo, R. M., Xu, R. H. Derivation and Chondrogenic Commitment of Human Embryonic Stem Cell-Derived Mesenchymal Progenitors. Methods Mol Biol. 1340, 65-78 (2015).
  7. Nejadnik, H., et al. Improved approach for chondrogenic differentiation of human induced pluripotent stem cells. Stem Cell Rev. 11, (2), 242-253 (2015).
  8. Teramura, T., et al. Induction of mesenchymal progenitor cells with chondrogenic property from mouse-induced pluripotent stem cells. Cell Reprogram. 12, (3), 249-261 (2010).
  9. Koyama, N., et al. Human induced pluripotent stem cells differentiated into chondrogenic lineage via generation of mesenchymal progenitor cells. Stem Cells Dev. 22, (1), 102-113 (2013).
  10. Ko, J. Y., Kim, K. I., Park, S., Im, G. I. In vitro chondrogenesis and in vivo repair of osteochondral defect with human induced pluripotent stem cells. Biomaterials. 35, (11), 3571-3581 (2014).
  11. Nam, Y., Rim, Y. A., Jung, S. M., Ju, J. H. Cord blood cell-derived iPSCs as a new candidate for chondrogenic differentiation and cartilage regeneration. Stem Cell Res Ther. 8, (1), 16 (2017).
  12. Hotten, G. C., et al. Recombinant human growth/differentiation factor 5 stimulates mesenchyme aggregation and chondrogenesis responsible for the skeletal development of limbs. Growth Factors. 13, (1-2), 65-74 (1996).
  13. Murphy, M. K., Huey, D. J., Hu, J. C., Athanasiou, K. A. TGF-beta1, GDF-5, and BMP-2 stimulation induces chondrogenesis in expanded human articular chondrocytes and marrow-derived stromal cells. Stem Cells. 33, (3), 762-773 (2015).
  14. Shintani, N., Siebenrock, K. A., Hunziker, E. B. TGF-ss1 enhances the BMP-2-induced chondrogenesis of bovine synovial explants and arrests downstream differentiation at an early stage of hypertrophy. PLoS One. 8, (1), e53086 (2013).
  15. Fukumoto, T., et al. Combined effects of insulin-like growth factor-1 and transforming growth factor-beta1 on periosteal mesenchymal cells during chondrogenesis in vitro. Osteoarthritis Cartilage. 11, (1), 55-64 (2003).
  16. Worster, A. A., Nixon, A. J., Brower-Toland, B. D., Williams, J. Effect of transforming growth factor beta1 on chondrogenic differentiation of cultured equine mesenchymal stem cells. Am J Vet Res. 61, (9), 1003-1010 (2000).
  17. Knippenberg, M., et al. Differential effects of bone morphogenetic protein-2 and transforming growth factor-beta1 on gene expression of collagen-modifying enzymes in human adipose tissue-derived mesenchymal stem cells. Tissue Eng Part A. 15, (8), 2213-2225 (2009).
  18. Jang, Y., et al. Centrifugal gravity-induced BMP4 induces chondrogenic differentiation of adipose-derived stem cells via SOX9 upregulation. Stem Cell Res Ther. 7, (1), 184 (2016).
  19. Kang, R., et al. Mesenchymal stem cells derived from human induced pluripotent stem cells retain adequate osteogenicity and chondrogenicity but less adipogenicity. Stem Cell Res Ther. 6, 144 (2015).
  20. Tao, H., et al. Biological evaluation of human degenerated nucleus pulposus cells in functionalized self-assembling peptide nanofiber hydrogel scaffold. Tissue Eng Part A. 20, (11-12), 1621-1631 (2014).
  21. Sekiya, I., Larson, B. L., Vuoristo, J. T., Reger, R. L., Prockop, D. J. Comparison of effect of BMP-2, -4, and -6 on in vitro cartilage formation of human adult stem cells from bone marrow stroma. Cell Tissue Res. 320, (2), 269-276 (2005).
  22. Shen, B., Wei, A., Tao, H., Diwan, A. D., Ma, D. D. BMP-2 enhances TGF-beta3-mediated chondrogenic differentiation of human bone marrow multipotent mesenchymal stromal cells in alginate bead culture. Tissue Eng Part A. 15, (6), 1311-1320 (2009).
  23. Rim, Y. A., Nam, Y., Ju, J. H. Induced Pluripotent Stem Cell Generation from Blood Cells Using Sendai Virus and Centrifugation. J Vis Exp. (118), (2016).
  24. Kim, Y., et al. The Generation of Human Induced Pluripotent Stem Cells from Blood Cells: An Efficient Protocol Using Serial Plating of Reprogrammed Cells by Centrifugation. Stem Cells Int. 2016, 1329459 (2016).
  25. Oldershaw, R. A., et al. Directed differentiation of human embryonic stem cells toward chondrocytes. Nat Biotechnol. 28, (11), 1187-1194 (2010).
  26. Toh, W. S., et al. Differentiation and enrichment of expandable chondrogenic cells from human embryonic stem cells in vitro. J Cell Mol Med. 13, (9B), 3570-3590 (2009).
  27. Hwang, N. S., Varghese, S., Elisseeff, J. Derivation of chondrogenically-committed cells from human embryonic cells for cartilage tissue regeneration. PLoS One. 3, (6), e2498 (2008).
  28. Nakagawa, T., Lee, S. Y., Reddi, A. H. Induction of chondrogenesis from human embryonic stem cells without embryoid body formation by bone morphogenetic protein 7 and transforming growth factor beta1. Arthritis Rheum. 60, (12), 3686-3692 (2009).
  29. Guzzo, R. M., Scanlon, V., Sanjay, A., Xu, R. H., Drissi, H. Establishment of human cell type-specific iPS cells with enhanced chondrogenic potential. Stem Cell Rev. 10, (6), 820-829 (2014).
  30. Rim, Y. A., Park, N., Nam, Y., Ju, J. H. Generation of Induced-pluripotent Stem Cells Using Fibroblast-like Synoviocytes Isolated from Joints of Rheumatoid Arthritis Patients. J Vis Exp. (116), (2016).
  31. Pfaff, N., et al. Efficient hematopoietic redifferentiation of induced pluripotent stem cells derived from primitive murine bone marrow cells. Stem Cells Dev. 21, (5), 689-701 (2012).
  32. Xu, H., et al. Highly efficient derivation of ventricular cardiomyocytes from induced pluripotent stem cells with a distinct epigenetic signature. Cell Res. 22, (1), 142-154 (2012).
  33. Lee, S. B., et al. Contribution of hepatic lineage stage-specific donor memory to the differential potential of induced mouse pluripotent stem cells. Stem Cells. 30, (5), 997-1007 (2012).
  34. Hu, S., et al. Effects of cellular origin on differentiation of human induced pluripotent stem cell-derived endothelial cells. JCI Insight. 1, (8), 1-12 (2016).
  35. Vonk, L. A., de Windt, T. S., Slaper-Cortenbach, I. C., Saris, D. B. Autologous, allogeneic, induced pluripotent stem cell or a combination stem cell therapy? Where are we headed in cartilage repair and why: a concise review. Stem Cell Res Ther. 6, (94), 1-11 (2015).
  36. Gomez-Leduc, T., et al. Chondrogenic commitment of human umbilical cord blood-derived mesenchymal stem cells in collagen matrices for cartilage engineering. Sci Rep. 6, 32786 (2016).
  37. Mareschi, K., et al. Isolation of human mesenchymal stem cells: bone marrow versus umbilical cord blood. Haematologica. 86, (10), 1099-1100 (2001).
  38. Wexler, S. A., et al. Adult bone marrow is a rich source of human mesenchymal 'stem' cells but umbilical cord and mobilized adult blood are not. Br J Haematol. 121, (2), 368-374 (2003).
  39. Zhang, X., et al. Isolation and characterization of mesenchymal stem cells from human umbilical cord blood: reevaluation of critical factors for successful isolation and high ability to proliferate and differentiate to chondrocytes as compared to mesenchymal stem cells from bone marrow and adipose tissue. J Cell Biochem. 112, (4), 1206-1218 (2011).
  40. Wagner, W., et al. Replicative senescence of mesenchymal stem cells: a continuous and organized process. PLoS One. 3, (5), e2213 (2008).
  41. Tarte, K., et al. Clinical-grade production of human mesenchymal stromal cells: occurrence of aneuploidy without transformation. Blood. 115, (8), 1549-1553 (2010).
  42. Chen, W. C., et al. Prediction of poor survival by cyclooxygenase-2 in patients with T4 nasopharyngeal cancer treated by radiation therapy: clinical and in vitro studies. Head Neck. 27, (6), 503-512 (2005).
  43. Guzzo, R. M., Gibson, J., Xu, R. H., Lee, F. Y., Drissi, H. Efficient differentiation of human iPSC-derived mesenchymal stem cells to chondroprogenitor cells. J Cell Biochem. 114, (2), 480-490 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics