Génération d’immunoprécipitation de la chromatine Native séquençage des bibliothèques pour l’analyse de densité de nucléosomes

Genetics
 

Summary

Nous présentons une immunoprécipitation de la chromatine native mis à jour le séquençage (ChIP-seq) méthodologie pour la production d’ensembles de données de séquence pour un cadre d’analyse des nucléosomes densité ChIP-seq intégrant l’accessibilité nucléase micrococcique (MNase) avec mesures de modification d’histone.

Cite this Article

Copy Citation | Download Citations

Lorzadeh, A., Lopez Gutierrez, R., Jackson, L., Moksa, M., Hirst, M. Generation of Native Chromatin Immunoprecipitation Sequencing Libraries for Nucleosome Density Analysis. J. Vis. Exp. (130), e56085, doi:10.3791/56085 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Nous présentons une immunoprécipitation de la chromatine native mis à jour le séquençage protocole expérimental (ChIP-seq) compatible avec une méthodologie de l’analyse de distribution basée mélange gaussien (densité nucléosome ChIP-seq ; ndChIP-seq) qui permet la génération de combinée des mesures d’accessibilité de la nucléase micrococcique (MNase) avec modification d’histone Génome-large. Position du nucléosome et densité locale et la modification post-traductionnelle de leurs sous-unités d’histone, agissent de concert pour réguler les États locaux de transcription. Des mesures d’accessibilité nucléosome avec modification d’histone générée par ndChIP-seq combinatoires permet l’interrogation simultanée de ces fonctionnalités. La méthodologie ndChIP-seq est applicable à un petit nombre de cellules primaires inaccessibles à réticulation selon des protocoles de ChIP-seq. L’ensemble ndChIP-seq permet la mesure de la modification des histones en combinaison avec une densité de nucléosomes local pour obtenir de nouvelles connaissances sur les mécanismes communs qui régulent la transcription de l’ARN au sein des populations rares cellules primaires.

Introduction

Le génome des eucaryotes est emballé dans la chromatine par répétition de structures nucléosome qui se composent de deux copies de quatre protéines histones (p. ex., H2A, H2B, H3 et H4) circonscrits par 146 paires de bases d’ADN1,2. Complexes de remodelage de la chromatine nucleosome à stabiliser des limites gène promoteur et participent à la régulation de l’expression génique en altérant l’accessibilité de l’ADN à des facteurs de transcription et de l’ARN polymérase machines3, 4.

Aminés terminales queues des histones dans les nucléosomes sont soumis à diverses modifications covalentes, y compris l’acétylation, méthylation, phosphorylation, ubiquitination, sumoylation, formylation et hydroxylation des acides aminés spécifiques5 , 6 , 7 , 8. postes et degrés de ces modifications exigent un état de la chromatine qui influencent la chromatine structure et contrôle l’accès des complexes moléculaires qui permettent l’activation de la transcription,7. Étant donné que les deux modifications de densité et histone nucléosome jouent un rôle dans le contrôle local de la transcription des gènes, nous avons développé une approche native de puce qui permet la mesure simultanée de la densité du nucléosome et histone modification9, 10.

Natif de ChIP-seq profite de la nucléase de micrococci endonucléase (MNase) pour digérer la chromatine intacte dans son état natif dans le noyau11,12, une propriété qui a été mis à profit pour faire correspondre les nucléosomes positionnement13 , 14 , 15. densité nucléosome ChIP-seq (ndChIP-seq) tire profit de la propriété de l’accès préférentiel de MNase pour ouvrir les régions de chromatine pour générer des mesures qui allient accessibilité MNase histone modification10. ndChIP-seq est adapté pour le profilage des modifications d’histone dans les rares cellules primaires, des tissus et des cellules cultivées. Nous présentons ici un protocole détaillé qui permet la génération d’ensembles de données de séquence pour un travail de cadre analytique décrit précédemment10 qui intègre le fragment taille post immunoprécipitation, déterminée par jumelé-fin lire les limites, à en même temps étudier MNase accessibilité avec mesures de modification des histones. Auparavant, l’application du présent protocole au sang de cordon humain primaire 10 000 dérivés CD34+ les cellules et les cellules souches embryonnaires humaines ont révélé une relation unique entre la chromatine structure et histone modifications au sein de ces cellules types10 . Compte tenu de sa capacité à mesurer simultanément l’accessibilité nucléosome et modification d’histone, ndChIP-seq est capable de révéler épigénomique caractéristiques dans une population de cellules à un niveau unique nucléosome et de résoudre les signatures hétérogènes dans leurs éléments constitutifs. Enquête des promoteurs bivalents, où H3K4me3, une marque active et H3K27me3, une marque répressive, sont présents10, est un exemple de l’exploration des populations cellulaires hétérogènes par ndChIP-seq.

Protocol

NOTE : L’entrée minimum pour que ce protocole est de 10 000 cellules par réaction unique immuno-précipitation (IP). Imprimer la feuille de calcul expérimental fourni et d’utiliser comme guide pour planifier l’expérience. Incubation à température ambiante est censées pour être à ~ 22 ° C. Toutes les recettes de tampon sont fournis dans le tableau 1. Tous les tampons devraient être conservés à 4 ° C et gardé sur glace au cours de la procédure, sauf indication contraire.

1. préparation de la cellule

  1. Cellules cultivées
    1. Laver les cellules avec 1 mL de solution saline de tampon au phosphate (PBS) et déterminer avec précision la concentration de cellules utilisant un hémocytomètre. S’il y a plus de 1 million de cellules, augmenter le volume de PBS.
    2. Basé sur le nombre d’éléments, aliquot l’équivalent de 70 000-100 000 cellules dans un tube stérile de 1,5 mL et centrifuger à 500 x g pendant 6 min à 4 ° C. À l’aide d’une pipette, retirer doucement et jeter le surnageant (sans déranger le culot cellulaire) et Resuspendre le culot dans le tampon de lyse glacée + 1 x inhibiteur de protéase cocktail (PIC) à une concentration de 1 000 cellules / µL. mélanger bien en pipettant également monter et descendre de 20-30 fois. Il est essentiel que les amas de cellules soient perturbés. Essayez de ne pas créer de bulles.
    3. Passer directement au jour 1 (Section 2) du protocole ndChIP-seq ou flash geler le culot cellulaire dans l’azote liquide et conserver à-80 ° C.
  2. Cellules triées
    1. Prélever des 70 000-100 000 triés16 cellules dans un tube de 1,5 mL 350 µl de la solution saline tamponnée (HBSS), de Hank ou PBS + 2 % sérum fœtal (SVF).
    2. Tournez en bas de chaque cellule aliquote à 500 x g pendant 6 min à 4 ° C. À l’aide d’une pipette, lentement retirer le surnageant (sans déranger le culot cellulaire) et remettre en suspension dans le tampon de lyse glacée + 1 x PIC à une concentration finale de 1 000 cellules / µL. Mélangez bien dans le tampon de lyse en pipettant également en haut et en bas 20 à 30 fois. Ce que l’amas de cellules soient perturbés. Essayez de ne pas créer de bulles.
    3. Passer directement au jour 1 (Section 2) du protocole ndChIP-seq ou flash geler le culot cellulaire dans l’azote liquide et conserver à-80 ° C.

2. jour 1 : ndChIP-seq

  1. Préparation du complexe anticorps-perle
    1. Préparer un bain-marie à 37 ° C et un seau à glace. Travaillant sur la glace, préparer 1 x IP tampon/1 x PIC et 1 x tampon de dilution des anticorps (AC) et les conserver sur la glace. Récupérer des billes magnétiques protéine A (ou G) (voir la Discussion pour les critères de sélection) de l’entreposage à 4 ° C et mélanger très bien en doux pulsation-Vortex. Gardez-le sur la glace.
      NOTE : Pulse-Vortex signifie Vortex est arrêté chaque fois qu’un vortex complet est formé dans le tube.
    2. Transférer 24 billes magnétiques µL de protéine A (ou G) par réaction de l’IP dans un nouveau tube de 2 mL. Noter le volume de billes et maintenir le tube sur la glace. Par exemple, pour 7 IPs, utilisez µL 24 x 7 = 168 µL.
    3. Placer le tube sur l’aimant de tube et attendez que la solution devienne la séparation nette entre la perle de l’indicateur. Sans déranger les perles, retirez le surnageant à l’aide d’une pipette doucement et jetez-le. Prenez le tuyau au large de l’aimant de tube et placez-le sur la glace.
    4. Ajouter un volume égal (c.-à-d., un volume initial de perles) de mémoire tampon d’IP glacée + 1 x PIC mélanger. La composition de pipetage de haut en bas. Ne pas vortexer.
    5. Placez le tampon IP + 1 x PIC + perles sur l’aimant de tube et attendre la solution devenir la séparation nette entre la perle de l’indicateur. Sans déranger les perles, retirez le surnageant à l’aide d’une pipette doucement et jetez-le. Répétez tampon IP froid + 1 X lavage PIC deux fois plus pour un total de 3 lavages.
    6. Après le lavage final, remettre en suspension les perles dans un volume égal (c.-à-d., un volume initial de perles) de mémoire tampon d’IP glacée + 1 x PIC mélanger. La composition de pipetage de haut en bas. Ne pas vortexer. Maintenir le tube sur la glace.
    7. Sur la glace, verser 10 mL de tampon d’IP + PIC dans un réservoir en forme de V de 25 mL. À l’aide d’une pipette multicanaux, ajouter 130 µL de tampon IP glacée + 1 x mélange PIC dans des puits individuels d’un fond en V 96 puits propre plaque. Remplir un puits par IP. La plaque sous l’étiquette « Ab-perle complexe ».
    8. Ajouter 12 billes magnétiques µL de la protéine A lavé (ou G) dans chaque cupule contenant la mémoire tampon d’IP + PIC et mélanger par pipetage de haut en bas. Garder les perles lavés restants sur la glace.
    9. Obtenir des anticorps validés de leur entreposage au froid et au dégel sur la glace, si nécessaire. Travaillant sur la glace, diluer l’anticorps avec tampon de dilution 1 x Ab aux concentrations indiquées au tableau 2.
    10. Dans chaque puits de la plaque complexe Ab-perle, ajouter 1 µL de l’anticorps appropriés, dilué (tableau 1). Compte rendu du puits à la clé de l’anticorps. Utilisez la pipette multicanaux, mélanger chaque ligne en pipettant également monter et descendre de 20 fois. Changer de conseils entre les rangs. Flasque de l’Ab-perle complexe très bien avec un couvercle de plaque en aluminium et incuber à 4 ° C sur une plate-forme tournante pendant au moins 2 h.
      Remarque : Cette incubation peut aller de l’avant jusqu’au moment de commencer l’étape 2.4.
  2. Digestion de la lyse et la chromatine cellulaire
    1. Travaillant sur la glace, préparer 1 x tampon de lyse + 1 x PIC et 1 mL de MNase j’ai dilution de la mémoire tampon (tableau 3) et les garder sur la glace.
    2. Récupérer les plombs de la cellule de leur stockage à-80 ° C (ou de la glace, si fraîchement préparé). Décongeler chaque culot cellulaire dans un bain-marie à 37 ° C pendant une 10 s, puis transfert à la glace.
    3. À chaque culot ajouter immédiatement glacée 1 x tampon de lyse + 1 x PIC à une concentration finale de 10 000 cellules/20 µL et mélanger 10 fois en pipettant également, haut et bas, sans créer de bulles. Par exemple, pour 70 000 cellules le volume final est 140 µL.
    4. Travail sur la glace, aliquote 20 µL/puits des lysats résultantes dans une plaque de 96 puits. Couvrir la plaque avec un sceau en plastique et incuber sur glace pendant 20 min. étiquette la plaque « MNase digestion » et d’enregistrer les puits à une touche de modèle. Afin d’assurer un moment exact de la réaction de digestion de la chromatine, ne passez pas à la digestion avec plus de 2 rangées d’échantillons à la fois.
    5. Juste avant la lyse de 20 min est terminée, diluer la MNase j’ai enzyme avec MNase j’ai dilution tampon, à une concentration finale de 20 U/µL et le garder sur la glace.
    6. Travaillant sur la glace, préparer la MNase j’ai digestion master mix selon le tableau 4 et aliquote 20 µL du mélange par chaque ligne d’échantillons plus volume mort de 5 µL dans une ligne d’une plaque 96 puits réservoir et gardez-le sur la glace. Pour les deux lignes, le volume doit être : (20 µL x 2) + 5 µL = 45 µL.
    7. Après que les lysats terminé en incubation, retirez la plaque de digestion de MNase de glace. À l’aide d’une pipette multicanaux, ajouter 20 µL de MNase j’ai digestion master mix dans chaque ligne d’échantillons et mélanger 10 fois par pipetage de haut en bas. Changer de conseils entre les rangs. Incuber à température ambiante pendant exactement 5 minutes.
    8. Après 5 min, pour arrêter la réaction, utilisez une pipette multicanaux pour ajouter 6 µL de l’acide éthylènediaminetétraacétique 250 µM (EDTA) dans chaque ligne d’échantillons et mélanger en haut et en bas à quelques reprises. Changer de conseils entre les rangs. Après addition de l’EDTA, basculez sur le réglage de la pipette à 20 µL et mélanger 10 fois par pipetage de haut en bas afin d’assurer un arrêt complet de la réaction de la digestion. Changer de conseils entre les rangs.
    9. À l’aide d’une pipette multicanaux, dans chaque ligne des échantillons MNase digéré, ajouter 6 µL de 10 x tampon de lyse et mélanger bien en pipettant également monter et descendre de 10 fois. Couvrir avec un sceau en plastique et laisser incuber sur la glace pendant 15 minutes.
  3. Pré-défrichage et séparation d’entrée
    1. Après l’incubation de 15 min, travaillant sur la glace, piscine tous les puits pour la même cellule pellet/template dans un stérile, préalablement réfrigérées sur glace, tube de 1,5 mL (préalablement marquées avec l’ID de modèle) et mélanger soigneusement, mais lentement à l’aide d’une pipette afin d’éviter le détergent moussant.
    2. Pour chaque cellule pellet/modèle, transfert 8 µL de chromatine digérée dans une nouvelle stérile, tube de 0,5 mL (préalablement marquées avec l’ID de modèle) et les conserver à 4 ° C durant la nuit. Cela servira de contrôle d’entrée.
    3. Distribuer le volume restant de la chromatine digérée dans 48 µL d’extraits, dans une nouvelle plaque de 96 puits. Pellet/modèle de cellule 1 va dans le puits A01-A06, cellule pellet/modèle 2 passe en puits A07-A12, etc.. Enregistrer les puits à une touche de modèle. Étiquette de la « Pré-défrichage ».
    4. À l’aide d’une pipette multicanaux, ajouter 120 µL de 1 x IP Buffer + 1 x PIC et 12 µL de lavé billes magnétiques de protéine A (ou G) dans chaque puits de la plaque de compensation avant de l’étape 2.3.3. La composition de chaque ligne de pipetage et descendre de 10 fois. Changer de conseils entre les rangs. Sceller la plaque très bien avec un couvercle de plaque en aluminium et incuber sur une plate-forme tournante à 4 ° C pendant au moins 2 h.
  4. Réaction d’immunoprécipitation
    1. Avant de commencer cette étape Assurez-vous que les plaques de complexe Ab-perle (étape 2.1.10) et pré-défrichage (étape 2.3.4) ont incubé au moins 2 h. Quick spin deux plaques par centrifugation pendant 10 s à 200 x g.
    2. Placez la plaque complexe Ab-perle (de l’étape 2.1.10) sur un aimant plat et attendez 15 s pour la solution devienne claire. Soigneusement, enlever et jeter le surnageant à l’aide d’une pipette sans déranger les perles. Retirez la plaque de l’aimant de la plaque et le garder sur la glace.
    3. Placez la plaque avant compensation (de l’étape 2.3.4) sur un aimant plat et attendez 15 s pour les perles séparer et pour la solution devienne claire. Sans déranger les perles, transvaser avec soin le surnageant à l’aide d’une pipette dans les puits correspondants du Ab-talon plaque complexe gardé sur glace et mélanger doucement 15 fois par pipetage de haut en bas. Joint de la plaque avec un aluminium plaque de couverture et incuber pendant la nuit (12-18 h) à 4 ° C sur une plate-forme tournante. Ré-étiqueter la plaque « Réaction de la propriété intellectuelle ».

3. jour 2 : ndCHIP-seq

  1. Lavages et élution
    1. La valeur de l’appareil de chauffage à 65 ° C. Sur la glace, préparer un tampon de lavage de faible teneur en sel et tampon de lavage de la forte teneur en sel. Rapide, faites tourner la plaque IP de réaction de l’étape 2.4.3 pour 10 s à 200 x g.
    2. Placer la plaque de réaction d’IP sur un aimant plat et attendre 15 s pour la solution devienne claire. À l’aide d’une pipette multicanaux, sans déranger les perles, soigneusement retirer et jeter le surnageant. Prenez la plaque de l’aimant de la plaque et placez-le sur la glace.
    3. Pour chaque ligne d’échantillons dans la plaque de réaction IP, ajouter 150 µL de faible teneur en sel glacee laver tampon et mélanger lentement 10 fois haut et bas pour complètement remettre en suspension les perles.
    4. Placer la plaque de réaction IP sur l’aimant de la plaque, attendez que les perles se séparer et à l’aide d’une pipette multicanaux, sans déranger les perles enlever et éliminer le surnageant. Replacez la plaque sur glace et répétez les étapes 3.1.3 et 3.1.4 pour un total de 2 lavages.
    5. Sur la glace, à chaque ligne d’échantillons dans la plaque de réaction IP, ajouter 150 µL du haut sel laver tampon et mélanger lentement 10 fois en pipettant également, haut et bas pour complètement remettre en suspension les perles.
    6. Placer la plaque de réaction IP sur l’aimant de la plaque, attendez que les perles se séparer et à l’aide d’une pipette multicanaux, sans déranger les perles enlever et éliminer le surnageant. Placer la plaque de réaction IP sur glace et réfrigérer avant une nouvelle plaque 96 puits à côté de lui.
    7. Pour chaque ligne d’échantillons dans la plaque de réaction IP, ajouter 150 µL du haut sel laver tampon et mélanger lentement 10 fois en pipettant également, haut et bas pour complètement remettre en suspension les perles. Après la remise en suspension, transfert chaque ligne des échantillons à la ligne correspondante de la plaque 96 puits, récente, préalablement réfrigérée. Étiquette de la « Réaction de la propriété intellectuelle ». Jeter la vieille plaque.
    8. Placez la nouvelle plaque de réaction IP sur l’aimant de la plaque et attendre les perles séparer. À l’aide d’une pipette multicanaux, sans déranger les perles, soigneusement retirer et jeter le surnageant. Maintenir la plaque à température ambiante.
    9. À chaque ligne d’échantillons dans la plaque de réaction IP, ajoutez 30 µL du tampon d’élution ChIP (EB) et mélangez lentement 10 fois par pipetage de haut en bas. Veillez à éviter la formation de bulles.
    10. Sceller la plaque avec une couverture PCR et incuber dans un mélangeur de chauffage à 65 ° C pendant 1,5 h avec une vitesse de mélange de 1 350 tr/min.
    11. Après une incubation de 1,5 h, faites tourner la plaque de réaction IP à 200 x g pendant 1 min à 4 ° C. Modifier le paramétrage de l’appareil de chauffage à 50 ° C.
    12. Le spin, placer la plaque de réaction d’IP sur un aimant plat et attendez que la solution effacer. À l’aide d’une pipette multicanaux, sans déranger les perles, Transvasez soigneusement 30 µL du liquide surnageant dans une nouvelle plaque de 96 puits. Utiliser des embouts de frais pour chaque ligne. Étiquette de la « Réaction de la propriété intellectuelle » et gardez-le à température ambiante.
  2. Digestion des protéines
    1. D’extraire 30 % PEG/1 M NaCl billes magnétiques17 (table de composition tampon) solution du réfrigérateur à 4 ° C et gardez-le à température ambiante pendant au moins 30 min. critique : s’assurer que la solution de perle atteigne pleinement la température ambiante avant de procéder.
    2. Récupérer des échantillons de contrôle d’entrée de 4 ° C, stockage (étape 2.3.2) et un essorage rapide. Mesurer le volume à l’aide d’une pipette et ajouter l’eau ultrapure à chaque contrôle d’entrée pour un volume final de 30 µL. transférer les échantillons de contrôle d’entrée dans les puits d’entrée présélectionnés (puits vides) dans la plaque de réaction de l’IP (étape 3.1.12). Le puits à l’exemple de clé d’enregistrement.
    3. Sur la glace, préparer le mélange de protéine Digestion Master comme indiqué dans le tableau 5 et volume égal aliquote dans une ligne d’une plaque 96 puits réservoir.
    4. À l’aide d’une pipette multicanaux, à chaque ligne d’échantillons dans la plaque de réaction IP, ajouter 40 µL de la protéine Digestion Master Mix et mélanger lentement 10 fois de haut en bas. Sceller la plaque avec une couverture PCR, tournez en bas à 200 x g pendant 1 min et incuber dans un mélangeur de chauffage à 50 ° C pendant 30 min à 650 tr/mn. Alors que la plaque est en incubation, préparer les frais 70 % éthanol (EtOH) et gardez-le à température ambiante.
    5. Après que l’incubation de 30 min est terminée, tourner la plaque de réaction IP à 200 x g pendant 1 min, 4 ° C. Maintenir la plaque à température ambiante.
      Remarque : Le volume total doit être maintenant ~ 70 µL/puits.
  3. Nettoyage perle à l’aide de la solution de billes magnétiques pour le PEG/1 M NaCl 30 %
    1. Perle de la température ambiante 30 % de PEG/1 M NaCl magnétique aliquote solution dans une ligne d’une plaque 96 puits propre réservoir (75 µL par exemple x Nbre de lignes).
    2. Travailler à température ambiante, à l’aide d’une pipette multicanaux, ajouter 70 µL (ratio 1:1) de la solution de billes magnétiques de PEG/1 M NaCl de 30 % à chaque ligne d’échantillons dans la plaque de réaction IP et mélanger 10 fois par pipetage de haut en bas. Changer de conseils entre les rangs. Incuber les plaques à température ambiante pendant 15 minutes.
    3. Placer la plaque sur l’aimant plat et incuber pendant 5 min permettre les perles se séparer.
    4. À l’aide d’une pipette, sans déranger les perles, soigneusement retirer et jeter le surnageant. Garder les perles.
    5. Alors que la plaque de réaction IP est toujours sur l’aimant de la plaque, à l’aide d’une pipette multicanaux, à chaque ligne d’échantillons, ajouter 150 µL de température ambiante 70 % EtOH et incuber pendant 30 s. Après 30 s, à l’aide d’une pipette multicanaux, retirer et jeter le surnageant. Répétez cette étape une fois de plus pour un total de 2 lavages.
    6. Après le deuxième lavage EtOH, incuber la plaque « à sec » sur l’aimant de la plaque pour 3 min. inspecter visuellement la plaque pour s’assurer que tous le EtOH se soit évaporée. Si ce n’est pas le cas, incuber la plaque pendant 1 min. séchage trop les résultats de perles à un rendement inférieur.
    7. Prendre la plaque de l’aimant de la plaque et à l’aide d’une pipette multicanaux, ajouter 35 µL EB (Table des matières). Mélangez bien en pipettant également 10 fois de haut en bas. Changer de conseils entre les rangs. Incuber à température ambiante pendant 3 min éluer.
    8. Après incubation, placer la plaque de réaction IP sur l’aimant de la plaque et incuber pendant 2 min. Les perles doivent séparer et la solution s’éclaircira.
    9. À l’aide d’une pipette multicanaux, sans déranger les perles, transvaser avec soin le surnageant dans les puits correspondants d’une nouvelle plaque de 96 puits.
    10. Sceller la plaque avec un couvercle de plaque en aluminium, étiqueter « IPed + entrée ADN » et stocker à 4 ° C durant la nuit, ou à-20 ° C à long terme (> 48 h) stockage.

4. jour 3 : Construction de la bibliothèque

  1. La phosphorylation et la réparation de la fin
    1. L’entrée pour la réaction de fin réparation/Phosphorylation est l’IPed + entrée plaque de l’étape 3.3.10. Après décongélation, tourner la plaque vers le bas à 200 x g pendant 1 min à 4 ° C et le maintenir sur la glace.
    2. Récupérer du congélateur-20 ° C tous les réactifs (à l’exception des enzymes) nécessaire pour la réaction de fin réparation/Phosphorylation (tableau 6) et les décongeler à température ambiante, puis transférer immédiatement à la glace.
    3. Travaillant sur la glace, suivre le tableau 6 de mettre en place la fin réparation/Phosphorylation Master Mix dans un tube de microtubes de 1,5 mL stérile. Après l’addition de tous les composants non-enzyme, mélanger bien au pouls-vortex et placer le tube de retour sur la glace.
    4. Récupérer les enzymes pertinentes de leur entreposage frigorifique et le transport sur le banc dans un portoir cool réfrigérée. Mélanger chaque enzyme en effleurant le tube, l’essorage rapide et placez-le dans le portoir cool réfrigérée. Lors du pipetage l’enzyme, aspirez lentement pour assurer un transfert de volume précis. Après l’addition, laver le bout en master mix de pipetage de haut en bas.
    5. Une fois que les enzymes sont ajoutées, doucement impulsion-vortex le master mix 5 fois afin d’assurer une répartition égale de tous les composants, puis essorage rapide et placez immédiatement le tube retour sur la glace.
    6. Sur la glace, partie aliquote un volume approprié de la fin réparation/Phosphorylation Master Mix dans une ligne d’une nouvelle plaque de 96 puits réservoir ; volume d’aliquotés : (15 µL x Nbre de lignes) + 5 µL volume mort. Un exemple de calcul pour deux rangées : (15 µL x 2) + 5 µL = 35 µL/puits.
    7. À l’aide d’une pipette multicanaux, ajouter 15 µL du mélange maître de réparation/Phosphorylation de fin pour chaque ligne d’échantillons et mélanger 10 fois par pipetage de haut en bas. Changer de conseils entre les rangs. Sceller la plaque avec un couvercle en plastique, tourner vers le bas à 200 x g pendant 1 min à 4 ° C et laisser incuber à température ambiante pendant 30 min.
  2. Perle nettoyage après réparation de la fin et la phosphorylation
    1. Du réfrigérateur à 4 ° C, récupérer la solution de billes magnétiques PEG/1 M NaCl à 20 % et 30 % PEG/1 M NaCl solution et laisser incuber à température ambiante pendant au moins 30 min.
      Remarque : La solution de NaCl M PEG/1 30 % n’est pas contiennent des billes magnétiques.
    2. Après que les deux solutions atteignent la température ambiante, pour chaque échantillon préparer 80 µL du mélange de 1:2 de 30 % de PEG/1 M NaCl et solutions de billes magnétiques pour le PEG/1 M NaCl 20 %. Un exemple pour 24 échantillons : 80 µL x 24 = 1 920 µL (640 µL de 30 % PEG/1 M NaCl et 1 288 µL des solutions de billes magnétiques pour le PEG/1 M NaCl 20 %).
    3. Aliquote la solution perle mélanger, volume égal, dans une ligne d’une plaque 96 puits réservoir et gardez-le à température ambiante. Tampon EB aliquote (40 µL par exemple x Nbre de lignes) dans une ligne d’une plaque 96 puits propre réservoir. Un exemple pour les deux lignes : 40 µL x 2 = 80 µL/puits.
    4. À l’aide d’une pipette multicanaux, ajouter 75 µL du mélange perle préparé dans l’étape 4.2.2 dans chaque ligne d’échantillons de l’étape 4.1.7 et mélanger et descendre de 10 fois. Changer de conseils entre les rangs. Incuber à température ambiante pendant 15 min. continuer avec la procédure de nettoyage des perles comme indiqué dans les étapes 3.3.3-3.3.10. Couvrir la plaque avec un sceau en plastique, essorage rapide et placez-le sur la glace. Passer au point 4.3.
  3. A-Tailing réaction
    1. Récupérer du congélateur-20 ° C tous les réactifs (à l’exception des enzymes) nécessaire pour la réaction de l’A-Tailing (tableau 7), les décongeler à température ambiante, puis transférer immédiatement à la glace.
    2. Travaillant sur la glace, suivre le tableau 7 de mettre en place le A-Tailing Master Mix dans un tube de microtubes de 1,5 mL stérile. Suivez les instructions de configuration de Broue enzymatique générales énoncées dans des mesures 4.1.4-4.1.6.
    3. À l’aide d’une pipette multicanaux, ajouter 15 µL de l’A-Tailing Master Mix à chaque ligne des échantillons et mélanger 10 fois par pipetage de haut en bas. Changer de conseils entre les rangs. Sceller la plaque avec une couverture PCR, tournez en bas à 200 x g pendant 1 min à 4 ° C et incuber dans un thermocycleur à 37 ° C pendant 30 min. Après l’incubation, tourner la plaque vers le bas à 200 x g pendant 1 min et gardez-le à température ambiante.
  4. Perle nettoyage après A-Tailing
    1. Suivez la procédure décrite à l’étape 4.2. Couvrir la plaque avec un sceau en plastique, essorage rapide étiquette « queue-A + BC, » et placez-le sur la glace. Passer au point 4.5.
  5. Ligature de l’adaptateur
    1. Récupérer du congélateur-20 ° C tous les réactifs (à l’exception des enzymes) nécessaires à la réaction de ligature de l’adaptateur (tableau 8), les décongeler à température ambiante, puis transférer immédiatement à la glace.
    2. Récupérer 10 µM PE adaptateur (Supplemental tableau1) solution-mère et diluer à 0,5 µM en EB. Mélangez bien au vortex de l’impulsion. Le volume nécessaire est 3 µL x Nbre d’échantillons. Travail sur la glace, aliquote l’adaptateur de 0,5 µM PE, à volume égal, dans 12 puits d’une plaque 96 puits propre réservoir. Gardez-le sur la glace.
    3. Travaillant sur la glace, suivre le tableau 8 pour configurer l’adaptateur ligature Master Mix dans un tube de microtubes de 1,5 mL stérile. Suivez les instructions de configuration de Broue enzymatique générales énoncées dans des mesures 4.1.4-4.1.6. Assurez-vous que le 5 X rapide ligature tampon est complètement décongelés et très bien mélangés avant utilisation.
    4. Sur la glace, partie aliquote un volume approprié de l’adaptateur ligature Master Mix dans une ligne d’une nouvelle plaque de 96 puits réservoir. Par exemple, le calcul pour deux rangées : (23 µL x 2) + 5 µL = 51 µL/puits. Maintenir la plaque sur la glace.
    5. À l’aide d’une pipette multicanaux, ajouter 2 µL de la 0,5 µM jumelé fin (PE) adaptateur dans chaque ligne des échantillons à l’étape 4.4.1 et mix. Changer de conseils entre les rangs.
    6. À l’aide d’une pipette multicanaux, ajouter 23 µL de l’adaptateur ligature Master Mix à chaque ligne des échantillons et mélanger 15 fois par pipetage de haut en bas. Changer de conseils entre les rangs. Sceller la plaque avec un couvercle en métal, étiquette « Ligature », centrifuger à 200 x g pendant 1 min à 4 ° C et incuber à température ambiante jusqu’au lendemain.
  6. Jour 4 : Perle nettoyage #1 après une ligature adaptateur
    1. Du réfrigérateur à 4 ° C, d’extraire la solution de billes magnétiques de PEG/1 M NaCl de 20 % et incuber à température ambiante pendant au moins 30 min. Alors que la solution est équilibration préparer fraîches 70 % EtOH.
    2. Partie aliquote de la solution de billes magnétiques de PEG/1 M NaCl de 20 %, 55 µL par exemple, dans une ligne d’un réservoir de 96 puits sur plaque et gardez-le à température ambiante. Un exemple pour les deux lignes : 55 µL x 2 = 110 µL/puits.
    3. Tampon EB aliquote, 50 µL par exemple, dans une ligne d’une plaque 96 puits propre réservoir. Un exemple pour les deux lignes : 50 µL x 2 = 100 µL/puits.
    4. À l’aide d’une pipette multicanaux, ajouter 48 µL de la solution de billes magnétiques de PEG/1 M NaCl de 20 % dans chaque ligne d’échantillons dans la plaque de la ligature de l’étape 4.5.6 et mélanger et descendre de 10 fois. Changer de conseils entre les rangs. Incuber à température ambiante pendant 15 min. continuer avec la procédure de nettoyage des perles comme indiqué dans les étapes 3.3.3-3.3.7.
    5. Prendre la plaque de l’aimant de la plaque et à l’aide d’une pipette multicanaux, ajouter 45 µL EB (Table des matières). Mélangez bien en pipettant également 10 fois de haut en bas. Changer de conseils entre les rangs. Incuber à température ambiante pendant 3 min éluer.
    6. Après incubation, placer la plaque de réaction IP sur l’aimant plat et incuber pendant 2 min. à l’aide d’une pipette multicanaux, sans déranger les perles, transvaser avec soin le surnageant dans les puits correspondants d’une nouvelle plaque de 96 puits. L’étiquette de la plaque « Ligature + 1 BC ».
    7. Dans chaque puits ajouter 5 µL de tampon de haute fidélité x PCR 10 et bien mélanger en pipetage de haut en bas. Changer de conseils entre les rangs. Couvrir la plaque avec un sceau en plastique, essorage rapide et gardez-le à température ambiante.
  7. Perle nettoyage #2 après une ligature adaptateur
    1. Exécuter un nettoyage perle comme décrit dans section 4.6, avec les modifications suivantes : ajouter 60 µL de solution de billes magnétiques de PEG/1 M NaCl de 20 % dans chaque puits active dans la ligature + 13:00 plaque (étape 4.6.7) et éluer depuis les perles avec 35 µL de tampon EB. Étiquette de la « Ligature + 2 BC » et le maintenir sur la glace.
  8. Amplification par PCR
    1. Récupérer du congélateur-20 ° C tous les réactifs (à l’exception des enzymes) nécessaires pour la réaction PCR (tableau 9), les décongeler à température ambiante puis les placer immédiatement sur la glace.
    2. Travaillant sur la glace, suivre le tableau 9 de mettre en place le Master PCR Mix dans un tube de microtubes de 1,5 mL stérile. Suivez les instructions d’installation de brassage général comme indiqué dans les étapes 4.1.4-4.1.5. Sur la glace, partie aliquote un volume approprié de PCR Master Mix dans une ligne d’une nouvelle plaque de 96 puits réservoir. Gardez-le sur la glace. Voir l’étape 4.5.4 pour exemples de calcul.
    3. Travail sur la glace, à l’aide d’une pipette multicanaux, ajouter 2 µL de chaque unique 12,5 µM PCR inverse indexation apprêt (2 Table supplémentaire) dans chaque puits dans la ligature + plaque 2 BC (étape 4.7.1) et mélanger doucement de haut en bas. Changer de conseils entre les rangs. Maintenir la plaque sur la glace.
    4. Travail sur la glace, à l’aide d’une pipette multicanaux, ajouter 23 µL du mélange maître PCR dans chaque ligne des échantillons à l’étape 4.8.3 et mix 10 fois par pipetage de haut en bas. Sceller la plaque avec une couverture PCR, pivoter vers le bas à 200 x g pendant 1 min et incuber dans un thermocycleur (voir tableau 10 pour vélo conditions d’amplification).
  9. Perle nettoyage après amplification par PCR
    1. Après amplification par PCR, tourner la plaque à 200 x g pendant 1 min, 4 ° C. Effectuer le nettoyage perle comme décrit dans section 4.6, avec les modifications suivantes : Ajouter 51 µL de solution de billes magnétiques PEG/1 M NaCl à 20 % à chaque réaction de PCR et éluer depuis les perles avec 25 µL de tampon EB. Sceller la plaque avec un couvercle en aluminium et tournez en bas à x 200 g pour 1 min. magasin les échantillons à-20 ° C.
    2. Pour valider les bibliothèques construites, effectuer la quantification de l’ADN à l’aide d’un test d’amplification par fluorescence, visualiser le produit final avec un analyseur de puce l’électrophorèse capillaire (essai de sensibilité élevée) et exécutez enrichissement PCR quantitative (qPCR) (voir Représentant des résultats, Validation de la qualité de bibliothèque ndChIP-seq par qPCR).

Representative Results

Profils de Digestion de la chromatine
Optimisation de la digestion MNase est essentielle pour la réussite de ce protocole. Il est essentiel pour générer un profil de digestion dominé par taille de fragment unique nucléosome, alors pas trop digérée, permettant la récupération de fragments de nucléosomes ordre plus élevés. Un profil idéal de la digestion se compose d’une majorité des fragments du nucléosome seule une petite fraction représentant des fragments inférieures et supérieures à nucléosomes unique. Figure 1 montre des exemples d’un profils de distribution de taille idéale, trop digérée et sous-digéré. Notez que digestion optimale de la chromatine est également apparente dans le profil de la bibliothèque de séquençage produit de la matière de la propriété intellectuelle (Figure 2).

Validation de la qualité de bibliothèque ndChIP-seq par qPCR
qPCR est une méthode bien établie pour l’évaluation de la qualité de la puce18,19,20. Quelle scène ndChIP-seq sur 10 000 cellules le rendement en acide nucléique après IP sera inférieure à 1 ng. Par conséquent, il est essentiel d’effectuer qPCR après la construction de la bibliothèque afin d’évaluer l’enrichissement relatif des régions cibles sur fond. Pour fournir une estimation de l’arrière-plan, bibliothèques construites de la chromatine MNase digéré (Input) sont générés. Pour chaque bibliothèque de propriété intellectuelle, deux ensembles d’amorces sont nécessaires (voir importation supplémentairetableau 3 pour obtenir la liste des amorces pour les marques de l’histone couramment utilisés). Un ensemble d’apprêt doit être spécifique pour une région génomique qui est constamment associée à la modification des histones d’intérêt (cible positif) et un autre qui n’est pas marqué avec la modification des histones d’intérêt (cible négatif). On évaluera la qualité de la bibliothèque de ChIP-seq que pli enrichissement en ce qui concerne la bibliothèque d’entrée. Enrichissement de pli peut être calculée selon l’équation suivante qui suppose une amplification exponentielle de la région génomique de la cible : 2Ctd’entrée-CtIP. Notre coutume progiciel statistique R, qcQpcr_v1.2, est adapté à l’analyse de l’enrichissement de qPCR de bibliothèques d’entrée faibles natives de ChIP-seq (Les fichiers de Code supplémentaires). La figure 3 représente un résultat de qPCR pour les bibliothèques de ChIP-seq réussies et ratées. La valeur de l’enrichissement pli attendue minimale pour les bibliothèques de ndChIP-seq de bonne qualité sont 16 marques étroits, tels que H3K4me3 et 7 pour les grandes marques, par exemple H3K27me3.

Modélisation MNase accessibilité
Analyse computationnelle de ChIP-seq est complexe et unique pour chaque paramètre expérimental. Un ensemble de lignes directrices établies par le Consortium International d’épigénomique humaine (IHEC) et l’Encyclopédie d’ADN éléments (Encoder) peut être utilisé pour évaluer la qualité du ChIP-seq bibliothèques21. Il est important de noter que la profondeur de séquençage des bibliothèques impact sur la détection et la résolution des régions enrichi de20. Le nombre de pics détectés augmentation et aborde un plateau que la profondeur augmente. Nous vous recommandons ndChIP-seq bibliothèques à séquencer selon les recommandations de l’IHEC de 50 millions jumelé-lectures (fragments de 25 millions) pour les marques étroits (par exemple, H3K4me3) et 100 millions jumelé-lectures (fragments de 50 millions) pour les grandes marques ( par exemple, H3K27me3) et d’entrée de22. Ces profondeurs de séquençage fournissent suffisamment alignements de séquences pour la détection des pics plus importants en utilisant largement utilisé des appelants de pic de ChIP-seq, comme MACS2 et HOMER, sans atteindre la saturation23,24. Une bibliothèque de mammifères ndChIP-seq de haute qualité a un taux double de PCR de < référence et 10 % du taux d’alignement à génome de > 90 % (y compris les lectures dupliqués). Bibliothèques de succès ndChIP-seq contiendra replications hautement corrélées avec une partie importante (> 40 %) des pics de lectures alignés dans MACS222 identifié enrichis et inspection des lectures alignés sur un navigateur de génome devrait révéler visuellement enrichissements détectables par rapport à la bibliothèque d’entrée (Figure 4). En outre, ndChIP-seq peut être utilisé pour évaluer la densité du nucléosome en utilisant un algorithme de distribution de mélange gaussien (w1 * n(x; Μ 1,σ1) + w2 * n(x, μ2σ2) = 1) à MACS2 identifié enrichi de régions à densité de nucléosomes modèle tel que défini par MNase limites accessibles. Dans ce modèle, w1 représente le poids de distribution mono-nucléosomes et w2 représente le poids de distribution di-nucléosomes. Où w1 est supérieur à o2, il y a prédominance des fragments de mono-nucléosomes et vice versa. Cette analyse exige que bibliothèques être séquencé dans un mode jumelé-fin afin que la taille du fragment peut être définie. Afin d’appliquer l’algorithme de distribution de mélange gaussien, régions enrichies statistiquement significatives sont tout d’abord identifiées. Nous vous suggérons d’appeler de la PIC avec MACS2 utilisant l’entrée sous forme de contrôle et avec les paramètres par défaut pour les marques étroits et un seuil de valeur de q de 0,01 pour les grandes marques. Un certain nombre de paquets statistiques utilisant un algorithme de mélange gaussien distribution est disponible auprès des progiciels statistiques largement utilisé. Utilisant la taille de fragment moyenne, déterminée par les frontières lire jumelé-fin des échantillons IPed, distributions en MACS2 identifié promoteurs enrichis et un algorithme de distribution gaussienne de mélange peut être appliqué à chaque porteur de projet en utilisant le paquet R-statistiques Mclust version 3.025 pour calculer une distribution pondérée. Dans cette application, nous vous recommandons d’éliminer les promoteurs contenant moins de 30 fragments alignés parce qu’au-dessous de ce seuil, le poids qui en résulte des estimations devient peu fiables. Une bibliothèque de bonne qualité ndChIP-seq génère une distribution gaussienne de mélange qui se composent de deux composants principaux avec des valeurs moyennes correspondant à mono-, longueur de fragment de di-nucléosomes.

Figure 1
Figure 1 : Évaluation de la digestion MNase avant la génération de la bibliothèque. Électrophorèse capillaire puce analyseur profils d’un MNase optimale digérés (A), sous-digérés (B) et trop digéré la chromatine (C). Réplicats biologiques sont affichés sous forme de traces bleues, rouges et verts. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : Évaluation de digestion MNase après génération bibliothèque. (A) poster des profilés de construction bibliothèque d’entrée optimale digérée (réplicats biologiques ; rouge, vert, noir) et IP (réplicats biologiques ; cyan, violet, bleu) et (B) apport sous-optimal (réplicats biologiques ; rouge, vert, bleu) et IP ( réplicats biologiques ; bibliothèques de cyan, violets, orange). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 : Post construction bibliothèque PCR quantitative peut être utilisé pour évaluer la qualité des bibliothèques ndChIP-seq. Enrichissement du pli des bibliothèques H3K4me3 IP en ce qui concerne les bibliothèques d’entrée équivaut à 2(Ct d’entrée - Ct de la propriété intellectuelle) pour des objectifs positifs et négatifs à l’aide de qcQpcr_v1.2. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 4
Figure 4 : Bibliothèque représentant ndChIP-seq, construit à partir de 10 000 CD34 primaire+ des cellules de sang de cordon. Corrélation de Pearson de H3K4me3 de signal (lectures par million lectures mappés) calculé dans les promoteurs (TSS +/-2 Ko) entre 3 réplicats biologiques, répliquer (A) 1 et 2, (B) reproduire 1 et 3, répliquer (C) 2 et 3. (D) UCSC affichage du pôle de gène HOXA de ChIP-seq réticulé issues de 1 million de cellules par IP, ndChIP-seq réussie de 10 000 cellules par IP et ndChIP-seq infructueuse de 10 000 cellules par IP. (rouge : H3K27me3, vert : H3K4me3 et le noir : Input). (E) Fraction mappé se lit dans MACS2 identifié des régions enrichies de H3K4me3 (noir) et H3K27me3 (gris). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Composition du tampon
A.1. tampon immunoprécipitation (IP)
20 millimètres Tris-HCl pH 7.5
2 mM EDTA
NaCl 150 mM
0,1 % Triton X-100
0,1 % désoxycholate
Butyrate de Sodium 10 mM
A.2. tampon de lavage sel de faible
20 millimètres Tris-HCl pH 8,0
2 mM EDTA
NaCl 150 mM
1 % Triton X-100
0,1 SDS %
A.3. tampon de lavage sel élevé
20 millimètres Tris-HCl pH 8,0
2 mM EDTA
500 mM NaCl
1 % Triton X-100
0,1 SDS %
A.4. tampon d’élution de la puce
100 mM NaHCO3
1 % SDS
A.5. 1 x tampon de lyse – 1 mL
0,1 % Triton
0,1 % désoxycholate
Butyrate de Sodium 10 mM
A.6. tampon de dilution Ab
0,05 % (p/v) d’Azide de
0.05 % large spectre antimicrobien (p. ex. ProClin 300)
dans du PBS
A.7. 30 % PEG / 1M NaCl Solution perle magnétique (référence16)
30 % PEG
1 M NaCl
10 mM Tris HCl, pH 7.5
EDTA 1 mM
1 mL de perles Super paramagnétiques lavés
A.8. 20 % PEG / 1M NaCl Solution perle magnétique (référence16)
30 % PEG
1 M NaCl
10 mM Tris HCl, pH 7.5
EDTA 1 mM
1 mL de perles Super paramagnétiques lavés

Tableau 1 : composition du tampon ndChIP-seq.

Modification des histones Concentration (µg/µL)
H3K4me3 0,125
H3K4me1 0.25
H3K27me3 0,125
H3K9me3 0,125
H3K36me3 0,125
H3K27ac 0,125

Tableau 2 : Montant de l’anticorps requis pour ndChIP-suiv.

Reganet Volume (µL)
Eau ultrapure 478
1 M Tris-HCl pH 7.5 10
0,5 EDTA M 10
5 M NaCl 2
Glycérol 500
Volume total 1 000

Tableau 3 : Recette de tampon de dilution MNase.

Réactif Volume (µL)
Eau ultrapure 13
20 mM TNT 1
10 x MNase tampon 4
20 U/µl Mnase 2
Volume total 20

Tableau 4 : Recette pour MNase Master Mix.

Réactif Volume (µL)
Tampon d’élution 30
Mémoire tampon G2 8
Protéase 2
Volume total 40

Tableau 5 : Recette du mélange réactionnel de Purification de l’ADN.

Réactif Volume (µL)
Eau ultrapure 3.3
10 x tampon endonucléase de Restriction (par exemple NEBuffer) 5
25 mM ATP 2
dNTPs 10 mM 2
T4 Polynucléotide Kinase (10 U/µl) 1
T4 ADN polymérase (3 U/µl) 1.5
ADN polymérase I, gros (Klenow) Fragment (5 U/µl) 0,2
Volume total 15

Tableau 6 : Recette pour fin réparation Master Mix.

Réactif Volume (µL)
Eau ultrapure 8
10 x tampon endonucléase de Restriction (par exemple NEBuffer) 5
dATP 10 mM 1
Klenow (3' - 5' exo-) 1
Volume total 15

Tableau 7 : Recette de Mix Master A-Tailing.

Réactif Volume (µL)
Eau ultrapure 4.3
5 x tampon ligature rapide 12
T4 DNA ligase (2000 U/µl) 6.7
Volume total 23

Tableau 8 : Recette pour adaptateur ligature Master Mix.

Réactif Volume (µL)
Eau ultrapure 7
25 uM amorce PCR 1.0 2
5 x tampon HF 12
DMSO 1.5
ADN polymérase 0,5
Volume total 23

Tableau 9 : Recette pour PCR Master Mix.

Temprature (° C) Durée (s) Nombre de Cycles
98 60 1
98 30
65 15 10
72 15
72 300 1
4 Maintenez Maintenez

Tableau 10 : PCR exécuter la méthode.

Oligo Séquence Modification
PE_adapter 1 5'-/ 5Phos/GAT CGG AAG AGC GGT TCA GCA GGA ATG GCC AG -3 ' 5' modification : Phosphorylation
PE_adapter 2 5' - ACA CCT TTT CCC TAC NOC NOC CCT TTC CGA TC * T - 3' 3' modification : * T est une liaison phosphorothioate

Supplemental tableau 1 : Les séquences de Oligo pour génération d’adaptateur de PE.

Nom de l’apprêt Séquence Index IndexRevC (à utiliser pour le séquencement)
Amorce d’indexation inverse PCR 1 CAAGCAGAAGACGGCATACGAGATCGTGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGTGAT atcacg
Amorce d’indexation inverse PCR 2 CAAGCAGAAGACGGCATACGAGATCTGATCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTGATC gatcag
Amorce d’indexation inverse PCR 3 CAAGCAGAAGACGGCATACGAGATGGGGTTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GGGGTT aacccc
Amorce d’indexation inverse PCR 4 CAAGCAGAAGACGGCATACGAGATCTGGGTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTGGGT acccag
Amorce d’indexation inverse PCR 5 CAAGCAGAAGACGGCATACGAGATAGCGCTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCGCT agcgct
Amorce d’indexation inverse PCR 6 CAAGCAGAAGACGGCATACGAGATCTTTTGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTTTTG caaaag
Amorce d’indexation inverse PCR 7 CAAGCAGAAGACGGCATACGAGATTGTTGGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TGTTGG ccaaca
Amorce d’indexation inverse PCR 8 CAAGCAGAAGACGGCATACGAGATAGCTAGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCTAG ctagct
Amorce d’indexation inverse PCR 9 CAAGCAGAAGACGGCATACGAGATAGCATCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCATC gatgct
Amorce d’indexation inverse PCR 10 CAAGCAGAAGACGGCATACGAGATCGATTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGATTA taatcg
Amorce d’indexation inverse PCR 11 CAAGCAGAAGACGGCATACGAGATCATTCACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CATTCA tgaatg
Amorce d’indexation inverse PCR 12 CAAGCAGAAGACGGCATACGAGATGGAACTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GGAACT agttcc
Amorce d’indexation inverse PCR 13 CAAGCAGAAGACGGCATACGAGATACATCGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT ACATCG cgatgt
Amorce d’indexation inverse PCR 14 CAAGCAGAAGACGGCATACGAGATAAGCTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AAGCTA tagctt
Amorce d’indexation inverse PCR 15 CAAGCAGAAGACGGCATACGAGATCAAGTTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CAAGTT aacttg
Amorce d’indexation inverse PCR 16 CAAGCAGAAGACGGCATACGAGATGCCGGTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCCGGT accggc
Amorce d’indexation inverse PCR 17 CAAGCAGAAGACGGCATACGAGATCGGCCTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGGCCT aggccg
Amorce d’indexation inverse PCR 18 CAAGCAGAAGACGGCATACGAGATTAGTTGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TAGTTG caacta
Amorce d’indexation inverse PCR 19 CAAGCAGAAGACGGCATACGAGATGCGTGGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCGTGG ccacgc
Amorce d’indexation inverse PCR 20 CAAGCAGAAGACGGCATACGAGATGTATAGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GTATAG ctatac
Amorce d’indexation inverse PCR 21 CAAGCAGAAGACGGCATACGAGATCCTTGCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CCTTGC gcaagg
Amorce d’indexation inverse PCR 22 CAAGCAGAAGACGGCATACGAGATGCTGTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCTGTA tacagc
Amorce d’indexation inverse PCR 23 CAAGCAGAAGACGGCATACGAGATATGGCACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT ATGGCA tgccat
Amorce d’indexation inverse PCR 24 CAAGCAGAAGACGGCATACGAGATTGACATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TGACAT atgtca

La Table 2 : PCR inverse indexation des séquences d’amorces.

Amorces Séquence
ZNF333_genic_H3K9me3_F 5'-AGCCTTCAATCAGCCATCATCCCT-3'
ZNF333_genic_H3K9me3_R 5'-TCTGGTATGGGTTCGCAGATGTGT-3'
HOXA9-10_F 5'-ACTGAAGTAATGAAGGCAGTGTCGT-3'
HOXA9-10_R 5'-GCAGCAYCAGAACTGGTCGGTG-3'
GAPDH_genic_H3K36me3_F 5'-AGGCAACTAGGATGGTGTGG-3'
GAPDH_genic_H3K36me3_R 5'-TTGATTTTGGAGGGATCTCG-3'
GAPDH.-F. 5'-TACTAGCGGTTTTACGGGCG-3'
GAPDH.-R. 5'-TCGAACAGGAGGAGCAGAGAGCGA-3'
Modification des histones Objectif positif Cible de négatif
H3K4me3 GAPDH HOXA9-10
H3K4me1 GAPDH_genic ZNF333
H3K27me3 HOXA9-10 ZNF333
H3K27ac GAPDH ZNF333
H3K9me3 ZNF333 HOXA9-10
H3K36me3 GAPDH_genic ZNF333

Supplemental tableau 3 : Liste des amorces pour les marques de l’histone couramment utilisés (H3K4me3, H3K4me1, H3K27me3, H3K27ac, H3K9me3 et H3K36me3).

Supplémentaire 1 fichier : feuille de calcul ndChIP-seq. S’il vous plaît cliquez ici pour télécharger ce fichier.

Les fichiers de Code supplémentaires : qcQpcr_v1.2. R progiciel statistique pour l’analyse d’enrichissement qPCR de faible entrées bibliothèques natives de ChIP-seq. S’il vous plaît cliquez ici pour télécharger ce fichier.

Discussion

Compte tenu de la nature combinatoire de modification de la chromatine et nucléosome positionnement dans la régulation transcriptionnelle, une méthode qui permet la mesure simultanée de ces caractéristiques est susceptible d’offrir de nouvelles perspectives sur la régulation épigénétique. Le ndChIP-seq présenté ici est un protocole de ChIP-seq natif optimisé permettant l’interrogation simultanée de modification d’histone et densité des nucléosomes dans rares cellules primaires9,10. ndChIP-seq utilise la digestion enzymatique de la chromatine qui, lorsqu’il est couplé au séquençage massivement parallèle jumelé-fin et un modèle de distribution de mélange gaussien, permet les modifications d’histone enquête au niveau de single nucléosome et le déconvolution des profils épigénomique entraînée par l’hétérogénéité au sein d’une population. Utilisant ce protocole, nous avons déjà rapporté une distribution unique de tailles de fragment immuno-précipité, déterminée par jumelé-fin lire limites, associées aux États de chromatine spécifiques définies par ChromHMM10,24.

La qualité d’une bibliothèque de ndChIP-seq dépend de multiples facteurs, comme la spécificité de l’anticorps et de sensibilité, des conditions optimales de digestion MNase et qualité de la chromatine. La spécificité de l’anticorps utilisé est cruciale dans la production réussie ndChIP-seq bibliothèque. Un anticorps idéal montre une affinité élevée contre l’épitope d’intérêt avec peu de réactivité croisée avec les autres épitopes. Il est également important de choisir des billes magnétiques avec l’affinité de l’anticorps de choix.

MNase digestion est une réaction critique et sensibles au temps et concentration dans le présent protocole. Par conséquent, lors du traitement des échantillons multiples, il est important que chaque réaction est incubée pendant une durée équivalente (Voir l’étape 2.2). La qualité de la chromatine est un autre facteur que les effets significativement le résultat de ndChIP-suiv. fragmentés chromatine entraîne un profil de digestion MNase sous-optimal et résultats dans les bibliothèques avec un faible rapport signal sur bruit. Des échantillons primaires avec faible viabilité cellulaire ou dégradent de la chromatine, tels que fixés au formol des tissus inclus en paraffine (FFIP) ne sont pas recommandés pour ce protocole.

L’ajout d’un PIC au cours de l’extraction de la chromatine réduit non désirés (c.-à-d., aléatoire) chromatine fragmentation et préserve l’intégrité des queues d’histone. Par conséquent, PIC doit être ajoutée au tampon de lyse et immunoprécipitation tampon juste avant d’utiliser. Tandis que la sélection de cellules par cytométrie en flux, sélectionnez des cellules viables et vérifiez les cellules sont triés à un faible débit pour augmenter la précision de l’estimation numéro de cellulaire et de la viabilité des cellules. Éviter le tri des cellules directement dans le tampon de lyse. Le tampon de la gaine va diluer le tampon de lyse et empêche efficacement perméabilisation de la membrane cellulaire à MNase. Selon un type de cellules ou d’organismes, titrage de MNase peut être nécessaire d’obtenir une digestion optimale.

ndChIP-seq sur cellules de mammifères nécessite une profondeur minimale de séquençage de 50 millions jumelé-lectures (fragments de 25 millions) pour les marques étroites et 100 millions jumelé-lectures (fragments de 50 millions) pour l’entrée et les grandes marques. L’algorithme de distribution gaussienne de mélange ne pas fonctionne de manière optimale sur les bibliothèques qui ont été séquencés jusqu'à une profondeur largement inférieures de cette recommandation. ndChIP-seq classera pas promoteurs avec peu de distinction entre la valeur de la distribution pondérée pour des longueurs de fragment de mono - et di-nucléosomes dans mono - ou di-nucléosomes dominé promoteurs. Par conséquent, ces promoteurs doivent être enlevés dans l’analyse qui suit. Réplicats biologiques peuvent être générés pour accroître la confiance dans les distributions prédites et identifier la variabilité technique dans la construction de la digestion et bibliothèque MNase.

Contrairement aux itérations précédentes de protocoles natifs de ChIP-seq, ndChIP-seq fournit les moyens d’enquêter sur les effet combinatoire de modification de structure et les histones de la chromatine en utilisant la taille de fragment post immunoprécipitation pour intégrer la densité du nucléosome, déterminé par l’accessibilité MNase, avec mesures de modification des histones. Demande de ndChIP-seq primaires de cellules et tissus fournira de nouveaux aperçus de la nature intégrative de régulation épigénétique et permettre l’identification de signatures épigénétiques en raison de l’hétérogénéité au sein de la population.

Disclosures

Les auteurs déclarent qu’ils n’ont aucun intérêt financier concurrentes.

Acknowledgements

A.L. était soutenue par une bourse d’études supérieures canadiennes de l’instituts de recherche en santé du Canada. Ce travail a été soutenu par des subventions de Génome Colombie-Britannique et les Instituts canadiens de recherche en santé (IRSC-120589) dans le cadre de l’épigénétique canadiens, l’environnement et l’Initiative Consortium de recherche en santé et par le programme d’Institut de recherche Terry Fox Subvention de projet #TFF-122869 M.H. et une Institut de recherche Terry Fox bourse de nouveau chercheur (subvention # 1039) à M.H.

Materials

Name Company Catalog Number Comments
1M Tris-HCl –pH 7.5 Thermo Scientific 15567-027
1M Tris-HCl –pH 8 Thermo Scientific 15568-025
0.5M EDTA Thermo Scientific AM9260G
5M NaCl Sigma 1001385276
Triton X-100 Sigma 1001412354
Sodium-Deoxycholate Sigma 1001437582
SDS Thermo Scientific 15525-017
Sodium-Bicarbonate Fisher Scientific S233-500
100% EtOH NA NA
V-bottom 96 well plate (AB 1400) Thermo Scientific AB-1400-L
Gilson P2 pipetman Mandel F144801
Gilson P10 pipetman Mandel F144802
Gilson P20 pipetman Mandel F123600
Gilson P100 pipetman Mandel F123615
Gilson P200 pipetman Mandel F123601
Gilson P1000 pipetman Mandel F123603
Micrococcal Nuclease  NEB M0247S
Thermo Mixer C (Heating block mixer) Eppendorf 5382000023
Multi 12-channel Pippet P20 Rainin 17013803
Multi 12-channel Pippet P200 Rainin 17013805
1.5 ml LoBind tube Eppendorf 22431021
0.5 ml LoBind tube Eppendorf 22431005
Plastic Plate Cover Edge Bio 48461
PCR cover Bio Rad MSD-1001
Aluminum Plate Cover Bio Rad MSF-1001
Elution buffer (EB buffer) Qiagen 19086
1M DTT Sigma 646563
Eppendorf 5810R centrifuge  Eppendorf 22625004
Ultrapure water Thermo Scientific 10977-015
Protein G dynabeads Thermo Scientific 10001D
Protein A dynabeads Thermo Scientific 10001D
Protease inhibitor Cocktail Calbiochem 539134
Rotating platform Mandel 1b109-12052010
Plate magnet Alpaqua 2523
Domed 12-cap strip Bio Rad TCS1201
Buffer G2 Qiagen 1014636
Protease Qiagen 19155
Tube Magnet (DynaMag-2) Thermo Scientific 12321D
Tube Magnet (DynaMag-2) LabCore 730-006
V shape Plastic reservoir Mandel S0100A
Vortex Mandel C1801
Mini Fuge Mettler Toledo XS2035
Analytical scale Mandel LB109-12052010
Quick Ligation Reaction Buffer, 5X NEB B6058S
DNA Polymerase I, Large (Klenow) Fragment NEB M0210S
Klenow Fragment (3'-5' exo) NEB M0212S
T4 DNA Polymerase NEB M0203S
T4 Polynucleotide Kinase NEB M0201S
Deoxynucleotide Solution mix, 10mM NEB N0447S
dATP Solution 10mM NEB N0440S
Quick T4 DNA Ligase NEB M0202T
Adenosine 5'-Triphosphate (ATP), 25mM NEB P0756S
DNA Polymerase Thermo Scientific F549L
NEBuffer 2 NEB B7002S
Hank's buffered salt solution Thermo Scientific 14025076
Fetal bovine serum  Thermo Scientific A3160702
phosphate buffer saline  Thermo Scientific 10010023
H3K4me3 Cell Signaling 9751S
H3K4me1 Diagenode C15410037
H3K27me3 Diagenode pAb-069-050
H3K36me3 Abcam ab9050
H3K9me3 Diagenode C15410056
SeraMag  super-paramagnetic beads

DOWNLOAD MATERIALS LIST

References

  1. Simpson, R. T. Nucleosome Positioning: Occurrence, Mechanisms, and Functional Consequences. Prog. Nucleic Acid Res. Mol. Biol. 40, Issue C 143-184 (1991).
  2. Kornberg, R. D., Lorch, Y. Twenty-five years of the nucleosome, fundmamental particle of the eukaryotic chromosome. Cell. 98, 285-294 (1999).
  3. Schones, D. E., et al. Dynamic regulation of nucleosome positioning in the human genome. Cell. 132, (5), 887-898 (2008).
  4. Segal, E., et al. A genomic code for nucleosome positioning. Nature. 442, (7104), 772-778 (2006).
  5. Shiio, Y., Eisenman, R. N. Histone sumoylation is associated with transcriptional repression. PNAS. 100, (23), 13225-13230 (2003).
  6. Li, L., Lorzadeh, A., Hirst, M. Regulatory variation: An emerging vantage point for cancer biology. Wiley Interdiscip. Rev. Syst. Biol. Med. 6, (1), 37-59 (2014).
  7. Jiang, J., et al. Investigation of the acetylation mechanism by GCN5 histone acetyltransferase. PLoS ONE. 7, (5), (2012).
  8. Kouzarides, T. Histone methylation in transcriptional control. Curr. Opin. Genet. Dev. 12, (2), 198-209 (2002).
  9. Brind'Amour, J., Liu, S., Hudson, M., Chen, C., Karimi, M. M., Lorincz, M. C. An ultra-low-input native ChIP-seq protocol for genome-wide profiling of rare cell populations. Nat. Commun. 6, 6033 (2015).
  10. Lorzadeh, A., et al. Nucleosome Density ChIP-Seq Identifies Distinct Chromatin Modification Signatures Associated with MNase Accessibility. Cell Rep. 17, (8), 2112-2124 (2016).
  11. Noll, M., Kornberg, R. D. Action of micrococcal nuclease on chromatin and the location of histone H1. J. Mol. Biol. 109, (3), 393-404 (1977).
  12. Skene, P. J., Henikoff, S. A simple method for generating high-resolution maps of genome wide protein binding. eLife. 4, 09225 (2015).
  13. Brogaard, K., Xi, L., Wang, J. -P., Widom, J. A map of nucleosome positions in yeast at base-pair resolution. Nature. (2012).
  14. Cui, K., Zhao, K. Genome-wide approaches to determining nucleosome occupancy in metazoans using MNase-Seq. Methods Mol. Biol. 833, 413-419 (2012).
  15. Mieczkowski, J., et al. MNase titration reveals differences between nucleosome occupancy and chromatin accessibility. Nat. Commun. 7, 11485 (2016).
  16. Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of Specific Cell Population by Fluorescence Activated Cell Sorting (FACS). JOVE. (41), (2010).
  17. Rohland, N., Reich, D. Cost-effective, high-throughput DNA sequencing libraries for multiplexed target capture. Genome Res. 22, (5), 939-946 (2012).
  18. Zheng, Y., Josefowicz, S. Z., Kas, A., Chu, T. T., Gavin, M. A., Rudensky, A. Y. Genome-wide analysis of Foxp3 target genes in developing and mature regulatory T cells. Nature. 445, (7130), 936-940 (2007).
  19. Krishnakumar, R., Gamble, M. J., Frizzell, K. M., Berrocal, J. G., Kininis, M., Kraus, W. L. Reciprocal Binding of PARP-1 and Histone H1 at Promoters Specifies Transcriptional Outcomes. Science. 319, (5864), 819-821 (2008).
  20. Mendenhall, E. M., et al. Locus-specific editing of histone modifications at endogenous enhancers. Nat. Biotechnol. 31, (12), 1133-1136 (2013).
  21. Landt, S. G., et al. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia. Genome Res. 22, (9), 1813-1831 (2012).
  22. Reference Epigenome Standards - IHEC. Available from: http://ihec-epigenomes.org/research/reference-epigenome-standards/ (2017).
  23. Heinz, S., et al. Simple Combinations of Lineage-Determining Transcription Factors Prime cis-Regulatory Elements Required for Macrophage and B Cell Identities. Mol. Cell. 38, (4), 576-589 (2010).
  24. Feng, J., Liu, T., Qin, B., Zhang, Y., Liu, X. S. Identifying ChIP-seq enrichment using MACS. Nat. Protoc. 7, (9), 1728-1740 (2012).
  25. Fraley, C., Raftery, A. E. MCLUST: Software for Model-Based Cluster Analysis. J. Classif. 16, (2), 297-306 (1999).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics