Nucleosome घनत्व विश्लेषण के लिए देशी क्रोमेटिन Immunoprecipitation अनुक्रमण पुस्तकालयों की पीढ़ी

Genetics
 

Summary

हम एक संशोधित नेटिव क्रोमेटिन immunoprecipitation sequencing (चिप-seq) पद्धति की पीढ़ी के लिए अनुक्रम डेटासेट एक nucleosome घनत्व चिप के लिए उपयुक्त-seq विश्लेषणात्मक ढांचा घालमेल micrococcal nuclease (MNase) पहुंच citrullinated संशोधन माप के साथ ।

Cite this Article

Copy Citation | Download Citations

Lorzadeh, A., Lopez Gutierrez, R., Jackson, L., Moksa, M., Hirst, M. Generation of Native Chromatin Immunoprecipitation Sequencing Libraries for Nucleosome Density Analysis. J. Vis. Exp. (130), e56085, doi:10.3791/56085 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

हम एक संशोधित देशी क्रोमेटिन immunoprecipitation अनुक्रमण (चिप-seq) प्रयोगात्मक एक गाऊसी मिश्रण वितरण आधारित विश्लेषण पद्धति (nucleosome घनत्व चिप-seq; ndChIP-seq) के साथ संगत प्रोटोकॉल मौजूद है कि की पीढ़ी को सक्षम बनाता है citrullinated संशोधन जीनोम के साथ micrococcal nuclease (MNase) पहुंच के संयुक्त माप चौड़ा । Nucleosome स्थिति और स्थानीय घनत्व, और उनके citrullinated उपइकाईयों के posttranslational संशोधन, संगीत समारोह में अभिनय के लिए स्थानीय प्रतिलिपि राज्यों को विनियमित । ndChIP-seq द्वारा उत्पन्न citrullinated संशोधन के साथ nucleosome पहुँच के मिश्रित मापन इन सुविधाओं के साथ-साथ पूछताछ के लिए अनुमति देता है. ndChIP-seq पद्धति प्राथमिक कोशिकाओं को पार से जोड़ने के लिए दुर्गम आधारित चिप-seq प्रोटोकॉल की छोटी संख्या के लिए लागू है । साथ में ले लिया, ndChIP-seq स्थानीय nucleosome घनत्व के साथ संयोजन में citrullinated संशोधन की माप सक्षम बनाता है साझा तंत्र है कि दुर्लभ प्राथमिक कोशिका आबादी के भीतर आरएनए प्रतिलेखन को विनियमित में नई अंतर्दृष्टि प्राप्त करने के लिए ।

Introduction

युकेरियोटिक जीनोम क्रोमेटिन में दोहरा nucleosome संरचनाओं कि चार citrullinated प्रोटीन की दो प्रतियां (जैसे, H2A, H2B, H3, और H4) डीएनए के १४६ आधार जोड़े द्वारा घिरा1,2से मिलकर पैक किया जाता है । क्रोमेटिन remodeling परिसरों जीन प्रवर्तक सीमाओं के भीतर नियंत्रण nucleosome स्थिति और प्रतिलेखन कारकों को डीएनए की पहुंच और आरएनए पोलीमरेज़ मशीनरी को बदलने के द्वारा जीन अभिव्यक्ति के विनियमन में भाग लेने के लिए3, 4.

nucleosome के भीतर histones के एमिनो टर्मिनल पूंछ acetylation, मिथाइल, फास्फारिलीकरण, ubiquitylation, sumoylation, formylation, और विशिष्ट अमीनो एसिड की hydroxylation सहित विभिन्न आबंध संशोधनों के अधीन हैं5 , , 7 , 8. पदों और इन संशोधनों के डिग्री एक क्रोमेटिन राज्य है कि प्रभाव क्रोमेटिन संरचना और आणविक परिसरों कि प्रतिलेखन7के सक्रियकरण की अनुमति के नियंत्रण का उपयोग करते हैं । यह देखते हुए कि दोनों nucleosome घनत्व और citrullinated संशोधन जीन प्रतिलेखन के स्थानीय नियंत्रण में एक भूमिका निभाते हैं, हम एक देशी चिप दृष्टिकोण है कि nucleosome घनत्व और citrullinated संशोधन के एक साथ माप9सक्षम बनाता है विकसित, 10.

देशी चिप-seq endonuclease micrococci nuclease (MNase) के नाभिक के भीतर अपने पैतृक राज्य में बरकरार क्रोमेटिन पचाने के लिए का लाभ लेता है11,12, एक संपत्ति है कि nucleosome स्थिति13 नक्शा करने के लिए leveraged किया गया है , 14 , 15. Nucleosome घनत्व चिप-seq (ndChIP-seq) MNase के क्षेत्रों को खोलने के लिए क्रोमेटिन के अधिमानी उपयोग की संपत्ति का लाभ लेता है माप है कि संशोधन के साथ MNase पहुंच गठबंधन उत्पंन करने के लिए 10 । ndChIP-seq दुर्लभ प्राथमिक कोशिकाओं, ऊतकों, और प्रसंस्कृत कोशिकाओं में citrullinated संशोधनों की रूपरेखा के लिए उपयुक्त है । यहां, हम एक विस्तृत प्रोटोकॉल है कि अनुक्रम datasets एक पहले वर्णित विश्लेषणात्मक फ़्रेम काम10 कि टुकड़ा आकार पोस्ट immunoprecipitation को एकीकृत करता है, युग्मित अंत से निर्धारित की सीमाओं के लिए उपयुक्त की पीढ़ी को सक्षम बनाता है पेश करते हैं, के लिए इसके साथ ही citrullinated संशोधन माप के साथ MNase पहुंच की जांच । पहले, १०,००० प्राथमिक मानव गर्भनाल रक्त व्युत्पंन CD34+ कोशिकाओं और मानव भ्रूण स्टेम कोशिकाओं के लिए इस प्रोटोकॉल के आवेदन क्रोमेटिन संरचना और इन सेल प्रकार के भीतर citrullinated संशोधनों के बीच अद्वितीय संबंधों को पता चला10 . इसके साथ ही nucleosome पहुंच और citrullinated संशोधन को मापने की क्षमता को देखते हुए, ndChIP-seq एक सेल जनसंख्या में epigenomic सुविधाओं का खुलासा करने में सक्षम है एक एकल nucleosome स्तर पर, और विषम हस्ताक्षरों को हल करने में उनके घटक तत्त्वे आहेत. ndChIP द्वारा विषम सेलुलर आबादी की खोज का एक उदाहरण-seq bivalent प्रमोटरों की जांच है, जहां दोनों H3K4me3, एक सक्रिय निशान, और H3K27me3, एक दमन के निशान, मौजूद है10

Protocol

नोट: इस प्रोटोकॉल के लिए न्यूनतम इनपुट एकल bliss-वर्षण (IP) प्रतिक्रिया प्रति १०,००० कक्ष है । आपूर्ति प्रयोगात्मक वर्कशीट बाहर प्रिंट और प्रयोग की योजना के लिए एक दिशानिर्देश के रूप में उपयोग. कमरे के तापमान पर गर्मी ~ 22 डिग्री सेल्सियस पर माना जाता है । बफर व्यंजनों के सभी तालिका 1में प्रदान की जाती हैं । बफ़र्स के सभी 4 डिग्री सेल्सियस पर संग्रहीत किया जाना चाहिए और प्रक्रिया के दौरान बर्फ पर रखा, जब तक अंयथा कहा ।

1. सेल की तैयारी

  1. कल्चरल सेल
    1. फॉस्फेट बफर खारा (पंजाब) की 1 मिलीलीटर के साथ कोशिकाओं को धोने और सही सेल एकाग्रता का उपयोग कर एक hemocytometer का निर्धारण । यदि १,०००,००० से अधिक कक्ष हैं, तो पंजाबियों की मात्रा बढ़ाएं ।
    2. सेल गणना के आधार पर, एक बाँझ १.५ एमएल ट्यूब में 70000-100000 कोशिकाओं के बराबर aliquot, और 4 ° c पर 6 मिनट के लिए ५०० x g पर नीचे स्पिन । एक पिपेट का उपयोग करना, धीरे से हटाने और supernatant (सेल गोली परेशान किए बिना) त्यागें और बर्फ में गोली फिर से स्थगित-शीत lysis बफर + 1x चिढ़ाने की एक एकाग्रता के लिए कॉकटेल (PIC) १,००० कोशिकाओं/µ एल मिश्रण अच्छी तरह से pipetting द्वारा और नीचे 20-30 बार. यह महत्वपूर्ण है कि सेल के झुरमुट बाधित कर रहे हैं । बुलबुले बनाने के लिए नहीं की कोशिश करो ।
    3. 1 दिन के लिए सीधे आगे बढ़ें (खंड 2) ndChIP-seq प्रोटोकॉल या फ़्लैश तरल नाइट्रोजन और स्टोर में सेल गोली फ्रीज-८० ° c ।
  2. सॉर्ट किए गए कक्ष
    1. इकट्ठा 70000-100000 एक १.५ मिलीलीटर ट्यूब में16 कोशिकाओं को हल हांक के बफर नमक समाधान (HBSS), या पंजाब + 2% भ्रूण गोजातीय सीरम (FBS) के ३५० µ एल के साथ ।
    2. 4 डिग्री सेल्सियस पर 6 मिनट के लिए ५०० x g पर प्रत्येक कोशिका aliquot नीचे स्पिन । एक पिपेट का प्रयोग, धीरे (सेल गोली परेशान बिना) supernatant हटाने और बर्फ में reसस्पेंड-शीत lysis बफर + 1x १,००० कोशिकाओं के एक अंतिम एकाग्रता के लिए PIC/µ l. lysis बफर में अच्छी तरह से pipetting ऊपर और नीचे 20-30 बार मिश्रण । सुनिश्चित करें कि सेल के झुरमुट बाधित हो रहे हैं । बुलबुले बनाने के लिए नहीं की कोशिश करो ।
    3. 1 दिन के लिए सीधे आगे बढ़ें (खंड 2) ndChIP-seq प्रोटोकॉल, या फ़्लैश तरल नाइट्रोजन और स्टोर में सेल गोली फ्रीज-८० ° c ।

2. दिन 1: ndChIP-seq

  1. एंटीबॉडी-मनका परिसर की तैयारी
    1. एक ३७ ° c पानी स्नान और एक बर्फ बाल्टी तैयार करें । बर्फ पर कार्य करना, 1x आईपी बफर/1x PIC और 1x एंटीबॉडी (Ab) कमजोर पड़ने बफर तैयार है, और बर्फ पर उंहें रखने के लिए । पुनः प्राप्त प्रोटीन एक (या जी) चुंबकीय मोती (चयन मानदंड के लिए चर्चा देखें) से 4 डिग्री सेल्सियस भंडारण, और बहुत अच्छी तरह से कोमल नाड़ी-भंवर से मिश्रण । इसे बर्फ पर रखें ।
      नोट: पल्स भंवर का मतलब है भंवर हर बार बंद कर दिया है एक पूर्ण भंवर ट्यूब में बना है ।
    2. एक नई 2 एमएल ट्यूब में आईपी प्रतिक्रिया प्रति प्रोटीन एक (या जी) चुंबकीय मोतियों की 24 µ एल स्थानांतरण । मोती की मात्रा रिकॉर्ड और बर्फ पर ट्यूब रखने के लिए । उदाहरण के लिए, 7 आईपीएस के लिए, 24 µ l x 7 = १६८ µ l का उपयोग करें ।
    3. ट्यूब चुंबक पर ट्यूब प्लेस और समाधान के लिए प्रतीक्षा करने के लिए स्पष्ट संकेत मनका जुदाई बन जाते हैं । मोतियों को परेशान किए बिना, ध्यान से एक पिपेट का उपयोग कर supernatant को हटा दें और छोड़ें । ट्यूब चुंबक से ट्यूब ले लो और यह बर्फ पर जगह है ।
    4. एक बराबर मात्रा (यानी, मोतियों की प्रारंभिक मात्रा) बर्फ ठंडा आईपी बफर + 1x तस्वीर मिश्रण जोड़ें । ऊपर और नीचे pipetting द्वारा मिक्स । भंवर मत करो ।
    5. आईपी बफर प्लेस + 1x PIC + मोती वापस ट्यूब चुंबक पर और समाधान के लिए प्रतीक्षा करने के लिए स्पष्ट संकेत मनका जुदाई बन जाते हैं । मोतियों को परेशान किए बिना, ध्यान से एक पिपेट का उपयोग कर supernatant को हटा दें और छोड़ें । दोहराएं शीत आईपी बफर + 1x तस्वीर 3 बहाकर की कुल के लिए दो बार और धो लो ।
    6. अंतिम धोने के बाद, एक समान मात्रा (यानी, मोतियों की प्रारंभिक मात्रा) बर्फ ठंड आईपी बफर + 1x तस्वीर मिश्रण में मोतियों को फिर से स्थगित । ऊपर और नीचे pipetting द्वारा मिक्स । भंवर मत करो । बर्फ पर ट्यूब रखें ।
    7. बर्फ पर, एक 25 मिलीलीटर वी के आकार का जलाशय में आईपी बफर के 10 मिलीलीटर + तस्वीर डालो । एक मल्टीचैनल पिपेट का उपयोग करना, एक साफ V-नीचे ९६-अच्छी तरह से प्लेट के व्यक्तिगत कुओं में बर्फ ठंडा आईपी बफर + 1x PIC मिश्रण के १३० µ एल जोड़ें । एक आईपी प्रति अच्छी तरह से भरें । "Ab-मनका जटिल" के रूप में प्लेट लेबल ।
    8. एक अच्छी तरह से युक्त आईपी बफर में धोया प्रोटीन एक (या जी) चुंबकीय मोती के 12 µ एल जोड़ें + तस्वीर, और ऊपर और नीचे pipetting द्वारा मिश्रण । शेष धोकर मोतियों को बर्फ पर रखें.
    9. यदि आवश्यक हो तो बर्फ पर अपने कोल्ड स्टोरेज और गल से मान्य एंटीबॉडी प्राप्त करें । बर्फ पर कार्य करना, तालिका 2में दिखाया सांद्रता के लिए 1x अटल बिहारी कमजोर करने बफर के साथ एंटीबॉडी पतला ।
    10. अटल-मनका जटिल प्लेट के प्रत्येक कुआं के लिए, उपयुक्त, पतला एंटीबॉडी (तालिका 1) के 1 µ l जोड़ें. एंटीबॉडी कुंजी को अच्छी तरह से रिकॉर्ड करें । मल्टीचैनल पिपेट का उपयोग करके, प्रत्येक पंक्ति को pipetting करके ऊपर और नीचे 20 बार मिलाएं । पंक्तियों के बीच युक्तियां परिवर्तित करें । एक एल्यूमीनियम प्लेट कवर के साथ और एक घूर्णन मंच पर 4 डिग्री सेल्सियस से कम 2 ज के लिए बहुत अच्छी तरह से अटल-मनका जटिल प्लेट सील ।
      नोट: यह मशीन कदम २.४ शुरू करने के लिए तैयार जब तक आगे बढ़ सकते हैं ।
  2. कोशिका lysis और क्रोमेटिन पाचन
    1. बर्फ पर काम करना, 1x lysis बफर + 1x तस्वीर और MNase के 1 मिलीलीटर मैं कमजोर पड़ने बफर तैयार (तालिका 3) और उंहें बर्फ पर रखो ।
    2. उनके-८० ° c संग्रहण से सेल छर्रों पुनः प्राप्त (या बर्फ से, अगर हौसले से तैयार) । गल एक 10 एस के लिए एक ३७ ° c पानी के स्नान में प्रत्येक कोशिका गोली, तो बर्फ को हस्तांतरण ।
    3. प्रत्येक सेल गोली करने के लिए तुरंत बर्फ ठंडा 1x lysis बफर + 1x तस्वीर जोड़ने के लिए १०,००० कोशिकाओं के एक अंतिम एकाग्रता/20 µ एल, और मिश्रण 10 बार ऊपर और नीचे pipetting द्वारा, बुलबुले बनाने के बिना । उदाहरण के लिए, ७०,००० कक्षों के लिए अंतिम खंड १४० µ है l
    4. बर्फ पर कार्य करना, aliquot 20 µ l/परिणामस्वरूप lysates के एक ९६-अच्छी तरह से थाली में । एक प्लास्टिक सील के साथ थाली कवर और बर्फ पर 20 मिनट के लिए मशीन लेबल प्लेट "MNase पाचन" और एक कुंजी टेंपलेट के कुओं रिकॉर्ड । आदेश में क्रोमेटिन पाचन प्रतिक्रिया का एक सटीक समय आश्वासन देने के लिए, एक समय में नमूनों की 2 से अधिक पंक्तियों के साथ पाचन के लिए आगे बढ़ना नहीं है ।
    5. बस से पहले 20 मिनट lysis पूरा हो गया है, MNase मैं कमजोर पड़ने बफर के साथ MNase एंजाइम पतला, 20 यू के एक अंतिम एकाग्रता के लिए/µ एल, और यह बर्फ पर रखो ।
    6. बर्फ पर कार्य करना, MNase मैं पाचन मास्टर मिश्रण तैयार के अनुसार तालिका 4 और aliquot 20 µ एल के नमूनों की प्रत्येक पंक्ति से अधिक 5 µ l मृत मात्रा एक ९६-अच्छी तरह से जलाशय प्लेट की एक पंक्ति में और बर्फ पर रखने के प्रति । दो पंक्तियों के लिए, वॉल्यूम होना चाहिए: (20 µ l x 2) + 5 µ l = ४५ µ l.
    7. lysates खत्म करने के बाद, बर्फ से MNase पाचन थाली निकालें । एक मल्टीचैनल पिपेट का प्रयोग, MNase के 20 µ एल जोड़ें मैं पाचन मास्टर मिश्रण नमूनों की प्रत्येक पंक्ति में, और ऊपर और नीचे pipetting द्वारा 10 बार मिश्रण. पंक्तियों के बीच युक्तियां परिवर्तित करें । ठीक 5 मिनट के लिए कमरे के तापमान पर मशीन ।
    8. 5 मिनट के बाद, प्रतिक्रिया को रोकने के लिए, एक मल्टीचैनल पिपेट का उपयोग करने के लिए नमूने की प्रत्येक पंक्ति में २५० µ एम ethylenediaminetetraacetic एसिड (EDTA) के 6 µ एल जोड़ने के लिए और ऊपर और नीचे कुछ समय मिश्रण । पंक्तियों के बीच युक्तियां परिवर्तित करें । इसके अलावा EDTA के बाद, पिपेट की सेटिंग स्विच करने के लिए 20 µ l और मिश्रण 10 बार ऊपर और नीचे pipetting द्वारा पाचन प्रतिक्रिया का एक पूरा रोकने के आश्वासन देने के लिए. पंक्तियों के बीच युक्तियां परिवर्तित करें ।
    9. एक मल्टीचैनल पिपेट का प्रयोग, MNase पचा नमूनों की प्रत्येक पंक्ति के लिए, 10x lysis बफर के 6 µ एल जोड़ें और pipetting द्वारा अच्छी तरह से ऊपर और नीचे 10 बार मिश्रण । एक प्लास्टिक सील के साथ कवर और 15 मिनट के लिए बर्फ पर गर्मी ।
  3. इनपुट पृथक्करण और पूर्व समाशोधन
    1. 15 मिनट की मशीन के बाद, बर्फ पर काम कर रहे, एक ही सेल गोली के लिए सभी कुओं पूल/एक बाँझ, पूर्व में बर्फ पर ठंडा, १.५ मिलीलीटर ट्यूब (पूर्व टेंपलेट आईडी के साथ लेबल) और अच्छी तरह से मिश्रण है, लेकिन धीरे से एक पिपेट का उपयोग कर डिटर्जेंट फोम से बचने के लिए ।
    2. प्रत्येक सेल गोली के लिए/टेंपलेट, एक नया बाँझ, ०.५ मिलीलीटर ट्यूब में पच क्रोमेटिन के 8 µ एल हस्तांतरण (पूर्व-टेम्पलेट आईडी के साथ लेबल), और 4 डिग्री सेल्सियस पर रात भर की दुकान. यह इनपुट नियंत्रण के रूप में कार्य करेगा ।
    3. ४८ µ l aliquots में डाइजेस्टेड क्रोमेटिन की शेष मात्रा को एक नए ९६-वेल प्लेट में वितरित करें । सेल गोली/1 कुओं में चला जाता है A01-A06, सेल गोली/2 कुओं A07-A12, आदिमें चला जाता है । एक टेंपलेट कुंजी को कुओं रिकॉर्ड । प्लेट लेबल "पूर्व समाशोधन" ।
    4. एक मल्टीचैनल पिपेट का उपयोग करना, कदम 2.3.3 से पूर्व समाशोधन प्लेट के प्रत्येक अच्छी तरह से धोया प्रोटीन एक (या जी) चुंबकीय मोती के १२० µ एल 1x आईपी बफर + 1x तस्वीर और 12 µ एल जोड़ें । प्रत्येक पंक्ति को ऊपर और नीचे 10 बार pipetting करके मिलाएं । पंक्तियों के बीच युक्तियां परिवर्तित करें । प्लेट सील बहुत अच्छी तरह से एक एल्यूमीनियम प्लेट कवर और 4 डिग्री सेल्सियस पर एक घूर्णन मंच पर 2 ज की एक ंयूनतम के लिए मशीन ।
  4. Immunoprecipitation प्रतिक्रिया
    1. इस चरण को शुरू करने से पहले सुनिश्चित करें कि अटल-मनका जटिल प्लेट (step 2.1.10) और प्री क्लियरिंग प्लेट (step 2.3.4) में कम से 2 h. क्विक स्पिन दोनों प्लेटों के लिए २०० x पर 10 एस के लिए मशीन है ।
    2. एक प्लेट चुंबक पर अटल-मनका जटिल प्लेट (कदम 2.1.10 से) प्लेस और समाधान स्पष्ट हो के लिए 15 एस प्रतीक्षा करें । ध्यान से हटाने और मोतियों को परेशान किए बिना एक पिपेट का उपयोग कर supernatant त्यागें । प्लेट चुंबक से प्लेट निकालकर बर्फ पर रखें ।
    3. एक प्लेट चुंबक पर (कदम 2.3.4 से) पूर्व समाशोधन प्रतिक्रिया प्लेट प्लेस और अलग करने के लिए और समाधान के लिए स्पष्ट हो मोतियों के लिए 15 एस प्रतीक्षा करें । मोतियों को परेशान किए बिना, ध्यान से एक पिपेट का उपयोग कर supernatant स्थानांतरण एबी के इसी कुएँ-मनका जटिल प्लेट बर्फ पर रखा और धीरे से मिश्रण 15 बार ऊपर और नीचे pipetting. प्लेट अच्छी तरह से सील एक एल्यूमीनियम प्लेट कवर के साथ और एक घूर्णन मंच पर 4 डिग्री सेल्सियस पर रात भर (12-18 ज) गर्मी । प्लेट "आईपी रिएक्शन" फिर से लेबल ।

3. DAY 2: ndCHIP-seq

  1. बहाकर और रेफरेंस
    1. ६५ ° c के लिए हीटिंग मिक्सर सेट करें । बर्फ पर, एक कम नमक धोने बफर और उच्च नमक धोने बफर तैयार करते हैं । त्वरित २०० एक्स जी पर 10 एस के लिए कदम 2.4.3 से आईपी रिएक्शन प्लेट स्पिन
    2. एक प्लेट चुंबक पर आईपी रिएक्शन प्लेट प्लेस और समाधान के लिए 15 एस प्रतीक्षा स्पष्ट हो जाते हैं । एक मल्टीचैनल पिपेट का प्रयोग, मोतियों को परेशान किए बिना, ध्यान से हटाने और supernatant को त्यागें । थाली चुंबक से थाली ले लो और यह बर्फ पर जगह है ।
    3. आईपी रिएक्शन प्लेट में नमूनों की प्रत्येक पंक्ति के लिए, बर्फ ठंड कम नमक धोने बफर के १५० µ एल जोड़ें और धीरे से 10 बार ऊपर और नीचे करने के लिए पूरी तरह से reसस्पेंड मोतियों का मिश्रण ।
    4. आईपी रिएक्शन प्लेट वापस प्लेट चुंबक पर रखें, मोतियों को अलग करने के लिए प्रतीक्षा करें, और एक मल्टीचैनल पिपेट का उपयोग कर, मोतियों को हटाने और supernatant त्यागने के बिना । प्लेट बर्फ पर वापस प्लेस और दोहराएं कदम 3.1.3 और 3.1.4 के कुल के लिए 2 बहाकर ।
    5. बर्फ पर, आईपी रिएक्शन प्लेट में नमूनों की प्रत्येक पंक्ति के लिए, उच्च नमक धोने बफर के १५० µ एल जोड़ने के लिए और ऊपर और नीचे pipetting द्वारा धीरे से 10 बार मिश्रण को पूरी तरह से reसस्पेंड ।
    6. आईपी रिएक्शन प्लेट वापस प्लेट चुंबक पर रखें, मोतियों को अलग करने के लिए प्रतीक्षा करें, और एक मल्टीचैनल पिपेट का उपयोग कर, मोतियों को हटाने और supernatant त्यागने के बिना । बर्फ पर आईपी रिएक्शन प्लेट प्लेस और पूर्व ठंडा एक नया ९६ यह बगल में अच्छी तरह से थाली ।
    7. आईपी रिएक्शन प्लेट में नमूनों की प्रत्येक पंक्ति के लिए, उच्च नमक धोने बफर के १५० µ एल जोड़ने के लिए और ऊपर और नीचे pipetting द्वारा धीरे से 10 बार मिश्रण को पूरी तरह से reसस्पेंड । resuspension के बाद, नमूनों की प्रत्येक पंक्ति नए, पूर्व ठंडा, ९६-अच्छी तरह से प्लेट की इसी पंक्ति में स्थानांतरण । लेबल प्लेट "आईपी रिएक्शन" । पुरानी थाली को त्याग दें ।
    8. प्लेट चुंबक पर नए आईपी रिएक्शन प्लेट प्लेस और मोतियों के लिए अलग करने के लिए प्रतीक्षा करें । एक मल्टीचैनल पिपेट का प्रयोग, मोतियों को परेशान किए बिना, ध्यान से हटाने और supernatant को त्यागें । प्लेट को कमरे के तापमान पर रखें ।
    9. आईपी रिएक्शन प्लेट में नमूनों की प्रत्येक पंक्ति के लिए, चिप रेफरेंस बफर के 30 µ एल जोड़ें (EB) और ऊपर और नीचे pipetting द्वारा धीरे से 10 बार मिश्रण । बुलबुला गठन को रोकने के लिए सुनिश्चित करें.
    10. प्लेट एक पीसीआर कवर के साथ अच्छी तरह से सील और १,३५० rpm की एक मिश्रण की गति के साथ १.५ एच के लिए ६५ डिग्री सेल्सियस पर एक हीटिंग मिक्सर में गर्मी ।
    11. १.५ ज की मशीन के बाद, 4 डिग्री सेल्सियस पर 1 मिनट के लिए २०० x g पर आईपी रिएक्शन प्लेट नीचे स्पिन । ५० ° c करने के लिए हीटिंग मिक्सर की सेटिंग बदलें ।
    12. स्पिन के बाद, एक प्लेट चुंबक पर आईपी रिएक्शन प्लेट जगह और समाधान के लिए स्पष्ट करने के लिए प्रतीक्षा करें । एक मल्टीचैनल पिपेट का प्रयोग, मोती परेशान बिना, ध्यान से एक नया ९६-अच्छी तरह से थाली में supernatant के 30 µ एल हस्तांतरण । प्रत्येक पंक्ति के लिए ताजा सुझावों का उपयोग करें । प्लेट लेबल "आईपी रिएक्शन" और यह कमरे के तापमान पर रहते हैं ।
  2. प्रोटीन पाचन
    1. पुनः प्राप्त 30% खूंटी/1 एम NaCl चुंबकीय मनका17 (बफर संरचना तालिका) 4 ° c रेफ्रिजरेटर से समाधान और यह कम से कम 30 मिनट के लिए कमरे के तापमान पर रखने के लिए महत्वपूर्ण: सुनिश्चित करें कि मनका समाधान आगे बढ़ने से पहले कमरे के तापमान तक पहुंचता है ।
    2. 4 डिग्री सेल्सियस भंडारण (कदम 2.3.2) और त्वरित स्पिन से इनपुट नियंत्रण नमूने प्राप्त करें । एक पिपेट का उपयोग कर मात्रा को मापने और 30 µ के एक अंतिम मात्रा के लिए प्रत्येक इनपुट नियंत्रण के लिए ultrapure पानी जोड़ने एल आईपी रिएक्शन प्लेट (चरण 3.1.12) में पूर्व चयनित इनपुट वेल्स (खाली कुओं) के लिए इनपुट नियंत्रण नमूने स्थानांतरित. नमूना कुंजी के लिए अच्छी तरह से रिकॉर्ड है ।
    3. बर्फ पर, प्रोटीन पाचन मास्टर मिश्रण तैयार के रूप में तालिका 5 और एक ९६-अच्छी तरह से जलाशय प्लेट की एक पंक्ति में बराबर मात्रा aliquot में दिखाया गया है ।
    4. एक मल्टीचैनल पिपेट का उपयोग करना, आईपी रिएक्शन प्लेट में नमूनों की प्रत्येक पंक्ति के लिए, प्रोटीन पाचन मास्टर मिश्रण के ४० µ एल जोड़ें और धीरे से 10 बार ऊपर और नीचे मिश्रण । प्लेट एक पीसीआर कवर के साथ अच्छी तरह से सील, 1 मिनट के लिए २०० एक्स जी में नीचे स्पिन, और ६५० rpm पर सेट 30 मिनट के लिए ५० डिग्री सेल्सियस पर एक हीटिंग मिक्सर में गर्मी । जबकि थाली मशीन है, ताजा ७०% इथेनॉल (ेतोः) तैयार है और यह कमरे के तापमान पर रहते हैं ।
    5. 30 मिनट की मशीन के बाद पूरा हो गया है, 1 मिनट, 4 डिग्री सेल्सियस के लिए २०० एक्स जी में आईपी रिएक्शन प्लेट स्पिन । प्लेट को कमरे के तापमान पर रखें ।
      नोट: कुल मात्रा अब होना चाहिए ~ ७० µ l/
  3. मनका साफ-अप का उपयोग कर 30% खूंटी/1 एम NaCl चुंबकीय मनका समाधान
    1. Aliquot के कमरे का तापमान 30% खूंटी/1 एम NaCl चुंबकीय मनका समाधान की एक पंक्ति में एक साफ ९६-अच्छी तरह से जलाशय प्लेट (७५ µ एल प्रति नमूना x # पंक्तियों की) ।
    2. कमरे के तापमान पर कार्य करना, एक मल्टीचैनल पिपेट का उपयोग करना, ७० µ एल जोड़ें (1:1 अनुपात) 30% खूंटी/1 एम NaCl चुंबकीय मनका समाधान आईपी रिएक्शन प्लेट में नमूनों की प्रत्येक पंक्ति के लिए और मिश्रण 10 बार pipetting द्वारा ऊपर और नीचे । पंक्तियों के बीच युक्तियां परिवर्तित करें । कमरे के तापमान पर 15 मिनट के लिए थाली मशीन ।
    3. प्लेट चुंबक पर थाली प्लेस और 5 मिनट के लिए मशीन मोतियों की अनुमति के लिए अलग ।
    4. एक पिपेट का उपयोग करना, मोतियों को परेशान किए बिना, ध्यान से निकालें और supernatant को त्यागें । मोतियों को रखो ।
    5. जबकि आईपी रिएक्शन प्लेट अभी भी प्लेट चुंबक पर है, एक मल्टीचैनल पिपेट का उपयोग कर, नमूनों की प्रत्येक पंक्ति के लिए, कमरे के तापमान ७०% ेतोः के १५० µ एल जोड़ने और 30 एस के लिए मशीन । 30 एस के बाद, एक मल्टीचैनल पिपेट का उपयोग कर, हटाने और supernatant त्यागें । इस चरण को एक बार में कुल 2 धुल के लिए दोहराएं ।
    6. दूसरा ेतोः धोने के बाद, 3 मिनट के लिए प्लेट चुंबक पर ' सूखी ' थाली गर्मी. नेत्रहीन प्लेट का निरीक्षण करने के लिए सुनिश्चित करें कि सभी ेतोः काफूर है । यदि नहीं, तो 1 मिनट के लिए थाली मशीन पर-एक कम उपज में मोतियों का परिणाम सूख ।
    7. प्लेट चुंबक से थाली ले लो और एक मल्टीचैनल पिपेट का उपयोग कर, ३५ µ l EB (सामग्री की तालिका) जोड़ें । 10 बार ऊपर और नीचे pipetting करके अच्छी तरह मिलाएं । पंक्तियों के बीच युक्तियां परिवर्तित करें । elute के लिए 3 मिनट के लिए कमरे के तापमान पर मशीन ।
    8. मशीन के बाद, जगह आईपी प्रतिक्रिया प्लेट वापस प्लेट चुंबक पर और 2 मिनट के लिए मशीन । मोतियों को अलग करना चाहिए और समाधान साफ हो जाएगा ।
    9. एक मल्टीचैनल पिपेट का प्रयोग, मोतियों को परेशान किए बिना, ध्यान से एक नया ९६-अच्छी तरह से थाली के इसी कुएं में supernatant हस्तांतरण ।
    10. एक एल्यूमीनियम प्लेट कवर, लेबल "आयपेड + इनपुट डीएनए" के साथ प्लेट सील, और 4 डिग्री सेल्सियस पर रात भर, या लंबी अवधि (> 48 एच) भंडारण के लिए-20 डिग्री सेल्सियस पर स्टोर ।

4. DAY 3: पुस्तकालय निर्माण

  1. अंत मरंमत और फास्फारिलीकरण
    1. अंत मरंमत/फास्फारिलीकरण प्रतिक्रिया के लिए इनपुट चरण 3.3.10 से आयपेड + इनपुट प्लेट है । गल जाने के बाद, प्लेट को 4 डिग्री सेल्सियस पर 1 मिनट के लिए २०० x g पर नीचे स्पिन करें और बर्फ पर रखें ।
    2. से पुनर्प्राप्त करें-20 ° c फ्रीजर (एंजाइमों को छोड़कर) अंत मरंमत के लिए आवश्यक (तालिका 6) और कमरे के तापमान पर उन्हें गल, तो तुरंत बर्फ के लिए स्थानांतरण ।
    3. बर्फ पर कार्य करना, तालिका 6 का पालन करें अंत मरंमत सेट करने के लिए/फास्फारिलीकरण मास्टर मिक्स एक बाँझ, १.५ मिलीलीटर microcentrifuge ट्यूब में । गैर के सभी के अलावा-एंजाइम घटकों के बाद, अच्छी तरह से नाड़ी से मिश्रण-भंवर और ट्यूब वापस बर्फ पर जगह है ।
    4. उनके ठंडे भंडारण और एक ठंडा ट्यूब शांत रैक में बेंच करने के लिए परिवहन से प्रासंगिक एंजाइमों निकालते हैं । ट्यूब, त्वरित स्पिन फ़्लिक करके प्रत्येक एंजाइम मिश्रण है, और यह ठंडा ट्यूब शांत रैक में वापस जगह है । जब एंजाइम pipetting, महाप्राण धीरे एक सटीक मात्रा हस्तांतरण आश्वासन देने के लिए । इसके अलावा, मास्टर मिश्रण में pipetting ऊपर और नीचे से टिप धो लो ।
    5. एक बार एंजाइमों जोड़ रहे हैं, धीरे पल्स भंवर मास्टर मिश्रण 5 बार सभी घटकों के एक भी वितरण आश्वासन देने के लिए, तो जल्दी स्पिन और तुरंत बर्फ पर ट्यूब वापस जगह.
    6. बर्फ पर, एक नई ९६-अच्छी तरह से जलाशय प्लेट की एक पंक्ति में अंत मरंमत/फास्फारिलीकरण मास्टर मिश्रण का एक उचित मात्रा aliquot; aliquoted होने के लिए खंड: (15 µ l x # पंक्तियों की) + 5 µ l मृत मात्रा । दो पंक्तियों के लिए एक उदाहरण परिकलन: (15 µ l x 2) + 5 µ l = ३५ µ l/ठीक है ।
    7. एक मल्टीचैनल पिपेट का प्रयोग, अंत की मरंमत के 15 µ एल जोड़ें/फास्फारिलीकरण मास्टर मिश्रण नमूनों की प्रत्येक पंक्ति के लिए और मिश्रण 10 बार ऊपर और नीचे pipetting द्वारा । पंक्तियों के बीच युक्तियां परिवर्तित करें । एक प्लास्टिक कवर के साथ प्लेट सील, 4 डिग्री सेल्सियस पर 1 मिनट के लिए २०० एक्स जी में नीचे स्पिन, और 30 मिनट के लिए कमरे के तापमान पर गर्मी ।
  2. मनका साफ-अंत मरंमत और फास्फारिलीकरण के बाद
    1. 4 डिग्री सेल्सियस रेफ्रिजरेटर से, 20% खूंटी/1 एम NaCl चुंबकीय मनका समाधान और 30% खूंटी/1 एम NaCl समाधान और कमरे के तापमान पर कम से कम 30 मिनट के लिए मशीन को पुनः प्राप्त करें ।
      नोट: 30% खूंटी/1 एम NaCl समाधान चुंबकीय मोतियों को शामिल नहीं करता है ।
    2. के बाद दोनों समाधान तक पहुंचने के कमरे के तापमान, प्रत्येक नमूने के लिए तैयार ८० µ एल के 1:2 मिश्रण की 30% खूंटी/1 m NaCl और 20% खूंटी/1 एम NaCl चुंबकीय मनका समाधान । 24 नमूनों के लिए एक उदाहरण: ८० µ l x 24 = १,९२० µ l (६४० µ l की 30% खूंटी/1 एम NaCl और १,२८८ µ एल के 20% पेग/1 एम NaCl चुंबकीय मनका समाधान) ।
    3. Aliquot मनका समाधान मिश्रण, बराबर मात्रा, एक ९६-अच्छी तरह से जलाशय प्लेट की एक पंक्ति में और यह कमरे के तापमान पर रखने के लिए । Aliquot EB बफर (४० µ एल प्रति नमूना x # पंक्तियों की) एक साफ ९६-अच्छी तरह से जलाशय प्लेट की एक पंक्ति में । दो पंक्तियों के लिए एक उदाहरण: ४० µ l x 2 = ८० µ l/
    4. एक मल्टीचैनल पिपेट का प्रयोग, कदम 4.1.7 से नमूनों की प्रत्येक पंक्ति में 4.2.2 चरण में तैयार मनका मिश्रण के ७५ µ एल जोड़ें और ऊपर और नीचे 10 बार मिश्रण । पंक्तियों के बीच युक्तियां परिवर्तित करें । 15 मिनट के लिए कमरे के तापमान पर मशीन मनका साफ-अप प्रक्रिया के रूप में कदम 3.3.3-3.3.10 में उल्लिखित के साथ जारी रखें । एक प्लास्टिक सील, जल्दी स्पिन के साथ प्लेट को कवर और बर्फ पर जगह है । ४.३ चरण के लिए आगे बढ़ें ।
  3. A-पुच्छ प्रतिक्रिया
    1. से पुनः प्राप्त-20 ° c फ्रीजर (एंजाइमों को छोड़कर) के सभी एक पूंछ प्रतिक्रिया (तालिका 7) के लिए आवश्यक), उन्हें कमरे के तापमान पर गल तो तुरंत बर्फ के लिए स्थानांतरण.
    2. बर्फ पर कार्य करना, तालिका 7 का पालन करें एक बाँझ, १.५ मिलीलीटर microcentrifuge ट्यूब में एक पूंछ मास्टर मिश्रण स्थापित करने के लिए । सामान्य एंजाइमी काढ़ा सेटअप निर्देशों के रूप में चरणों 4.1.4-4.1.6 में उल्लिखित का पालन करें ।
    3. एक मल्टीचैनल पिपेट का प्रयोग, एक-पूंछ मास्टर मिश्रण के 15 µ एल नमूने की प्रत्येक पंक्ति को जोड़ने और ऊपर और नीचे pipetting द्वारा 10 बार मिश्रण । पंक्तियों के बीच युक्तियां परिवर्तित करें । एक पीसीआर कवर के साथ प्लेट सील, 4 डिग्री सेल्सियस पर 1 मिनट के लिए २०० एक्स जी में नीचे स्पिन, और 30 मिनट के लिए ३७ डिग्री सेल्सियस पर एक thermocycler में मशीन । मशीन के बाद, 1 मिनट के लिए २०० x g पर प्लेट नीचे स्पिन और यह कमरे के तापमान पर रहते हैं ।
  4. मनका साफ-एक के बाद पूंछ
    1. चरण ४.२ में वर्णित चरणों को पूरा करें । एक प्लास्टिक सील के साथ प्लेट को कवर, लेबल "a-पूंछ + ई. पू.", त्वरित स्पिन, और यह बर्फ पर जगह है । ४.५ चरण के लिए आगे बढ़ें ।
  5. एडेप्टर बंधाव
    1. -20 डिग्री सेल्सियस फ्रीजर से पुनः प्राप्त (एंजाइमों को छोड़कर) एडाप्टर बंधाव प्रतिक्रिया (तालिका 8) के लिए आवश्यक) के सभी, उन्हें कमरे के तापमान पर गल तो तुरंत बर्फ के लिए स्थानांतरण.
    2. पुनर्प्राप्त 10 µ एम पीई अनुकूलक (पूरक तालिका 1) स्टॉक समाधान और पतला करने के लिए ०.५ µ m का उपयोग कर EB. नाड़ी भंवर से अच्छी तरह मिलाएं । आवश्यक मात्रा 3 µ l x # नमूनों की है । बर्फ पर काम करना, aliquot ०.५ µ एम पीई अनुकूलक, बराबर मात्रा, एक साफ ९६ के 12 कुओं में अच्छी तरह से जलाशय प्लेट । इसे बर्फ पर रखें ।
    3. बर्फ पर कार्य करना, एक बाँझ, १.५ मिलीलीटर microcentrifuge ट्यूब में एडाप्टर बंधाव मास्टर मिश्रण सेट करने के लिए तालिका 8 का पालन करें । सामान्य एंजाइमी काढ़ा सेटअप निर्देशों के रूप में चरणों 4.1.4-4.1.6 में उल्लिखित का पालन करें । सुनिश्चित करें कि 5x त्वरित बंधाव बफर पूरी तरह से गल गया है और बहुत अच्छी तरह से उपयोग करने से पहले मिलाया ।
    4. बर्फ पर, एक नया ९६-अच्छी तरह से जलाशय प्लेट की एक पंक्ति में अनुकूलक बंधाव मास्टर मिश्रण का एक उचित मात्रा aliquot । उदाहरण के लिए, दो पंक्तियों के लिए परिकलन: (23 µ l x 2) + 5 µ l = ५१ µ l/ बर्फ पर प्लेट रखें ।
    5. एक मल्टीचैनल पिपेट का उपयोग कर, चरण निमा और मिश्रण से नमूनों की प्रत्येक पंक्ति में ०.५ µ मीटर युग्मित अंत (पीई) एडाप्टर के 2 µ एल जोड़ें । पंक्तियों के बीच युक्तियां परिवर्तित करें ।
    6. एक मल्टीचैनल पिपेट का प्रयोग, एडाप्टर बंधाव मास्टर मिश्रण के 23 µ एल नमूने की प्रत्येक पंक्ति को जोड़ने और 15 बार ऊपर और नीचे pipetting द्वारा मिश्रण । पंक्तियों के बीच युक्तियां परिवर्तित करें । एक धातु कवर के साथ प्लेट सील, लेबल "बंधाव", 4 डिग्री सेल्सियस पर 1 मिनट के लिए २०० x g पर नीचे स्पिन, और कमरे के तापमान पर रात भर में गर्मी ।
  6. 4 दिन: मनका साफ #1 एडेप्टर बंधाव के बाद
    1. 4 डिग्री सेल्सियस रेफ्रिजरेटर से, 20% खूंटी/1 एम NaCl चुंबकीय मनका समाधान और कम से कम 30 मिनट के लिए कमरे के तापमान पर मशीन पुनः प्राप्त । जबकि समाधान ताजा ७०% ेतोः तैयार equilibrating है ।
    2. Aliquot 20% खूंटी/1 एम NaCl चुंबकीय मनका समाधान, नमूना प्रति ५५ µ एल, एक ९६ अच्छी तरह से जलाशय प्लेट की एक पंक्ति में और यह कमरे के तापमान पर रहते हैं । दो पंक्तियों के लिए एक उदाहरण: ५५ µ l x 2 = ११० µ l/
    3. Aliquot EB बफर, नमूना प्रति ५० µ एल, एक साफ ९६ की एक पंक्ति में अच्छी तरह से जलाशय प्लेट । दो पंक्तियों के लिए एक उदाहरण: ५० µ l x 2 = १०० µ l/
    4. एक मल्टीचैनल पिपेट का प्रयोग, 20% खूंटी के ४८ µ एल जोड़ें/1 एम NaCl चुंबकीय मनका समाधान बंधाव प्लेट में नमूनों की प्रत्येक पंक्ति में कदम 4.5.6 से और ऊपर और नीचे 10 बार मिश्रण । पंक्तियों के बीच युक्तियां परिवर्तित करें । 15 मिनट के लिए कमरे के तापमान पर मशीन मनका साफ-अप प्रक्रिया के रूप में कदम 3.3.3-3.3.7 में उल्लिखित के साथ जारी रखें ।
    5. प्लेट चुंबक से थाली ले लो और एक मल्टीचैनल पिपेट का उपयोग कर, ४५ µ l EB (सामग्री की तालिका) जोड़ें । 10 बार ऊपर और नीचे pipetting करके अच्छी तरह मिलाएं । पंक्तियों के बीच युक्तियां परिवर्तित करें । elute के लिए 3 मिनट के लिए कमरे के तापमान पर के लिए मशीन ।
    6. मशीन के बाद, आईपी रिएक्शन प्लेट पर वापस प्लेट चुंबक और 2 मिनट के लिए गर्मी की जगह. एक मल्टीचैनल पिपेट का उपयोग कर, मोतियों को परेशान किए बिना, ध्यान से एक नया ९६-अच्छी तरह से प्लेट के इसी कुएं में supernatant हस्तांतरण । प्लेट लेबल "बंधाव + 1 BC" ।
    7. प्रत्येक अच्छी तरह से 10x पीसीआर उच्च निष्ठा बफर के 5 µ एल जोड़ने के लिए और ऊपर और नीचे pipetting द्वारा अच्छी तरह से मिश्रण । पंक्तियों के बीच युक्तियां परिवर्तित करें । एक प्लास्टिक सील, जल्दी स्पिन के साथ थाली को कवर, और यह कमरे के तापमान पर रहते हैं ।
  7. मनका साफ #2 एडेप्टर बंधाव के बाद
    1. के रूप में निंनलिखित परिवर्तन के साथ धारा ४.६ में वर्णित मनका साफ-अप करें: जोड़ें ६० 20% खूंटी के µ एल/1 एम NaCl चुंबकीय मनका समाधान बंधाव में प्रत्येक सक्रिय अच्छी तरह से + 1 ईसा पूर्व प्लेट (कदम 4.6.7) और मोतियों से elute का उपयोग µ बफर के ३५ EB एल । थाली लेबल "बंधाव + 2 BC" और यह बर्फ पर रखो ।
  8. पीसीआर प्रवर्धन
    1. -20 डिग्री सेल्सियस फ्रीजर से पुनर्प्राप्त करें सभी रिएजेंट (एंजाइमों को छोड़कर) पीसीआर प्रतिक्रिया (तालिका 9) के लिए आवश्यक है, उन्हें कमरे के तापमान पर गल तो तुरंत बर्फ पर उन्हें जगह.
    2. बर्फ पर कार्य करना, तालिका 9 का पालन करें एक बाँझ, १.५ मिलीलीटर microcentrifuge ट्यूब में पीसीआर मास्टर मिश्रण स्थापित करने के लिए । सामान्य काढ़ा सेट-अप निर्देशों के रूप में चरणों 4.1.4-4.1.5 में उल्लिखित का पालन करें । बर्फ पर, एक नया ९६-अच्छी तरह से जलाशय प्लेट की एक पंक्ति में पीसीआर मास्टर मिश्रण की एक उपयुक्त मात्रा aliquot । इसे बर्फ पर रखें । नमूना परिकलन के लिए चरण 4.5.4 देखें ।
    3. बर्फ पर काम करना, एक मल्टीचैनल पिपेट का उपयोग करना, प्रत्येक अद्वितीय १२.५ µ मीटर पीसीआर रिवर्स अनुक्रमण प्राइमर (पूरक तालिका 2) में से 2 µ एल जोड़ें) बंधाव + 2 बीसी प्लेट (स्टेप 4.7.1) में एक अच्छी तरह से और धीरे ऊपर और नीचे मिश्रण. पंक्तियों के बीच युक्तियां परिवर्तित करें । बर्फ पर प्लेट रखें ।
    4. बर्फ पर काम करना, एक मल्टीचैनल पिपेट का उपयोग करना, चरण 4.8.3 से नमूनों की प्रत्येक पंक्ति में पीसीआर मास्टर मिश्रण के 23 µ एल जोड़ें और ऊपर और नीचे pipetting द्वारा 10 बार मिश्रण । एक पीसीआर कवर के साथ प्लेट सील, यह 1 मिनट के लिए २०० x g पर नीचे स्पिन, और एक thermocycler में मशीन (देखें पीसीआर सायक्लिंग शर्तों के लिए 10 तालिका ) ।
  9. मनका साफ-के बाद पीसीआर प्रवर्धन
    1. पीसीआर प्रवर्धन के बाद 1 मिनट, 4 डिग्री सेल्सियस के लिए २०० x g पर थाली स्पिन । के रूप में निंनलिखित परिवर्तन के साथ धारा ४.६ में वर्णित मनका साफ-अप करें: जोड़ें ५१ 20% खूंटी के µ एल/1 एम NaCl चुंबकीय मनका समाधान प्रत्येक पीसीआर प्रतिक्रिया करने के लिए और EB बफर के 25 µ एल का उपयोग मोतियों से elute । एक एल्यूमीनियम कवर के साथ प्लेट सील और 1 मिनट के लिए २०० x g पर नीचे स्पिन-20 डिग्री सेल्सियस पर नमूनों की दुकान.
    2. निर्माण पुस्तकालयों को मान्य करने के लिए, एक प्रतिदीप्ति आधारित परख का उपयोग डीएनए ठहराव प्रदर्शन, एक चिप आधारित केशिका ट्रो विश्लेषक (उच्च संवेदनशीलता परख) का उपयोग कर अंतिम उत्पाद कल्पना, और चलाने के संवर्धन मात्रात्मक पीसीआर (qPCR) (देखें प्रतिनिधि परिणाम, qPCR द्वारा ndChIP-seq पुस्तकालय गुणवत्ता की मांयता) ।

Representative Results

क्रोमेटिन पाचन प्रोफाइल
MNase पाचन का अनुकूलन इस प्रोटोकॉल की सफलता के लिए आवश्यक है । यह एक पाचन एक nucleosome टुकड़ा आकार का प्रभुत्व प्रोफ़ाइल उत्पंन महत्वपूर्ण है, जबकि अधिक नहीं पचा, उच्च क्रम nucleosome टुकड़े की वसूली के लिए अनुमति देते हैं । एक आदर्श पाचन प्रोफ़ाइल छोटे और एकल nucleosomes से बड़ा टुकड़े का प्रतिनिधित्व एक छोटा सा अंश के साथ एकल nucleosome टुकड़े के बहुमत के होते हैं । चित्र 1 एक आदर्श, अधिक-डाइजेस्ट, और इसके अंतर्गत डाइजेस्ट आकार वितरण प्रोफ़ाइल के उदाहरण दिखाता है । क्रोमेटिन के उप इष्टतम पाचन भी आईपी सामग्री (चित्रा 2) से उत्पन्न sequencing पुस्तकालय के प्रोफ़ाइल में स्पष्ट हो जाएगा कि ध्यान दें.

qPCR द्वारा ndChIP-seq पुस्तकालय की गुणवत्ता का सत्यापन
qPCR चिप18,19,20की गुणवत्ता के आकलन के लिए एक अच्छी तरह से स्थापित विधि है । १०,००० कोशिकाओं पर ndChIP-seq प्रदर्शन जब आईपी के बाद न्यूक्लिक एसिड की उपज 1 एनजी नीचे हो जाएगा । इसलिए, यह पृष्ठभूमि पर लक्ष्य क्षेत्रों के सापेक्ष संवर्धन का आकलन करने के लिए पुस्तकालय निर्माण के बाद qPCR प्रदर्शन करने के लिए आवश्यक है । एक पृष्ठभूमि अनुमान प्रदान करने के लिए, MNase पचता क्रोमेटिन (इनपुट) से निर्माण पुस्तकालयों उत्पन्न कर रहे हैं. प्रत्येक आईपी पुस्तकालय के लिए, प्राइमरों के दो सेट की जरूरत है (सामांय रूप से इस्तेमाल किया citrullinated के निशान के लिए प्राइमरों की एक सूची के लिए पूरकतालिका 3 देखें) । एक प्राइमर सेट एक जीनोमिक क्षेत्र है कि लगातार ब्याज की citrullinated संशोधन (सकारात्मक लक्ष्य) और अंय क्षेत्र है कि ब्याज की citrullinated संशोधन (नकारात्मक लक्ष्य) के साथ चिह्नित नहीं है के साथ जुड़ा हुआ है के लिए विशिष्ट होना चाहिए । चिप-seq पुस्तकालय की गुणवत्ता इनपुट पुस्तकालय के संबंध में गुना संवर्धन के रूप में मूल्यांकन किया जाएगा । गुना संवर्धन निम्नलिखित समीकरण है कि लक्ष्य जीनोमिक क्षेत्र के घातीय प्रवर्धन मान लिया गया है का उपयोग कर की गणना की जा सकती: 2सीटीइनपुट-सीटीआईपी। हमारे कस्टम आर सांख्यिकीय सॉफ्टवेयर पैकेज बनाया, 1.2 qcqpcr_v, कम इनपुट देशी चिप के qPCR संवर्धन विश्लेषण के लिए उपयुक्त है-seq पुस्तकालयों (पूरक कोड फ़ाइलें) । आरेख 3 सफल और असफल चिप-seq लायब्रेरीज़ के लिए एक qPCR परिणाम का प्रतिनिधित्व करता है । अच्छी गुणवत्ता ndChIP-seq पुस्तकालयों के लिए न्यूनतम उम्मीद गुना संवर्धन मूल्य, जैसे H3K4me3 के रूप में संकीर्ण निशान के लिए 16 हैं, और व्यापक निशान के लिए 7, उदाहरण के लिए H3K27me3.

मॉडलिंग MNase ऑप्शन्स
चिप-seq की गणना विश्लेषण जटिल और प्रत्येक प्रयोगात्मक सेटिंग के लिए अद्वितीय है । अंतरराष्ट्रीय मानव Epigenomic कंसोर्टियम (IHEC) और डीएनए तत्वों के विश्वकोश (सांकेतिक शब्दों में बदलना) द्वारा स्थापित दिशा निर्देशों का एक सेट चिप-seq पुस्तकालयों की गुणवत्ता का आकलन करने के लिए इस्तेमाल किया जा सकता है21. यह नोट करने के लिए महत्वपूर्ण है कि पुस्तकालयों के अनुक्रमण गहराई प्रभावों का पता लगाने और समृद्ध क्षेत्रों के संकल्प20. चोटियों की संख्या में वृद्धि का पता चला और दृष्टिकोण एक पठार के रूप में पढ़ें गहराई बढ़ जाती है । हम अनुशंसा करते है ndChIP-seq लायब्रेरी IHEC अनुशंसाओं के अनुसार अनुक्रम किया जा करने के लिए ५०,०००,००० युग्मित-पढ़ता (२५,०००,००० फ़्रेग्मेंट्स) के लिए संकीर्ण चिह्न (eg, H3K4me3) और १००,०००,००० युग्मित-पढ़ता (५०,०००,००० टुकड़े) के लिए व्यापक चिह्न ( उदा, H3K27me3) और इनपुट22. इन अनुक्रमण गहराई, संतृप्ति23,24तक पहुँचने के बिना व्यापक रूप से इस्तेमाल किया चिप seq पीक कॉलर, जैसे MACS2 और होमर का उपयोग कर सबसे महत्वपूर्ण चोटियों का पता लगाने के लिए पर्याप्त अनुक्रम संरेखण प्रदान करते हैं । एक उच्च गुणवत्ता स्तनधारी ndChIP-seq पुस्तकालय की एक पीसीआर की डुप्लिकेट दर है < 10% और संदर्भ जीनोम संरेखण दर की > ९०% (सहित डुप्लिकेट पुस्तकें) । सफल ndChIP-seq पुस्तकालयों उच्च संबंधित एक महत्वपूर्ण भाग के साथ दोहराने की प्रतिकृति (> ४०%) के साथ संरेखित करें MACS222 की पहचान की समृद्ध चोटियों और एक जीनोम ब्राउज़र पर पढ़ता के निरीक्षण नेत्रहीन प्रकट करना चाहिए इनपुट लाइब्रेरी की तुलना में detectable संवर्धनों (चित्रा 4) । इसके अलावा, ndChIP-seq एक गाऊसी मिश्रण वितरण एल्गोरिथ्म (w1 * n(xका उपयोग करके nucleosome घनत्व का आकलन करने के लिए इस्तेमाल किया जा सकता है; μ1,σ1) + w2 * n(x; μ2, σ2) = 1) MACS2 में MNase सुलभ सीमाओं द्वारा परिभाषित मॉडल nucleosome घनत्व के लिए समृद्ध क्षेत्रों की पहचान की । इस मॉडल में, डब्ल्यू1 मोनो nucleosome वितरण वजन और डब्ल्यू2 का प्रतिनिधित्व करता है di-nucleosome वितरण वजन का प्रतिनिधित्व करता है । डब्ल्यू1 जहां डब्ल्यू2से अधिक है, वहां मोनो nucleosome टुकड़े और इसके विपरीत के प्रभुत्व है । इस विश्लेषण की आवश्यकता है कि पुस्तकालयों एक युग्मित-अंत फैशन में अनुक्रम किया है ताकि टुकड़ा आकार परिभाषित किया जा सकता है । आदेश में गाऊसी मिश्रण वितरण एल्गोरिथ्म, सांख्यिकीय महत्वपूर्ण समृद्ध क्षेत्रों को लागू करने के लिए पहली बार पहचान की है । हम MACS2 के साथ एक नियंत्रण के रूप में इनपुट का उपयोग कर और संकीर्ण निशान के लिए डिफ़ॉल्ट सेटिंग्स और व्यापक निशान के लिए ०.०१ का q मान कटऑफ के साथ बुला पीक सुझाव देते हैं । सांख्यिकीय संकुल के एक नंबर एक गाऊसी मिश्रण वितरण एल्गोरिथ्म रोजगार व्यापक रूप से इस्तेमाल सांख्यिकीय सॉफ्टवेयर संकुल से उपलब्ध हैं । औसत टुकड़ा आकार का उपयोग, मीन्स द्वारा निर्धारित अंत आयपेड नमूनों की सीमाओं को पढ़ने, MACS2 की पहचान समृद्ध प्रमोटरों पर वितरण, और एक गाऊसी मिश्रण वितरण एल्गोरिथ्म आर सांख्यिकीय पैकेज का उपयोग कर प्रत्येक प्रमोटर के लिए लागू किया जा सकता Mclust संस्करण ३.०25 एक भारित वितरण की गणना करने के लिए । इस आवेदन में, हम 30 से कम संरेखित अंशों वाले प्रवर्तकों को नष्ट करने की अनुशंसा करते हैं क्योंकि इस सीमा से नीचे आने वाले वजन अनुमान अविश्वसनीय हो जाते हैं. एक अच्छी गुणवत्ता ndChIP-seq पुस्तकालय मोनो-, di-nucleosome टुकड़ा लंबाई के लिए इसी मतलब मूल्यों के साथ दो प्रमुख घटकों से मिलकर बनता है कि एक गाऊसी मिश्रण वितरण उत्पन्न करता है.

Figure 1
चित्र 1 : पुस्तकालय सृजन से पहले MNase पाचन का आकलन । एक इष्टतम MNase पच (A), के अंतर्गत पच (B), और अधिक पच (C) क्रोमेटिन की चिप आधारित केशिका ट्रो विश्लेषक प्रोफाइल । जैविक प्रतिकृति नीले, लाल, और हरे निशान के रूप में दिखाए जाते हैं । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्र 2 : पुस्तकालय निर्माण के बाद MNase पाचन का आकलन. (A) बेहतर पचा इनपुट के पोस्ट लाइब्रेरी निर्माण प्रोफाइल (जैविक प्रतिकृति; लाल, हरे, काले) और आईपी (जैविक प्रतिकृति; सियान, बैंगनी, नीला) और () उप इष्टतम इनपुट (जैविक प्रतिकृति; लाल, हरे, नीले) और आईपी ( जैविक प्रतिकृति; सियान, बैंगनी, नारंगी) पुस्तकालयों. कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 3
चित्र 3 : पोस्ट पुस्तकालय निर्माण मात्रात्मक पीसीआर ndChIP-seq पुस्तकालयों की गुणवत्ता का आकलन करने के लिए इस्तेमाल किया जा सकता है । इनपुट पुस्तकालयों के संबंध में H3K4me3 आईपी पुस्तकालयों के गुना संवर्धन qcqpcr_v 1.2 का उपयोग कर सकारात्मक और नकारात्मक लक्ष्यों के लिए 2(आईपी के सीटी की सीटी) के रूप में गणना की जाती है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 4
चित्र 4 : प्रतिनिधि ndChIP-seq पुस्तकालय १०,००० प्राथमिक CD34+ गर्भनाल रक्त कोशिकाओं से निर्माण किया । H3K4me3 संकेत के पियरसन सहसंबंध (पढ़ता है प्रति मिलियन मैप किए गए पढ़ता) 3 जैविक प्रतिकृतियां के बीच प्रवर्तकों (TSS +/-2Kb) में परिकलित, (A) 1 और 2 दोहराने, (B) प्रतिकृति 1 और 3, (C) दोहराने 2 और 3 । (D) UCSC के HOXA जीन क्लस्टर का ब्राउज़र दृश्य, प्रति ip १,०००,००० कक्षों से जेनरेट की गई चिप-seq, सफल ndChIP-seq प्रति ip से १०,००० कक्षों से उत्पंन, और ip प्रति १०,००० कक्षों से असफल ndChIP-seq । (लाल: H3K27me3, हरा: H3K4me3, और काला: इनपुट) । (E) H3K4me3 (काला) और H3K27me3 (धूसर) की MACS2 की पहचान वाले समृद्ध क्षेत्रों में मैप की गई पठन के अंश । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

बफ़र संरचना
A. 1. Immunoprecipitation बफर (आईपी)
20 एमएम Tris-एचसीएल नं० ७.५
2 मिमी EDTA
१५० मिमी NaCl
०.१% ट्राइटन एक्स-१००
०.१% Deoxycholate
10 मिमी सोडियम Butyrate
A. 2. कम नमक धोने बफर
20 एमएम Tris-एचसीएल नं० ८.०
2 मिमी EDTA
१५० मिमी NaCl
1% ट्राइटन एक्स-१००
०.१% एसडीएस
A. 3. उच्च नमक धोने बफर
20 एमएम Tris-एचसीएल नं० ८.०
2 मिमी EDTA
५०० मिमी NaCl
1% ट्राइटन एक्स-१००
०.१% एसडीएस
A. 4. चिप रेफरेंस बफर
१०० मिमी NaHCO3
1% एसडीएस
A. 5.1x Lysis बफर-1 मिलीलीटर
०.१% ट्राइटन
०.१% Deoxycholate
10 मिमी सोडियम Butyrate
A. 6. अब कमजोर पड़ने बफर
०.०५% (w/v) Azide
०.०५% व्यापक स्पेक्ट्रम रोगाणुरोधी (उदा. ProClin ३००)
पंजाब में
A. 7.30% खूंटी/1m NaCl चुंबकीय मनका समाधान (संदर्भ16)
30% खूंटी
१ मी NaCl
10 एमएम Tris एचसीएल नं० ७.५
1 मिमी EDTA
धोया सुपर paramagnetic मोतियों की 1 मिलीलीटर
A. 8.20% खूंटी/1m NaCl चुंबकीय मनका समाधान (संदर्भ16)
30% खूंटी
१ मी NaCl
10 एमएम Tris एचसीएल नं० ७.५
1 मिमी EDTA
धोया सुपर paramagnetic मोतियों की 1 मिलीलीटर

तालिका 1: ndChIP-seq बफ़र संरचना ।

citrullinated संशोधन एकाग्रता (µ g/µ l)
H3K4me3 ०.१२५
H3K4me1 ०.२५
H3K27me3 ०.१२५
H3K9me3 ०.१२५
H3K36me3 ०.१२५
H3K27ac ०.१२५

तालिका 2: ndChIP-seq के लिए आवश्यक एंटीबॉडी राशि ।

Reganet मात्रा (µ एल)
अल्ट्रा शुद्ध पानी ४७८
1 मीटर Tris-एचसीएल नं० ७.५ 10
०.५ एम EDTA 10
५ मीटर NaCl 2
ग्लिसरॉल ५००
कुल मात्रा १,०००

तालिका 3: MNase कमजोर पड़ने बफर के लिए नुस्खा ।

अभिकर्मक मात्रा (µ एल)
अल्ट्रा शुद्ध पानी 13
20 एमएम डीटीटी 1
10x MNase बफर 4
20 U/µ l Mnase 2
कुल मात्रा 20

तालिका 4: MNase मास्टर मिश्रण के लिए नुस्खा ।

अभिकर्मक मात्रा (µ एल)
रेफरेंस बफर 30
बफ़र G2 8
protease 2
कुल मात्रा ४०

तालिका 5: डीएनए शुद्धि मास्टर मिक्स के लिए नुस्खा ।

अभिकर्मक मात्रा (µ एल)
अल्ट्रा शुद्ध पानी ३.३
10x प्रतिबंध Endonuclease बफर (उदा NEBuffer) 5
25 एमएम एटीपी 2
10 एमएम dNTPs 2
टी-4 Polynucleotide कळेनासे (10 यू/µ एल) 1
टी-4 डीएनए पोलीमरेज़ (3 यू/µ एल) १.५
डीएनए पोलीमरेज़ I, बड़ा (Klenow) टुकड़ा (5 U/µ l) ०.२
कुल मात्रा 15

तालिका 6: अंत मरंमत मास्टर मिक्स के लिए नुस्खा ।

अभिकर्मक मात्रा (µ एल)
अल्ट्रा शुद्ध पानी 8
10x प्रतिबंध Endonuclease बफर (उदा NEBuffer) 5
10 एमएम dATP 1
Klenow (3 '-5 ' exo-) 1
कुल मात्रा 15

तालिका 7: एक-पूंछ मास्टर मिश्रण के लिए नुस्खा ।

अभिकर्मक मात्रा (µ एल)
अल्ट्रा शुद्ध पानी ४.३
5x त्वरित बंधाव बफर 12
टी-4 डीएनए ligase (२००० यू/µ एल) ६.७
कुल मात्रा 23

तालिका 8: अनुकूलक बंधाव मास्टर मिश्रण के लिए नुस्खा ।

अभिकर्मक मात्रा (µ एल)
अल्ट्रा शुद्ध पानी 7
25 उम पीसीआर प्राइमरी १.० 2
5x HF बफर 12
dmso १.५
डीएनए पोलीमरेज़ ०.५
कुल मात्रा 23

तालिका 9: पीसीआर मास्टर मिक्स के लिए नुस्खा ।

Temprature (° c) अवधि (s) चक्रों की संख्या
९८ ६० 1
९८ 30
६५ 15 10
७२ 15
७२ ३०० 1
4 पकड़ पकड़

तालिका 10: पीसीआर भागो विधि ।

oligo अनुक्रम संशोधन
PE_adapter १ 5 '-/5Phos/GAT CGG AAG AGC GGT टीसीए जीसीए GGA ATG CCG AG-3 ' 5 ' संशोधन: फास्फारिलीकरण
PE_adapter २ ५ '-ऐका सीटीसी TTT सीसीसी टीएसी ACG ACG सीटीसी टीटीसी CGA टीसी * टी-3 ' 3 ' संशोधन: * टी एक phosphorothioate बांड है

पूरक तालिका 1: पीई एडेप्टर की जनरेशन के लिए Oligo अनुक्रम ।

प्राइमरी का नाम अनुक्रम सूचकांक IndexRevC (sequencing के लिए उपयोग किया जा करने के लिए)
पीसीआर रिवर्स अनुक्रमण प्राइमर 1 CAAGCAGAAGACGGCATACGAGATCGTGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGTGAT atcacg
पीसीआर रिवर्स अनुक्रमण प्राइमर 2 CAAGCAGAAGACGGCATACGAGATCTGATCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTGATC gatcag
पीसीआर रिवर्स अनुक्रमण प्राइमर 3 CAAGCAGAAGACGGCATACGAGATGGGGTTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GGGGTT aacccc
पीसीआर रिवर्स अनुक्रमण प्राइमर 4 CAAGCAGAAGACGGCATACGAGATCTGGGTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTGGGT acccag
पीसीआर रिवर्स अनुक्रमण प्राइमर 5 CAAGCAGAAGACGGCATACGAGATAGCGCTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCGCT agcgct
पीसीआर रिवर्स अनुक्रमण प्राइमर 6 CAAGCAGAAGACGGCATACGAGATCTTTTGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CTTTTG caaaag
पीसीआर रिवर्स अनुक्रमण प्राइमर 7 CAAGCAGAAGACGGCATACGAGATTGTTGGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TGTTGG ccaaca
पीसीआर रिवर्स अनुक्रमण प्राइमर 8 CAAGCAGAAGACGGCATACGAGATAGCTAGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCTAG ctagct
पीसीआर रिवर्स अनुक्रमण प्राइमर 9 CAAGCAGAAGACGGCATACGAGATAGCATCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AGCATC gatgct
पीसीआर रिवर्स अनुक्रमण प्राइमर 10 CAAGCAGAAGACGGCATACGAGATCGATTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGATTA taatcg
पीसीआर रिवर्स अनुक्रमण प्राइमर 11 CAAGCAGAAGACGGCATACGAGATCATTCACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CATTCA tgaatg
पीसीआर रिवर्स अनुक्रमण प्राइमर 12 CAAGCAGAAGACGGCATACGAGATGGAACTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GGAACT agttcc
पीसीआर रिवर्स अनुक्रमण प्राइमर 13 CAAGCAGAAGACGGCATACGAGATACATCGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT ACATCG cgatgt
पीसीआर रिवर्स अनुक्रमण प्राइमर 14 CAAGCAGAAGACGGCATACGAGATAAGCTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT AAGCTA tagctt
पीसीआर रिवर्स अनुक्रमण प्राइमर 15 CAAGCAGAAGACGGCATACGAGATCAAGTTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CAAGTT aacttg
पीसीआर रिवर्स अनुक्रमण प्राइमर 16 CAAGCAGAAGACGGCATACGAGATGCCGGTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCCGGT accggc
पीसीआर रिवर्स अनुक्रमण प्राइमर 17 CAAGCAGAAGACGGCATACGAGATCGGCCTCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CGGCCT aggccg
पीसीआर रिवर्स अनुक्रमण प्राइमर 18 CAAGCAGAAGACGGCATACGAGATTAGTTGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TAGTTG caacta
पीसीआर रिवर्स अनुक्रमण प्राइमर 19 CAAGCAGAAGACGGCATACGAGATGCGTGGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCGTGG ccacgc
पीसीआर रिवर्स अनुक्रमण प्राइमर 20 CAAGCAGAAGACGGCATACGAGATGTATAGCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GTATAG ctatac
पीसीआर रिवर्स अनुक्रमण प्राइमर 21 CAAGCAGAAGACGGCATACGAGATCCTTGCCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT CCTTGC gcaagg
पीसीआर रिवर्स अनुक्रमण प्राइमर 22 CAAGCAGAAGACGGCATACGAGATGCTGTACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT GCTGTA tacagc
पीसीआर रिवर्स अनुक्रमण प्राइमर 23 CAAGCAGAAGACGGCATACGAGATATGGCACGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT ATGGCA tgccat
पीसीआर रिवर्स अनुक्रमण प्राइमर 24 CAAGCAGAAGACGGCATACGAGATTGACATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT TGACAT atgtca

पूरक तालिका 2: पीसीआर रिवर्स अनुक्रमण प्राइमर दृश्यों ।

प्राइमरों अनुक्रम
ZNF333_genic_H3K9me3_F 5 '-AGCCTTCAATCAGCCATCATCCCT-3 '
ZNF333_genic_H3K9me3_R 5 '-TCTGGTATGGGTTCGCAGATGTGT-3 '
HOXA9-10_F 5 '-ACTGAAGTAATGAAGGCAGTGTCGT-3 '
HOXA9-10_R 5 '-GCAGCAYCAGAACTGGTCGGTG-3 '
GAPDH_genic_H3K36me3_F 5 '-AGGCAACTAGGATGGTGTGG-3 '
GAPDH_genic_H3K36me3_R 5 '-TTGATTTTGGAGGGATCTCG-3 '
GAPDH-च 5 '-TACTAGCGGTTTTACGGGCG-3 '
GAPDH-R 5 '-TCGAACAGGAGGAGCAGAGAGCGA-3 '
citrullinated संशोधन सकारात्मक लक्ष्य नकारात्मक लक्ष्य
H3K4me3 gapdh HOXA9-10
H3K4me1 GAPDH_genic ZNF333
H3K27me3 HOXA9-10 ZNF333
H3K27ac gapdh ZNF333
H3K9me3 ZNF333 HOXA9-10
H3K36me3 GAPDH_genic ZNF333

पूरक तालिका 3: सामांयतः प्रयुक्त citrullinated चिह्नों के लिए प्राइमरों की एक सूची (H3K4me3, H3K4me1, H3K27me3, H3K27ac, H3K9me3, और H3K36me3) ।

पूरक फ़ाइल 1: ndChIP-seq कार्यपत्रक. इस फ़ाइल को डाउनलोड करने के लिए कृपया यहां क्लिक करें.

पूरक कोड फ़ाइलें: 1.2 qcqpcr_v. कम इनपुट देशी चिप-seq पुस्तकालयों के qPCR संवर्धन विश्लेषण के लिए आर सांख्यिकीय सॉफ्टवेयर पैकेज । इस फ़ाइल को डाउनलोड करने के लिए कृपया यहां क्लिक करें.

Discussion

क्रोमेटिन संशोधन और transcriptional विनियमन में nucleosome पोजीशनिंग की मिश्रित प्रकृति को देखते हुए, एक विधि है कि इन सुविधाओं के एक साथ माप सक्षम बनाता है epigenetic विनियमन में नए अंतर्दृष्टि प्रदान करने की संभावना है । ndChIP-seq प्रोटोकॉल यहां प्रस्तुत एक देशी चिप-seq दुर्लभ प्राथमिक कोशिकाओं में citrullinated संशोधन और nucleosome घनत्व के एक साथ पूछताछ को सक्षम करने के लिए अनुकूलित प्रोटोकॉल है9,10। ndChIP-seq क्रोमेटिन के एंजाइमी पाचन का इस्तेमाल करता है कि, जब युग्मित करने के लिए युग्मित अंत व्यापक समानांतर अनुक्रमण और एक गाऊसी मिश्रण वितरण मॉडल, एकल citrullinated स्तर पर जांच nucleosome संशोधनों के लिए अनुमति देता है और एक आबादी के भीतर विविधता द्वारा संचालित epigenomic प्रोफाइल का deconvolution । इस प्रोटोकॉल का उपयोग करते हुए, हमने पहले bliss-उपजी अंश आकारों का एक अद्वितीय वितरण रिपोर्ट किया है, जो कि ChromHMM10,24द्वारा परिभाषित विशिष्ट क्रोमेटिन राज्यों के साथ संबद्ध, युग्मित-अंत में पढ़ी गई सीमाओं द्वारा निर्धारित है ।

एक ndChIP-seq पुस्तकालय की गुणवत्ता एंटीबॉडी विशिष्टता और संवेदनशीलता, इष्टतम MNase पाचन शर्तों, और क्रोमेटिन की गुणवत्ता के रूप में कई कारकों पर निर्भर करता है । इस्तेमाल किया एंटीबॉडी की विशिष्टता सफल ndChIP-seq पुस्तकालय के उत्पादन में महत्वपूर्ण है । एक आदर्श एंटीबॉडी अंय epitopes के साथ थोड़ा पार जेट के साथ ब्याज की epitope के खिलाफ उच्च समानता से पता चलता है । यह पसंद के एंटीबॉडी के लिए सबसे अधिक अपनत्व के साथ चुंबकीय मोतियों का चयन करने के लिए समान रूप से महत्वपूर्ण है ।

MNase पाचन इस प्रोटोकॉल में एक महत्वपूर्ण और समय और एकाग्रता के प्रति संवेदनशील प्रतिक्रिया है । इसलिए, जब कई नमूनों प्रसंस्करण, यह महत्वपूर्ण है कि प्रत्येक प्रतिक्रिया समय की एक समतुल्य राशि के लिए मशीन है (चरण २.२ देखें) । क्रोमेटिन की गुणवत्ता एक और पहलू है कि काफी ndChIP के परिणाम प्रभाव-seq. खंडित क्रोमेटिन एक उप इष्टतम MNase पाचन प्रोफ़ाइल और परिणाम के लिए एक कम संकेत के साथ पुस्तकालयों में शोर अनुपात के लिए सुराग है । कम कोशिका व्यवहार्यता या नीचा क्रोमेटिन के साथ प्राथमिक नमूनों, जैसे formalin-फिक्स्ड आयल-एंबेडेड (FFPE) ऊतक इस प्रोटोकॉल के लिए अनुशंसित नहीं हैं ।

क्रोमेटिन निष्कर्षण के दौरान एक तस्वीर के अलावा अवांछित (अर्थात, यादृच्छिक) क्रोमेटिन विखंडन कम कर देता है और citrullinated पूंछ की अखंडता को बरकरार रखता है । जैसे, PIC lysis बफर और immunoprecipitation बफर बस का उपयोग करने से पहले करने के लिए जोड़ा जा करने की जरूरत है. जबकि फ्लो cytometry के माध्यम से कोशिकाओं का चयन, व्यवहार्य कोशिकाओं के लिए चयन करें और सुनिश्चित कोशिकाओं को एक कम प्रवाह की दर से हल कर रहे है कक्ष संख्या अनुमान और कोशिकाओं की व्यवहार्यता की सटीकता में वृद्धि हुई है । lysis बफ़र में सीधे कक्षों को सॉर्ट करने से बचें । म्यान बफर lysis बफर को पतला करेगा और MNase करने के लिए कोशिका झिल्ली के प्रभावी permeabilization को रोकता है । कोशिकाओं या जीव का एक प्रकार के आधार पर, MNase के अनुमापन इष्टतम पाचन प्राप्त करने के लिए आवश्यक हो सकता है ।

ndChIP-seq स्तनधारी कक्षों पर एक न्यूनतम sequencing गहराई ५०,०००,००० युग्मित-पढ़ता (२५,०००,००० अंशों) के लिए संकीर्ण चिह्न और १००,०००,००० युग्मित-पढ़ता (५०,०००,००० अंशों) के लिए व्यापक चिह्न और इनपुट की आवश्यकता है । गाऊसी मिश्रण वितरण एल्गोरिथ्म श्रेष्ठ रूप से इस अनुशंसा के नीचे एक गहराई के लिए अनुक्रम किया गया है जो लायब्रेरीज़ पर निष्पादित नहीं करेगा । ndChIP-seq मोनो के लिए भारित वितरण मूल्य के बीच थोड़ा जुदाई के साथ प्रमोटर वर्गीकृत नहीं होगा और di-nucleosome टुकड़ा लंबाई मोनो में या डि-nucleosome हावी प्रवर्तकों. इसलिए, इन प्रवर्तकों को बाद के विश्लेषण में निकाला जाना चाहिए । जैविक प्रतिकृति भविष्यवाणी वितरण में विश्वास बढ़ाने के लिए उत्पंन किया जा सकता है और MNase पाचन और पुस्तकालय निर्माण में तकनीकी परिवर्तनशीलता की पहचान ।

देशी चिप-seq प्रोटोकॉल की पिछले पुनरावृत्ति के विपरीत, ndChIP-seq क्रोमेटिन घनत्व को एकीकृत करने के लिए citrullinated संरचना और immunoprecipitation संशोधन के अंश आकार पोस्ट का उपयोग करके मिश्रित प्रभाव की जांच करने का साधन प्रदान करता है, citrullinated संशोधन मापन के साथ, MNase पहुँच द्वारा निर्धारित. प्राथमिक कोशिकाओं और ऊतकों को ndChIP-seq के आवेदन epigenetic विनियमन के एकीकृत प्रकृति में उपंयास अंतर्दृष्टि प्रदान करते है और जनसंख्या के भीतर विविधता के कारण epigenetic हस्ताक्षर की पहचान की अनुमति होगी ।

Disclosures

लेखकों की घोषणा है कि वे कोई प्रतिस्पर्धा वित्तीय हितों की है ।

Acknowledgements

अल कनाडा के स्वास्थ्य अनुसंधान के संस्थानों से स्नातक छात्रवृत्ति द्वारा समर्थित किया गया । इस काम के जीनोम ब्रिटिश कोलंबिया और कनाडा के Epigenetics, पर्यावरण और स्वास्थ्य अनुसंधान कंसोर्टियम पहल के भाग के रूप में स्वास्थ्य अनुसंधान के कनाडाई संस्थानों (CIHR-१२०५८९) से अनुदान द्वारा समर्थित किया गया था और टेरी फॉक्स अनुसंधान संस्थान के कार्यक्रम द्वारा परियोजना अनुदान #TFF-१२२८६९ को M.H. और एक टेरी फॉक्स अनुसंधान संस्थान के नए जांचकर्ता पुरस्कार (अनुदान # १०३९) को M.H.

Materials

Name Company Catalog Number Comments
1M Tris-HCl –pH 7.5 Thermo Scientific 15567-027
1M Tris-HCl –pH 8 Thermo Scientific 15568-025
0.5M EDTA Thermo Scientific AM9260G
5M NaCl Sigma 1001385276
Triton X-100 Sigma 1001412354
Sodium-Deoxycholate Sigma 1001437582
SDS Thermo Scientific 15525-017
Sodium-Bicarbonate Fisher Scientific S233-500
100% EtOH NA NA
V-bottom 96 well plate (AB 1400) Thermo Scientific AB-1400-L
Gilson P2 pipetman Mandel F144801
Gilson P10 pipetman Mandel F144802
Gilson P20 pipetman Mandel F123600
Gilson P100 pipetman Mandel F123615
Gilson P200 pipetman Mandel F123601
Gilson P1000 pipetman Mandel F123603
Micrococcal Nuclease  NEB M0247S
Thermo Mixer C (Heating block mixer) Eppendorf 5382000023
Multi 12-channel Pippet P20 Rainin 17013803
Multi 12-channel Pippet P200 Rainin 17013805
1.5 ml LoBind tube Eppendorf 22431021
0.5 ml LoBind tube Eppendorf 22431005
Plastic Plate Cover Edge Bio 48461
PCR cover Bio Rad MSD-1001
Aluminum Plate Cover Bio Rad MSF-1001
Elution buffer (EB buffer) Qiagen 19086
1M DTT Sigma 646563
Eppendorf 5810R centrifuge  Eppendorf 22625004
Ultrapure water Thermo Scientific 10977-015
Protein G dynabeads Thermo Scientific 10001D
Protein A dynabeads Thermo Scientific 10001D
Protease inhibitor Cocktail Calbiochem 539134
Rotating platform Mandel 1b109-12052010
Plate magnet Alpaqua 2523
Domed 12-cap strip Bio Rad TCS1201
Buffer G2 Qiagen 1014636
Protease Qiagen 19155
Tube Magnet (DynaMag-2) Thermo Scientific 12321D
Tube Magnet (DynaMag-2) LabCore 730-006
V shape Plastic reservoir Mandel S0100A
Vortex Mandel C1801
Mini Fuge Mettler Toledo XS2035
Analytical scale Mandel LB109-12052010
Quick Ligation Reaction Buffer, 5X NEB B6058S
DNA Polymerase I, Large (Klenow) Fragment NEB M0210S
Klenow Fragment (3'-5' exo) NEB M0212S
T4 DNA Polymerase NEB M0203S
T4 Polynucleotide Kinase NEB M0201S
Deoxynucleotide Solution mix, 10mM NEB N0447S
dATP Solution 10mM NEB N0440S
Quick T4 DNA Ligase NEB M0202T
Adenosine 5'-Triphosphate (ATP), 25mM NEB P0756S
DNA Polymerase Thermo Scientific F549L
NEBuffer 2 NEB B7002S
Hank's buffered salt solution Thermo Scientific 14025076
Fetal bovine serum  Thermo Scientific A3160702
phosphate buffer saline  Thermo Scientific 10010023
H3K4me3 Cell Signaling 9751S
H3K4me1 Diagenode C15410037
H3K27me3 Diagenode pAb-069-050
H3K36me3 Abcam ab9050
H3K9me3 Diagenode C15410056
SeraMag  super-paramagnetic beads

DOWNLOAD MATERIALS LIST

References

  1. Simpson, R. T. Nucleosome Positioning: Occurrence, Mechanisms, and Functional Consequences. Prog. Nucleic Acid Res. Mol. Biol. 40, Issue C 143-184 (1991).
  2. Kornberg, R. D., Lorch, Y. Twenty-five years of the nucleosome, fundmamental particle of the eukaryotic chromosome. Cell. 98, 285-294 (1999).
  3. Schones, D. E., et al. Dynamic regulation of nucleosome positioning in the human genome. Cell. 132, (5), 887-898 (2008).
  4. Segal, E., et al. A genomic code for nucleosome positioning. Nature. 442, (7104), 772-778 (2006).
  5. Shiio, Y., Eisenman, R. N. Histone sumoylation is associated with transcriptional repression. PNAS. 100, (23), 13225-13230 (2003).
  6. Li, L., Lorzadeh, A., Hirst, M. Regulatory variation: An emerging vantage point for cancer biology. Wiley Interdiscip. Rev. Syst. Biol. Med. 6, (1), 37-59 (2014).
  7. Jiang, J., et al. Investigation of the acetylation mechanism by GCN5 histone acetyltransferase. PLoS ONE. 7, (5), (2012).
  8. Kouzarides, T. Histone methylation in transcriptional control. Curr. Opin. Genet. Dev. 12, (2), 198-209 (2002).
  9. Brind'Amour, J., Liu, S., Hudson, M., Chen, C., Karimi, M. M., Lorincz, M. C. An ultra-low-input native ChIP-seq protocol for genome-wide profiling of rare cell populations. Nat. Commun. 6, 6033 (2015).
  10. Lorzadeh, A., et al. Nucleosome Density ChIP-Seq Identifies Distinct Chromatin Modification Signatures Associated with MNase Accessibility. Cell Rep. 17, (8), 2112-2124 (2016).
  11. Noll, M., Kornberg, R. D. Action of micrococcal nuclease on chromatin and the location of histone H1. J. Mol. Biol. 109, (3), 393-404 (1977).
  12. Skene, P. J., Henikoff, S. A simple method for generating high-resolution maps of genome wide protein binding. eLife. 4, 09225 (2015).
  13. Brogaard, K., Xi, L., Wang, J. -P., Widom, J. A map of nucleosome positions in yeast at base-pair resolution. Nature. (2012).
  14. Cui, K., Zhao, K. Genome-wide approaches to determining nucleosome occupancy in metazoans using MNase-Seq. Methods Mol. Biol. 833, 413-419 (2012).
  15. Mieczkowski, J., et al. MNase titration reveals differences between nucleosome occupancy and chromatin accessibility. Nat. Commun. 7, 11485 (2016).
  16. Basu, S., Campbell, H. M., Dittel, B. N., Ray, A. Purification of Specific Cell Population by Fluorescence Activated Cell Sorting (FACS). JOVE. (41), (2010).
  17. Rohland, N., Reich, D. Cost-effective, high-throughput DNA sequencing libraries for multiplexed target capture. Genome Res. 22, (5), 939-946 (2012).
  18. Zheng, Y., Josefowicz, S. Z., Kas, A., Chu, T. T., Gavin, M. A., Rudensky, A. Y. Genome-wide analysis of Foxp3 target genes in developing and mature regulatory T cells. Nature. 445, (7130), 936-940 (2007).
  19. Krishnakumar, R., Gamble, M. J., Frizzell, K. M., Berrocal, J. G., Kininis, M., Kraus, W. L. Reciprocal Binding of PARP-1 and Histone H1 at Promoters Specifies Transcriptional Outcomes. Science. 319, (5864), 819-821 (2008).
  20. Mendenhall, E. M., et al. Locus-specific editing of histone modifications at endogenous enhancers. Nat. Biotechnol. 31, (12), 1133-1136 (2013).
  21. Landt, S. G., et al. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia. Genome Res. 22, (9), 1813-1831 (2012).
  22. Reference Epigenome Standards - IHEC. Available from: http://ihec-epigenomes.org/research/reference-epigenome-standards/ (2017).
  23. Heinz, S., et al. Simple Combinations of Lineage-Determining Transcription Factors Prime cis-Regulatory Elements Required for Macrophage and B Cell Identities. Mol. Cell. 38, (4), 576-589 (2010).
  24. Feng, J., Liu, T., Qin, B., Zhang, Y., Liu, X. S. Identifying ChIP-seq enrichment using MACS. Nat. Protoc. 7, (9), 1728-1740 (2012).
  25. Fraley, C., Raftery, A. E. MCLUST: Software for Model-Based Cluster Analysis. J. Classif. 16, (2), 297-306 (1999).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics