الكشف عن متغير CDH1 نسخة نادرة في الأنسجة المجمدة الطازجة سرطان المعدة ببكر الرقمية المستندة إلى شرائح

JoVE Journal
Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

ويصف المخطوط القائم على رقاقة رقمية PCR مقايسة للكشف عن CDH1 نادرة نسخة variant (CDH1a) في العادي مجمدة طازجة وورم الأنسجة التي تم الحصول عليها من المرضى الذين يعانون من سرطان المعدة.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Molinari, C., Abou Khouzam, R., Salvi, S., Rossi, T., Ranzani, G. N., Calistri, D. Detection of a CDH1 Rare Transcript Variant in Fresh-frozen Gastric Cancer Tissues by Chip-based Digital PCR. J. Vis. Exp. (132), e57066, doi:10.3791/57066 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

CDH1a، نسخة غير مقبول من الجينات CDH1 ، قد وجد أن يتم التعبير عنها في بعض خطوط خلايا سرطان المعدة (GC)، في حين أنه غائب في مخاطية المعدة العادية. في الآونة الأخيرة، اكتشفنا CDH1a النص البديل في أنسجة الورم المجمدة الطازجة التي تم الحصول عليها من مرضى GC. كان التحقيق في التعبير عن هذا البديل في عينات الأنسجة النهج بكر (دبكر) الرقمي القائم على رقاقة المعروضة هنا. دبكر يوفر إمكانيات قياس دقيقة وقوية وحساسة للغاية للأحماض النووية، وهو يتزايد استخدام العديد من التطبيقات في مختلف المجالات. دبكر قادر على كشف الأهداف النادرة؛ وبالإضافة إلى ذلك، يوفر دبكر إمكانية مطلقة ودقة التقدير الكمي للأحماض النووية دون الحاجة إلى آلة لفرز والمنحنيات القياسية. في الواقع، فعل تقسيم يثري الهدف من الخلفية، مما يحسن كفاءة التضخيم والتسامح لمثبطات. هذه الخصائص تجعل دبكر أداة مثلى للكشف عن نسخة نادرة CDH1a .

Introduction

ترميز الجينات CDH1 لهاء-كادهيرين، عاملاً رئيسيا يشارك في الحفاظ على ظهارة المعدة العادية من خلال تنظيم خلية التصاق والبقاء على قيد الحياة، والانتشار والهجرة1. فقدان البروتين كادهيرين ه نتيجة للفعل الضار أو تعديلات جسدية من CDH1 ارتبطت بتطوير GC2،3. قد تم الافتراض المستنسخات المتعارف عليه عدم الناشئة عن إنترون 2 الجينات أيضا أن تلعب دوراً في التسرطن المعدة4،5. على وجه الخصوص، واحد هذه المحاضر، CDH1a، لقد ثبت أن يتم التعبير عنها في خطوط الخلايا GC لكن تغيب من المعدة العادي4. ونحن مؤخرا الكشف عن CDH1a في عينات الأنسجة GC من المرضى GC استخدام دبكر المستندة إلى شرائح5. دبكر واستخدم لتقييم، للمرة الأولى، وجود نسخة الجين CDH1a في GC الأمعاء وأنسجة طبيعية.

هو أسلوب المعيار الذهبي لتحديد التعبير الجيني PCR الكمي في الوقت الحقيقي (قبكر). ومع ذلك، البيانات الناتجة في بعض الأحيان يمكن أن يكون متغير وذات نوعية رديئة، خصوصا عند مستوى المستهدفة في العينة منخفضا. يمكن أن يكون سبب هذا التغير من الملوثات، التي تعوق النشاط بوليميريز والصلب التمهيدي، مما أدى إلى تضخيم غير محددة و ردود فعل الجانب التنافسي6.

على الرغم من أن مبادئ دبكر البيوكيميائية الأساسية مشابهة لتلك التي قبكر، دبكر يظهر بعض المزايا، مما يسمح لقياسات دقيقة جداً للحمض النووي (جدنا)/التكميلية جزيئات الحمض النووي (كدنا). وفي الواقع، هو دبكر فعل نقطة نهاية التي تعتمد على تقسيم معايرة من عينة إلى آلاف آبار، حيث يحتوي كل جيدا جزيء هدف واحد أو صفر. التضخيم ثم يحدث فقط في الآبار التي تحتوي على نسخة من الرقم المستهدف وهو مبين بإشارة فلورسنت. ويمكن حساب العدد المطلق للجزيئات المستهدفة في العينة الأصلية ثم بتحديد نسبة إيجابية لمجموع الأقسام باستخدام إحصاءات Poisson ثنائي الحد7.

وبالإضافة إلى ذلك، هذا الأسلوب دبكر يلغي الحاجة لتشغيل منحنى قياسي، ومن ثم، التحيز المرتبطة بها، والتقلبات المناخية، مما يسمح لإجراء تقييم كمي مباشر للأهداف8،9؛ فإنها تعطي نتائج أكثر دقة واستنساخه مستقل عن الملوثات وكفاءة نتيجة عن التسامح عالية لمثبطات10؛ هو أكثر حساسية وتحديداً من قبكر، وهو وسيلة موثوق بها للكشف عن هدف نادر وهكذا. وأخيراً، تقسيم العينة إلى ردود فعل متعددة يقلل من المنافسة مع جزيئات الخلفية ويحسن الحد من الكشف عن الهدف، مما يجعل من الممكن التضخيم وتيسير الكشف عن الجزيئات واحدة من جدنا/كدنا6 . الكشف والتحديد الكمي للأحماض النووية بالقائم على رقاقة دبكر قد طبق متزايد لنسخ تباين عدد والتحديد الكمي للحمض النووي وشظايا والطفرات ويحلل11،،من1213، نظراً الدقة والمواد المنخفضة إدخال شرط للأسلوب. وباﻹضافة إلى ذلك، أدمج دبكر مؤخرا في تحليل كل ميكرورناس14 والجينات النصوص5،15.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

البروتوكول يتبع المبادئ التوجيهية للجنة الأخلاقيات البحثية البشرية IRST.

ملاحظة: هذا الإجراء هو مصممة خصيصا للكشف عن عدد قليل من الجزيئات كدنا في الأنسجة البشرية الطازجة المجمدة. وخفضت الفروع الأنسجة على الثلج الجاف، بينما لا تزال مجمدة، من ورم المعدة المصادق عليه سابقا مشتقة من المريض أو عينات الأنسجة العادية.

1-الجيش الملكي النيبالي العزل وتنقية

  1. استخراج الحمض النووي الريبي
    ملاحظة: يتم عزل الحمض النووي الريبي تحت غطاء محرك السيارة باستخدام منتج معين (انظر الجدول للمواد). ومع ذلك، مجموعة متنوعة من مواد العزل المتاحة تجارياً.
    1. مجانسة 50-100 ملغ عينة ناعما قطع الأنسجة المجمدة الطازجة في أنبوب 1.5 مل مع 1 مل من كاشف عزل الحمض النووي الريبي ودوامه بقوة عن 15 س. إينكوباتي الأنابيب في-80 درجة مئوية بين عشية وضحاها.
    2. احتضان الأنبوبة التي تحتوي على العينة في درجة حرارة الغرفة لمدة 5 دقائق ومزيج من فورتيكسينج لمدة 15 ثانية.
    3. الاحتفاظ بالانبوب على الجليد، وإضافة 200 ميليلتر من كلوروفورم، ودوامه بقوة لمدة 15 ثانية.
    4. احتضان هذه الأنابيب في درجة حرارة الغرفة ل 60 s وأجهزة الطرد المركزي في 12,000 س ز لمدة 15 دقيقة في 4 درجات مئوية.
    5. نقل في مرحلة مائي في أنبوب 1.5 مل وإضافة 20 ميكروغرام من الجليكوجين.
      ملاحظة: من المهم تجنب بعناية نقل أي من الطور البيني أو الطبقة العضوية بغية الحد من التلوث.
    6. إضافة 500 ميليلتر من الايزوبروبانول، عكس أنبوب لمزيج، واحتضان على الجليد لمدة 10 دقائق.
    7. الطرد المركزي الأنبوب في ز س 12,000 لمدة 15 دقيقة في 4 درجات مئوية يعجل بالجيش الملكي النيبالي.
      ملاحظة: سوف تكون الحمض النووي الريبي موجودة في بيليه مثل هلام على الجانب والسفلي من الأنبوب، كثيرا ما غير مرئية بعد الطرد المركزي.
    8. إزالة المادة طافية دون الإخلال ترسبات وغسله مع 1 مل إيثانول 75% من بيبيتينج.
    9. الطرد المركزي الأنبوب في 7,500 س ز لمدة 5 دقائق في 4 درجات مئوية وإزالة المادة طافية دون إزعاج بيليه.
    10. واسمحوا بيليه الجاف حتى يصبح شفافاً ترسبات وتذوب في 50 ميليلتر من المياه خالية من رناسي.
    11. تجميد العينات في-80 درجة مئوية على الأقل بين عشية وضحاها قبل القياس الكمي.
  2. القضاء على الحمض النووي الجينومي وتنقية الحمض النووي الريبي
    ملاحظة: ينصح خطوة هضم الدناز، متبوعاً تنقية الحمض النووي الريبي المستندة إلى عمود، لتحليل الأهداف المنخفضة-وفرة من أجل هضم تلويث الحمض النووي.
    1. حل الدناز المجففة بالتبريد الأول (1500 كيس [كونيتز]) في ميليلتر 550 الحرة رناسي المياه استخدام المحاقن، المزيج بلطف بعكس القنينة، وتقسيم الحل الأسهم المعاد تشكيلها إلى مختبرين.
    2. نقل في أنبوب 1.5 مل حجم العينة المحسوب مع 15 ميكروغرام للجيش الملكي النيبالي، 10 ميليلتر من "الهضم الدناز" المخزن المؤقت من kit (المدرجة في الجدول للمواد)، 2.5 ميليلتر من الدناز أنا حل الأسهم، وخالية من رناسي المياه إلى 100 ميليلتر. إينكوباتي في درجة حرارة الغرفة لمدة 10 دقائق.
    3. إضافة 350 ميليلتر من المخزن المؤقت لتحلل الأنسجة (من الطقم، انظر الجدول للمواد)، ومزيج من بيبيتينج.
    4. إضافة 250 ميليلتر من الإيثانول 100% ومزيج من بيبيتينج.
    5. نقل وحدة التخزين بأكملها (700 ميليلتر) في عمود الدوران جديد وأجهزة الطرد المركزي في 12,000 س ز لمدة 15 ثانية.
    6. نقل عامل التصفية إلى أنبوب جمع جديد، إضافة 500 ميليلتر من الإيثانول 80% إلى العمود وأجهزة الطرد المركزي في 12,000 س ز لمدة 2 دقيقة.
    7. افتح غطاء لعمود الدوران وأجهزة الطرد المركزي في 12,000 س ز لمدة 5 دقائق مع أنبوب جمع جديد الجاف للتصفية؛ ثم نقل عامل التصفية إلى أنبوب 1.5 مل.
    8. إضافة 14 ميليلتر من المياه خالية من رناسي مباشرة إلى عمود التصفية والطرد المركزي في 12,000 س ز لمدة 1 دقيقة.
    9. تبقى العينات على الجليد والمضي قدما للقياس الكمي باستخدام 2 ميليلتر من العينة على مقاعد البدلاء-أعلى جهاز المطياف الضوئي أو تخزين الجيش الملكي النيبالي في-80 درجة مئوية حتى الاستخدام.

2-كدنا التوليف

  1. 1,000 مكان نانوغرام من الجيش الملكي النيبالي، 4 ميليلتر من مزيج الرئيسي، 1 ميليلتر المنتسخة العكسية، والمياه خالية من رناسي إلى وحدة تخزين نهائي من 20 ميليلتر في أنبوب PCR عقيمة. المزيج بلطف وتدور إلى أسفل.
  2. احتضان هذا المزيج رد فعل في cycler حرارية، تطبق الشروط التالية: 5 دقيقة عند 25 درجة مئوية، 30 دقيقة في 42 درجة مئوية، مدة 5 دقائق في 85 درجة مئوية.
  3. الطرد المركزي هذه الأنابيب بإيجاز والمضي قدما إلى تحليل دبكر أو تخزينها في-20 درجة مئوية إلى حين الحاجة.

3-إعداد رد بكر الرقمية

  1. رد فعل دبكر مزيج وعينه إعداد
    1. ذوبان الجليد في مزيج الرئيسي والمقايسة في درجة حرارة الغرفة لمدة 20 دقيقة على الأقل.
    2. تمييع العينات كدنا لتركيز 300 نانوغرام في 6 ميليلتر من الماء.
    3. بلطف دوامة سيد مزيج وإعداد المزيج في أنبوب عقيم مع 8.7 ميليلتر من مزيج الرئيسي و 0.87 ميليلتر من التمهيدي المقايسة تصميم مخصص CDH1a ميليلتر 1.83 المياه خالية من نوكلاس لوحدة تخزين نهائي من 11.4 ميليلتر.
      ملاحظة: لتفاصيل التمهيدي المقايسة تصميم مخصص CDH1a انظر الجدول للمواد.
    4. نقل ميليلتر 11.4 مزيج استعداد للعينة كدنا المخفف وتخلط بلطف والطرد المركزي بإيجاز.
      ملاحظة: تتضمن وحدات التخزين الزائد 20% للتعويض عن فقدان وحدة التخزين من بيبيتينج. إعداد المزيج لجميع العينات وعنصر تحكم قالب لا (المجلس الوطني الانتقالي).
  2. إعداد شرائح
    ملاحظة: لتحقيق أفضل النتائج تحميل الرقائق أسرع.
    1. قم بتوصيل رقاقة المحمل والانتظار حتى يتحول مؤشر الضوء الأخضر.
    2. إزالة غطاء المحاقن السوائل الغمر بلطف سحب المكبس 1-2 مم وإطلاقه لتسهيل هذه الخطوة، واستبدالها بمعلومات سرية.
    3. تأخذ شريحة جديدة وتأخذ علما بالتعليمات البرمجية المكتوبة على غطاء لإقرانها بالعينة.
    4. عقد الغطاء بعناية من جانبها وقشر بعيداً الفيلم الواقية ومكان الغطاء مع الوجه لزجة حتى في الاتجاه الصحيح.
    5. التقاط شريحة، مع الحرص على عدم لمس الجزء الداخلي، وتحميلها على العش رقاقة في الموضع الصحيح بالضغط لأسفل رافعة لفتح المشبك بعناية.
    6. تحميل شفرة تحميل جديد على المحمل ودفعها برفق التأكد من أنها بشدة في المكان.
    7. نقل 14.5 ميليلتر من مزيج دبكر الرد على شفرة تحميل دون صنع فقاعات الهواء أو تحريف بليد، بعد الصحافة التي الأسود تحميل زر لتوزيع الصوت على الشريحة.
    8. استخدام المحاقن غمر السائل لنقل حوالي 20 قطرات على سطح رقاقة مع الحرص على عدم لمس السطح مع التلميح.
      ملاحظة: من المهم لتغطية كامل السطح دون تسرب السوائل على الحواف.
    9. تدوير الذراع محمل جعل غطاء تتلامس الرقاقة واضغط باستمرار لمدة 15 ثانية.
    10. اضغط على زر غطاء للإفراج عن شرائح وإرجاع الذراع إلى موضعه.
    11. عقد رقاقة المجتمعون بزاوية 45 درجة بعناية الاستغناء المحاقن من خلال منفذ تعبئة السوائل الغمر وتدوير رقاقة قليلاً للتأكد من عدم وجود لا فقاعات الهواء، وإزالة أي السوائل الزائدة مع مسح عقيمة.
    12. إغلاق القضية رقاقة بلطف بعيداً تقشير التسمية على رأس غطاء شريحة والصحافة عبر منفذ التعبئة لمالا يقل عن 5 s.
    13. تخزن الرقاقة في الظلام حتى جاهزة التحميل في cycler الحرارية.
      ملاحظة: يجب استخدام رقائق المعدة ضمن ح 2.
  3. رد فعل دبكر
    1. فتح الغطاء وتثبيت المحولات لكل الكتل، حتى عندما يتم استخدام كتلة واحدة.
    2. وضع الرقائق على كتلة العينة في الموضع الصحيح.
      ملاحظة: يجب أن يكون المنفذ تعبئة نحو الجزء الأمامي cycler الحرارية في وضع مرتفعة للسماح أي فقاعات الهواء لتطفو إلى الأعلى دون إزعاج النافذة للرقاقة. استخدام رقائق فارغة لتحقيق التوازن بين الكتلتين.
    3. إرساء لوحة الحرارية على كتلة العينة تغطي كامل رقائق البطاطس.
    4. إغلاق الغطاء وتبدأ بكر تشغيل، تطبق الشروط التالية: عقد في 96 درجة مئوية لمدة 10 دقائق؛ دورات 45 من 60 درجة مئوية لمدة 2 دقيقة و 98 درجة مئوية لمدة 30 ثانية؛ عقد 60 درجة مئوية لمدة 2 دقيقة؛ عقد في 4 درجات مئوية. إيقاف cycler الحراري وذوبان الجليد الرقائق في درجة حرارة الغرفة لمدة 10 دقيقة على الأقل.
      ملاحظة: يجب إجراء تحليل رقاقة خلال ساعة واحدة.
  4. تحليل رقاقة
    1. افتح غطاء للصك وإزالة الوسادات الحرارية، ثم إزالة الرقائق من المحولات.
      ملاحظة: تخزين الرقائق في موقع داكنة ونظيفة حتى التحليل.
    2. تنظيف سطح الرقاقة مع الايزوبروبانول ومسح عقيمة.
      ملاحظة: فحص كل شريحة لتسرب أو المشاكل المحتملة.
    3. إدراج USB في النظام الكاشف لحفظ البيانات.
    4. فتح علبة رقاقة نظام كشف وتحميل رقاقة الوجه للأعلى في الموضع الصحيح ثم قم بإغلاق علبة الورق.
    5. انتظر 30 s للمعالجة، ثم إزالة الرقائق وإدراج واحد القادم.
    6. انتظر تحليل للانتهاء بالنسبة لجميع الشرائح المجهزة ثم إدراج USB في جهاز كمبيوتر لنقل الملفات.
      ملاحظة: الوقت الإجمالي للتحليل هو حوالي 2 إلى 3 دقيقة/رقاقة.

4-بيانات التحليل والتفسير

  1. قم بتوصيل منصة المستندة إلى مجموعة النظراء البرمجيات اللازمة للقيام بجميع التحاليل المتلقين للمعلومات.
  2. إنشاء مشروع واستيراد كافة ملفات البيانات من الرقائق الفائدة.
  3. قم بإدخال اسم العينة؛ حدد صبغ والمقايسة المستخدمة في علامة التبويب "تعريف رقائق".
  4. تحديد ما إذا كان الرقاقة مقبولة بتصور أنه في علامة التبويب "مراجعة البيانات"، التحقق من مدى دقة العينة كانت محملة على الرقاقة وكم عدد نقاط البيانات من المدانين.
    ملاحظة: رفض رقائق مع 13,000 أقل من نقاط البيانات المدانين.
  5. الانتقال إلى مؤامرة مبعثر رقاقة المحددة على الجانب الأيمن من الشاشة؛ تطبيق عتبة 000 6 إشارات صبغ مراسل أميديتي (الاتحاد الماليزي) fluorescein المحور (ص) من جميع الشرائح.
    ملاحظة: قد تختلف عتبة أنشئت على أساس الاختبارات المستخدمة.
  6. إزالة أي إشارات إيجابية مشكوك فيها لمنع النتائج الإيجابية الكاذبة عن طريق تحديد بقعة النسبي على مبعثر الأرض باستخدام أداة الحبل والضغط على "غير محدد". جميع النقاط الإيجابية المتبقية وتشير إلى وجود نسخ كدنا الهدف نادرة تم تحليلها.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

استخدام الإجراء المعروضة هنا، نحن فحص للتعبير عن البديل نسخة نادرة CDH1a في الأنسجة المجمدة الطازجة المعدة. وأجرى التحليل دبكر على إقران 21 عينات الأنسجة العادية والسرطان وفي عينات إضافية الورم 11. CDH1a كان من الممكن اكتشاف الأورام 15 من أصل 32 (47%)، بينما أي عينات أنسجة طبيعية وأظهرت وجود هذه النسخة نادرة5. في تحليلنا، رفضت رقائق مع نقاط البيانات أقل من 13,000، كما كانت رقائق مع تحميل غير متجانسة. يظهر الشكل 1 رقاقة عرض للمدانين (الشكل 1A) وغير المدانين (الشكل 1، ج) عينات. وفي الحالة الأخيرة، يجب أن يتم تجاهل الرقاقة نظراً لوجود فقاعات متعددة (الشكل 1B)، فقاعة كبيرة واحدة (الشكل 1)، أو نتيجة لعدم كفاية عدد نقاط البيانات العتبة (الشكل 1B). يجب تشغيل هذه العينات مرة أخرى للحصول على نتائج التفسير. فيما يتعلق بمؤامرة مبعثر المقدمة من البرنامج (الشكل 2)، وهو يصور عادة الإشارات من الصبغة مراسل الاتحاد الماليزي المحور (ص) ضد إشارات من الصبغة مراسل مركز فيينا الدولي (الملكية الشركة المصنعة) (س). نقاط البيانات المقدمة عن مؤامرة مبعثر المرمزة باللون، وهنا، نحن فقط تصور إشارات صبغ مراسل الاتحاد الماليزي باللون الأزرق (الشكل 2A)، مما يشير إلى الآبار التي اتسع نطاق الهدف. هذه الإشارات أقرب يقع على المحور الصادي وأبعد عن أصل المؤامرة. أصفر اللون الثاني ينظر في المؤامرة ويدل على الآبار التي وقع فيها أي تضخيم. تعيين عتبة موثوقة للإشارات الإيجابية وتطبيقها على جميع الشرائح لمنع التحيز القائم على الدعوة. هنا، كان على عتبة المحدد 6,000 استناداً إلى مجموعة الإشارات التي لوحظت بالنسبة للشرائح المختلفة في هذه التجارب. تم العثور على نسخ كدنا CDH1a (الإشارات الزرقاء) في عدد من عينات الورم، يظهر فرقا واضحا في السعة من الإشارات السلبية (الشكل 2A). على العكس من ذلك، لم تصدر أية إشارات فوق العتبة المحددة عثر في عينات سلبية بالنسبة CDH1a نسخة و أيوجميع عينات الأنسجة العادية وبعض عينات الورم (الشكل 2). وبالمثل، تم الكشف عن لا إشارات إيجابية في المجلس الوطني الانتقالي الذي تم إضافة المياه بدلاً من كدنا، وبالتالي تخدم كعنصر تحكم سلبية لرد فعل دبكر (الشكل 2).

إجراء تحليل رقائق دقيقة يجب تطبيقه على نقاط بيانات عامل التصفية المنخفضة الجودة، والقضاء على خطر نتائج ملتبسة. وقد تم ذلك عن طريق عرض شرائح لتحديد الموقع الدقيق للإشارة الإيجابية المقابلة: إذا كانت الإشارة الأزرق يقع في حدود جداً رقاقة (الشكل 3A) أو حولها فقاعات (الشكل 1B)، فصل الإشارة من التحليل . إلى منع خطر المغلوطة، إشارات أعلاه 6,000 لقناة الاتحاد الماليزي وعلى اليمين المتطرف من الأرض كانت تعتبر ربما أسبيسيفيك وثم تصفيتها، على الرغم من أنها كانت مترجمة جيدا داخل الرقاقة (الشكل 3B). وبهذه الطريقة، يعتبر عينة إيجابية للتعبير عن نسخة نادرة، CDH1a، حتى ولو أنه يظهر إشارة تضخيم واحد، طالما أن الإشارة يتوافق مع الشروط سالفة الذكر.

Figure 1
الشكل 1 . رقائق المدانين وغير المدانين الممثل. النقاط الزرقاء هي الآبار التي تم تضخيم النسخة CDH1a ؛ النقاط الصفراء هي الآبار التي وقع فيها أي تضخيم؛ النقاط البيضاء آبار فارغة. تتم الإشارة إلى نقاط البيانات العتبة أسفل كل شريحة. (أ) رقاقة إلكترونية المدانين مع الأزرق إشارات مترجمة أيضا داخل حدود شرائح. (ب) رقاقة غير المدانين مع نقاط البيانات 13,000 أقل من العتبة. (ج) رقاقة غير المدانين مع فقاعة كبيرة. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم-

Figure 2
الشكل 2 . الممثل مبعثر PCR الرقمية المؤامرات من CDH1a التعبير. تصوير قطع إشارات من الصبغة مراسل الاتحاد الماليزي المحور (ص) ضد إشارات من الصبغة مراسل مركز فيينا الدولي (س). النقاط الزرقاء إشارات إيجابية التعبير CDH1a ، بينما النقاط الصفراء هي إشارات "أي تضخيم". (أ) CDH1a-عينة إيجابية. (ب) CDH1a-نموذج سلبي. (ج) لا تحكم قالب (المجلس الوطني الانتقالي) عرض صفر التعبير CDH1a . الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم-

Figure 3
الشكل 3 . الممثل رقاقة غرامة التحليل الرقمي PCR التبعثر مؤامرات. على اليسار هو عرض شرائح مع الإشارات لمصلحة التكبير في سوداء مربعة، بينما على اليمين هو مؤامرة مبعثر المقابلة. (أ) إشارة أزرق مترجمة على الكسر الصحيح من الأرض ولكن عند الحدود للرقاقة. (ب) ثلاث إشارات الأزرق أبرز في الرمادي المترجمة في أقصى اليمين من الأرض ولكن داخل الرقاقة. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم-

Subscription Required. Please recommend JoVE to your librarian.

Discussion

دبكر وضعت أصلاً للحمض النووي الجزيئي القياسات10،11،،من1213 وفي وقت تم تكييف هذه التكنولوجيا للتحديد الكمي ميكرورناس، والجيش الملكي النيبالي النصوص5، ،من 1415. في هذا البروتوكول قد قدمنا قائمة التطبيقات تشمل الكشف عن النصوص النادرة المستمدة من عينات الأنسجة المجمدة الطازجة. نحن تستخدم لهذا الغرض على كمية عالية نسبيا من كدنا (300 نانوغرام). على الرغم من أن هذا المبلغ ليس الحد الأقصى الذي يمكن استخدامه في دبكر، كان كافياً لوضع شروط موحدة لمقارنة جميع العينات لدينا. بتحديد عتبة إشارة التنوير مبلغ 000 6 والعناية بمواقع إشارات إيجابية التضخيم على الأرض كل رقاقة ومبعثر، اكتشفنا بنجاح هذا الهدف نادرة في عينات الأنسجة ورم المعدة.

دبكر، نحن يمكن أن لا كمياً على الإطلاق، CDH1aبسبب كمية منخفضة جداً من الهدف، بل يمكن أن نقيم موثوق بها الوجود/عدم وجود هذه النسخة النادرة. والواقع أن الطابع الكمي لهذا الأسلوب محدود بالعدد الأولى للأهداف الموجودة في عينات تم تحليلها7. ذات الصلة، ما زالت هذه التقنية نفسها المركزة مكلفة إلى حد ما والوقت. تقنيات بديلة عند تحليل عينات عديدة و/أو عدة أهداف المطلوبة، وبالتالي، ينبغي النظر7،8.

ومع ذلك، دبكر بلا شك يوفر في نهاية المطاف منصة لحساسية القياس والتحديد الكمي للأحماض النووية، كما أنه يحسن الدقة وإمكانية تكرار نتائج فيما يتعلق قبكر7،8. وعلاوة على ذلك، يمكن اعتبار الوسيلة الوحيدة المتاحة لتحليل التعبير الجيني من الأحماض النووية المنخفضة الوفيرة التي بالقرب من الحد الأقصى من حساسية قبكر6.

البروتوكول هو موضح هنا يمكن تكييفها للكشف عن أي الأنسجة، مما يتيح الكشف عن أهداف نادرة، كما هو الحال في دراستنا. وبالإضافة إلى ذلك، يمكن أن تمتد المقايسة على القياس الكمي المطلق للنصوص. في مثل هذه الحالات، يجب ببساطة مضروباً في حجم رد فعل تحميل عدد النسخ/ميليلتر وأفادت بأن الصك لنموذج معين ومقسوما على مقدار كدنا الأولية. للتغلب على التقلبات التي تنتجها النسخ العكسي، ينبغي أن تكون آلة لفرز الجينات محددة شملت، عندما يكون ذلك ممكناً6. وتطلعاً إلى المستقبل، يحمل دبكر إمكانية كبيرة في أن تصبح منصة المعيار الذهبي، ليس فقط للكشف عن تسلسل نادرة، ولكن أيضا الكشف عن الطفرات النادرة ونسخة دقيقة التحديد الكمي رقم7. وهذا مهم خصوصا في mosaicism الوراثية، كذلك كما هو الحال في أبحاث السرطان حيث يمكن أن يؤثر عدم تجانس الورم المريض النتائج السريرية والاستجابة للعلاج.

العملية من وجهة نظر، عند إعداد البروتوكول دبكر هناك العديد من الخطوات الحاسمة التي يجب تسليط الضوء عليها. أولاً وقبل كل شيء، رد فعل مزيج يحتوي على المقدار المناسب من كدنا استناداً إلى مستوى التعبير الهدف المتوقع، ينبغي أن تنقل بعناية كبيرة في شفرة التحميل حتى لا يتعرض لخلق فقاعات الهواء، والتي يمكن أن تتداخل مع تجانس العينة. وبالإضافة إلى ذلك، ينبغي أولاً أن متوضعة بليد نفسها بشكل صحيح؛ وإلا يمكن أن يؤدي إلى توزيع عينة غير متكافئ. وعلاوة على ذلك، ينبغي دائماً إجراء طلاء كافية مع غمر السائل ودقيقة ختم من الغطاء. فيما يتعلق بتجهيز شرائح والتحليل، من المهم أن تكون على علم بإمكانية تراكم التكثيف على الرقاقة؛ في هذا سيناريو، ينبغي إعادة مسحت مع الايزوبروبانول الرقاقة وإعادة تحليلها. وعلاوة على ذلك، دبكر تستند إلى إحصاءات بواسون، يشير عدد الحد أدنى من البيانات المدانين (> 10,000) يجب أن تكون موجودة على الرقاقة، وإلا يجب أن يتم تشغيل النموذج مرة أخرى. أخيرا، لتجارب الكشف عن نسخة المستهدفة منخفضة، يمكن أن يكون عاملاً حاسما في التباس نسبة الإشارة إلى الضوضاء، ولكن عتبة موثوق بها لتحديد المواقع يمكن أن تساعد في تحديد إشارات إيجابية حقيقية.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

واضعي التقرير لا تضارب في المصالح لهذا العمل.

Acknowledgments

الكتاب أود أن أشكر تيرني Gráinne للمساعدة التحريرية.

Materials

Name Company Catalog Number Comments
TRIazol Reagent Thermo Fisher Scientific 15596018
Glycogen 20 mg/ml ROCHE 10901393001
RNeasy MinElute Cleanup kit QIAGEN 74204
iScript cDNA Synthesis kit BioRad 1708891
QuantStudio 3D Digital PCR Master Mix v2 Thermo Fisher Scientific A26358
CDH1a IDT custom designed assay Integrated DNA Technologies (IDT) NA F) GCTGCAGTTTCACTTTTAGTG
(R) ACTTTGAATCGGGTGTCGAG
(P)/FAM/CGGTCGACAAAGGACAGCCTATT/TAMRA/
[dPCR optimized assay concentrations: 900 nM (F),        900 nM (R), 250 nM (P)]
QuantStudio 3D Digital PCR 20K Chip Kit v2 Thermo Fisher Scientific A26316
Heraeus Biofuge Fresco Thermo  Scientific 75002402
Thermocycler (Labcycler) Sensoquest 011-103
GeneAmp PCR System 9700 Thermo Fisher Scientific N805-0200
Dual Flat Block Sample Module Thermo Fisher Scientific 4425757
QuantStudio 3D Tilt Base for Dual Flat Block GeneAmp PCR System 9700 Thermo Fisher Scientific 4486414
QuantStudio 3D Digital PCR Chip Adapter Kit for Flat Block Thermal Cycler Thermo Fisher Scientific 4485513
QuantStudio 3D Digital PCR Chip Loader Thermo Fisher Scientific 4482592
QuantStudio 3D Digital PCR Instrument with power cord Thermo Fisher Scientific 4489084

DOWNLOAD MATERIALS LIST

References

  1. van Roy, F., Berx, G. The cell-cell adhesion molecule E-cadherin. Cell Mol Life Sci. 65, (23), 3756-3788 (2008).
  2. Carneiro, P., et al. E-cadherin dysfunction in gastric cancer: cellular consequences, clinical applications and open questions. FEBS Lett. 586, (18), 2981-2989 (2012).
  3. Corso, G., et al. Somatic mutations and deletions of the E-cadherin gene predict poor survival of patients with gastric cancer. J Clin Oncol. 31, (7), 868-875 (2013).
  4. Pinheiro, H., et al. Transcription initiation arising from E-cadherin/CDH1 intron2: a novel protein isoform that increases gastric cancer cell invasion and angiogenesis. Hum Mol Genet. 21, (19), 4253-4269 (2012).
  5. Abou Khouzam, R., et al. Digital PCR identifies changes in CDH1 (E-cadherin) transcription pattern in intestinal-type gastric cancer. Oncotarget. 8, (12), 18811-18820 (2017).
  6. Taylor, S. C., Laperriere, G., Germain, H. Droplet Digital PCR versus qPCR for gene expression analysis with low abundant targets: from variable nonsense to publication quality data. Sci Rep. 7, (1), (2017).
  7. Basu, A. S. Digital Assays Part I: Partitioning statistics and digital PCR. SLAS Technol. 22, (4), 369-386 (2017).
  8. Huggett, J. F., Whale, A. Digital PCR as a novel technology and its potential implications for molecular diagnostics. Clin Chem. 59, (12), 1691-1693 (2013).
  9. Alikian, M., et al. RT-qPCR and RT-Digital PCR: A comparison of different platforms for the evaluation of residual disease in chronic myeloid leukemia. Clin Chem. 63, (2), 525-531 (2017).
  10. Hoshino, T., Inagaki, F. Molecular quantification of environmental DNA using microfluidics and digital PCR. Syst Appl Microbiol. 35, (6), 390-395 (2012).
  11. Salvi, S., et al. Circulating AR copy number and outcome to enzalutamide in docetaxel-treated metastatic castration-resistant prostate cancer. Oncotarget. 7, (25), 37839-37845 (2016).
  12. Tessitore, M. V., et al. Detection of newly produced T and B lymphocytes by digital PCR in blood stored dry on nylon flocked swabs. J.Transl.Med. 15, (1), (2017).
  13. Sho, S., et al. Digital PCR Improves mutation analysis in pancreas fine needle aspiration biopsy specimens. PLoS One. 12, (1), e0170897 (2017).
  14. Conte, D., et al. Novel method to detect microRNAs using chip-based QuantStudio 3D digital PCR. BMC Genomics. 16, 849 (2015).
  15. Sanders, R., Mason, D. J., Foy, C. A., Huggett, J. F. Evaluation of digital PCR for absolute RNA quantification. PLoS One. 8, (9), e75296 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics