РНК Pull-down процедура для определения целей РНК РНК, длиной некодирующих

Genetics
 

Summary

Этот метод выпадающее РНК позволяет определить цели РНК длиной некодирующих РНК (lncRNA). Основываясь на гибридизации домашнего, разработанные анти чувство ДНК олигонуклеотида зондов для этой lncRNA в надлежащим образом фиксированной ткани или клетки линии, позволяет эффективно захвата всех целей РНК lncRNA.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Torres, M., Becquet, D., Guillen, S., Boyer, B., Moreno, M., Blanchard, M. P., Franc, J. L., François-Bellan, A. M. RNA Pull-down Procedure to Identify RNA Targets of a Long Non-coding RNA. J. Vis. Exp. (134), e57379, doi:10.3791/57379 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Длиной некодирующих РНК (lncRNA), которые являются последовательности более чем 200 нуклеотидов без рамки определенных чтения, принадлежат к семейству регулирования некодирующих РНК. Хотя их биологические функции остаются практически неизвестны, постоянно увеличивалось количество этих lncRNAs и теперь предполагается, что люди могут иметь более чем 10 000 таких стенограмм. Некоторые из них известны принять участие в важных нормативных пути экспрессии генов, которые происходят на уровне транскрипционный анализ, но и на разных этапах РНК co - и post-transcriptional созревания. В последних случаях РНК, которые являются мишенью для lncRNA должны быть определены. Это причина, почему это полезно разработать метод, позволяющие идентифицировать РНК, связанных прямо или косвенно с lncRNA интерес.

Этот протокол, который был вдохновлен ранее опубликованные протоколы, позволяя изоляции lncRNA вместе с его последовательности связанных хроматина, был адаптирован для изоляции связанных молекул РНК. Мы определили, что два шага имеют решающее значение для обеспечения эффективности этого протокола. Во-первых, разработки конкретных анти смысле ДНК зонды олигонуклеотида состоянии гибридизировать к lncRNA интерес. С этой целью вторичная структура lncRNA было предсказано биоинформатики и анти чувство олигонуклеотидных зондов были разработаны с сильное сродство для регионов, которые отображают низкую вероятность внутреннего низкопробный спаривать. Второй критический шаг процедуры опирается на фиксирующие условий ткани или культивируемых клеток, которые должны сохранить в сети между всеми партнерами, молекулярной. В сочетании с высокой пропускной способностью РНК последовательности, этот протокол выпадающее РНК может обеспечить весь РНК interactome lncRNA интерес.

Introduction

Общая цель метода, описанного здесь заключается в идентификации молекулярных партнеров РНК длиной некодирующих РНК (lncRNA). LncRNA соответствуют последовательности более чем 200 нуклеотидов без рамки определенных чтения. Некоторые из них было показано, чтобы участвовать в регулировании выражения гена, не только на уровне транскрипционный анализ, но и на разных этапах РНК co - и post-transcriptional созревания. В последних случаях молекулярные партнерами lncRNA являются РНК, которые должны быть определены. Будет необходимо разработать метод, позволяющие идентифицировать РНК, связанных прямо или косвенно с lncRNA интерес.

Ранее опубликованные методы, такие как Chromatin изоляции RNA очистки (щебечут)1,2 и захватить гибридизации анализ на РНК цели (диаграмма)3,4, позволяют открытие высокой пропускной способности РНК прыгните белков и геномных привязки сайтов конкретного lncRNA. В этих двух методов, lncRNA интерес был впервые гибридизированных к биотинилированным взаимодополняющих олигонуклеотиды, и комплекс был затем изолированы при помощи стрептавидина бусины. Основное различие между этими двумя методами связана с дизайн зондов, ориентированные на lncRNAs. Щебечут, вдохновленный РНК рыбы, состояла из проектирование бассейна коротких дополнительных зондов олигонуклеотида ДНК плитки по всей длине lncRNA стратегии. Напротив в ДИАГРАММЕ, авторы адаптированы H РНКазы assay сопоставления на lncRNAs сайты, доступные для гибридизации зонда.

Процедура, предложенная здесь дизайн анти смысле ДНК биотинилированным олигонуклеотида использует датчики биоинформатики моделирование lncRNA вторичной структуры5 для выбора зонды с сильное сродство для регионов, которые отображают низкую вероятность внутреннего Базовый сопряжения. Эта процедура имеет преимущество быть менее дорогостоящим, чем те, которые основаны на бассейны черепица олигонуклеотидных зондов2 и меньше времени, чем те, которые основаны на H РНКазы чувствительность4.

Поскольку существует растущее количество доказательств для регулирования post-transcriptional гена lncRNAs6, это очень полезно разработать подход позволяет захвата молекул РНК, которые являются объектами lncRNA. Кроме того чтобы быть пригодным для большинства приложений, подход был оптимизирован в культивируемых клеток и тканей экстрактов.

Protocol

Все процедуры были выполнены в строгом соответствии с Европейского экономического сообщества для ухода и использования лабораторных животных (86/609/ЕЕС и 2010/63/ЕС) и под лицензией предоставляются для D. Becquet (Préfecture des Буш дю Рон, разрешение № 13-002).

1. зонд дизайн

  1. Использование первичной последовательности lncRNA интерес, генерировать его вторичной структуры на «RNAstructure Webserver»5.
    Примечание: На этом сайте, могут использоваться различные алгоритмы. Три прогноза инструменты, которые дают лучшие результаты для зонд конструкции являются: «Фолд» (низкая структура свободной энергии), «MaxExpect» (весьма вероятно пар оснований) и «Probnot» (вероятно, включая pseudoknots пар оснований). Эти три анализы могут быть выполнены и сравнить. Другие веб-серверы, например в Вене РНК websuite7, может также использоваться.
    1. Выбор регионов, которые отображают низкую вероятность внутреннего низкопробный спаривать и дизайн анти смысл олигонуклеотидных зондов 25 баз с сильное сродство для этих регионов.
      Примечание: GC содержимое этих датчиков должны входить между 40 и 60%. С помощью инструмента поиска выравнивания (взрыв), убедитесь, что выбранный анти чувство олигонуклеотида зонды не признают нуклеотидных последовательностей в других РНК, выраженные в системе выбранной ячейки.
  2. Дизайн также неспецифические ДНК олигонуклеотида зонд 25 баз который отображает ни сродство для lncRNA интереса ни для других РНК последовательности генома интерес.
  3. Закажите зонды с биотина в 3'-конце.
    Примечание: Для того, чтобы уменьшить их пространственной помех, расстояние между олигонуклеотида и биотин должно быть увеличено с triethyleneglycerol прокладку. Для оптимального результата и чтобы иметь возможность оценить специфичность результатов pull-down, рекомендуется дизайн 3 различных анти чувство олигонуклеотидных зондов и затем экспериментально сравнения их эффективности.

2. сшивка

  1. Сшивки культивируемых клеток
    1. Культура GH4C1 sommatolactotroph гипофиза клеток в среде F10 ветчина дополнена сыворотки крови лошади 15% и 2% плода телячьей сыворотки. Рост клеток до впадения в 78,5 см2 культуры пластин. Это соответствует примерно до 1 x 10-7 клеток.
    2. Удалить ячейку культуры среднего из сливной GH4C1 78,5 см2 культуры плиты, затем промыть 1 x средний объем фосфат буфер солевой раствор (PBS)
    3. Исправить клетки с 1% раствором параформальдегида в PBS (10 мл для блюд2 78,5 см); Это решение должно быть приготовленные из параформальдегида 4% раствор. Перекрестные ссылки под агитации за 10 мин при комнатной температуре (RT).
      Предупреждение: Параформальдегида (PFA) является токсичным и должны быть обработаны с осторожностью.
    4. Утолить параформальдегида действий, добавляя 1/10 объема глицин 1,25 М (1 мл на 10 мл раствора параформальдегида); агитировать 5 мин на RT.
    5. Отбросить СМИ путем аспирации и промыть два раза (5 мин) с 1 X средний объем PBS.
    6. Добавить объем PBS, соответствует 1/10 объема средств массовой информации, сбора клеток с скребок ячейки, а затем передачи для пластиковых пробирок.
    7. Спина на 510 g при 4 ° C за 5 мин.
    8. Удалите столько супернатанта как можно скорее.
    9. Хранить окатышей на неопределенный срок, при необходимости-80 ° c.
  2. Сшивание тканей
    1. 5 мг свежезаваренным полученные мыши гипофиза железы ткани в раствор 1% параформальдегида разводят в PBS (приблизительно 10 x размер ткани), агитировать за 10 мин на RT.
    2. Утолить параформальдегида действий, добавляя 1,25 М глицин раствора (1 мл на 10 мл раствора параформальдегида) и агитировать 5 мин на RT.
    3. Отказаться от средств массовой информации, стремление и промыть два раза с PBS (приблизительно 10 x размер ткани). Удалите столько супернатанта как можно скорее.
    4. Хранить сшитой ткани на неопределенный срок на-80 ° C.

3. клетки или ткани Lysis

  1. Подготовьте литического буфера (50 мм трис-HCl pH 7.0, 10 мм ЭДТА, 1% SDS, дополненная 200 ед/мл раствора АБС битор РНКазы и коктейль протеаз ингибитором 5 мкл/мл).
  2. Для получения лизированных образцов без предварительного размораживания, вновь приостановить клетки гранулы или сшитого тканей с этот буфер (примерно 1 мл на 100 мг гранул клеток или тканей). Пелле клетки, полученные от 1 x 10-7 клеток порождают лизированных образцы, содержащие примерно 20 мг белка.
    Примечание: В зависимости от используемых тканей, следует добавить шаг механического разрушения. В этом случае важно избежать нагрева образцов во время этот дополнительный шаг.

4. sonication

  1. Оптимизация условий sonication
    1. Программа sonicator с 2 до 5 серии 30 на s и 30 s OFF.
    2. Выполните тесты для оптимизации условий sonication на разреженных лизированных образцы (коэффициент разбавления ½ или ¼, соответствует примерно 10 или 5 мг белка). Место разбавленный лизированных образцов в водяной бане 4 ° C и начало серии sonication.
    3. Очищайте РНК, РНК комплект очистки либо с РНК изоляции реагента (например, Тризол).
    4. Загрузить всю совокупность очищенный РНК на электрофорезе геля агарозы 1% в буфере TBE, проверить длину фрагменты РНК. Эта длина должна диапазоне между 200 и 800 bp.
      Примечание: В зависимости от размера фрагмент РНК, эффективность анти чувство олигонуклеотидных зондов может варьироваться. Затем рекомендуется проверить эффективность зондов при различных условиях sonication.
  2. Sonication лизированных образцов
    1. Место лизированы образцов, соответствующих 20 мг белков (полученной после шага 3.2) в 4 ° C воды ванна и начать sonication серии, как оптимизированы в шаге 4.1.
    2. Сразу же после sonication, центрифуги для 5 мин при 12000 g при 4 ° C. Передача supernatants в новой пробирок.
      Примечание: Для обеспечения однородности, реплицировать supernatants можно объединить и перераспределены на этот шаг.

5. РНК Pull-down

  1. День 1 – шаг гибридизации
    1. Добавить 2 тома гибридизации буфера (50 мм трис-HCl pH 7.0, 750 мм NaCl, 1 мм ЭДТА, SDS 1%, 15% формамида добавил экспромтом) в supernatants, собранные после sonication шаг. Вихрь.
    2. Перевести 20 мкл каждого образца в пластиковых пробирок (ввода образцы) и хранить при температуре от-20 ° C.
    3. Добавьте 100 пмоль биотинилированным олигонуклеотидных зондов (или не-; см. таблицу 1) для каждой выборки. Инкубировать 4-6 ч при умеренной агитации на вращателе трубки на RT.
    4. Добавьте 50 мкл магнитных стрептавидина бусины дополнена 200 ед/мл раствора АБС битор РНКазы и коктейль протеаз ингибитором 5 мкл/мл.
    5. Инкубируйте на ночь под умеренным агитации на вращателе трубки на RT.
  2. День 2 – РНК изоляции шаг
    1. Использование магнитных поддержки отдельные шарики от lysate клетки, удалить супернатант и мыть бусины с 900 мкл буфера мытья (SDS 0.5%, SSC 2 x). Повторите 5 раз перемежаются с перемешиванием 5 мин на вращателе на RT.
    2. После последнего мыть, декантируют в последний раз и 95 мкл Proteinease K буфера (10 мм трис-HCl pH 7.0, 100 мм NaCl, 1 мм ЭДТА, 0,5% SDS) и 5 мкл протеиназы K (20 мг/мл) для образцов.
    3. На льду оттепель ввода образцов (20 мкл) и добавьте 75 мкл Proteinease K буфера и 5 мкл протеиназы K (20 мг/мл).
    4. Инкубируйте все образцы с протеиназы K 45 мин при температуре 50 ° C затем 10 мин при 95 ° C.
    5. Холод образца на льду на 3 мин до отделения бисера от РНК с помощью магнитного. Держите супернатант и отбросить бисер.
    6. Очищайте РНК с комплектом Очистка РНК, которая должна включать шаг пищеварение ДНК. Хранить РНК-80 ° c.
    7. Выполнение обратной транскрипции ПЦР (RT-ПЦР) с использованием комплекта RT следуют ПЦР с использованием конкретных грунтовки (Таблица 1).
    8. Постройте две библиотеки ДНК, соответствующий двух бассейнов РНК, полученные с каждым конкретным Neat1 зондов (Таблица 1). Выполните последовательность на системе виртуализации нового поколения.

Representative Results

Несколько недавних исследований показали, что lncRNAs играют важную роль в почти каждый важного биологического процесса и что эта роль достигается за счет контроля за экспрессией генов, происходящих как транскрипционный анализ и на post-transcriptional уровнях в этом последнем случае показаны, что РНК может стать мишенью lncRNAs6.

LncRNA ядерных обогащенного обильные транскрипта 1 (Neat1) подразумевается в различных мышат как frontotemporal деменции, боковой амиотрофический склероз или эпилепсия8,9,10и также misregulated в различных видов рака11,12.

Это lncRNA также известен быть структурным компонентом конкретных ядерных органов, paraspeckles и принять участие в post-transcriptional суточного регулирования ген выражение13. Paraspeckles, которые находятся в каждом клеточном ядре и формируются вокруг не только Neat1, которая необходима для их формирования, но и вокруг нескольких RNA-связывая протеинов (ОДП)14, действительно известно, чтобы иметь возможность сохранять цели РНК в ядре15 . Формирование paraspeckles достигается за счет объединения различных компонентов. Это образование было показано для отображения суточного ритмический рисунок, вождение художественной ядерной удержания РНК цели13. Ядерного сохранение целей РНК paraspeckles может произойти через привязку к ОДП или напрямую через РНК/РНК ассоциации, но степень РНК, мишенью paraspeckles пришлось быть определены. Для определения РНК направлены непосредственно или косвенно, Neat1, РНК раскрывающемся был разработан протокол, позволяющий изоляции и выявление всех целей Neat1 РНК в культивируемых клеток, а также в образцы тканей (см. Рисунок 1 для графического Презентация техники).

Протокол был также успешно применяется для определения РНК целей другой lncRNA метастазов связанные легких аденокарциномы транскрипт 1 (Malat1). Malat1 является весьма сохраняемой и выраженной lncRNA, в ядерной крапинками вместе с несколькими РНК сплайсинга факторов. Malat1 как известно участвует в регуляции сплайсинга несколько зарождающихся пре мРНК16,17.

Конкретные (SO) и зонды олигонуклеотида неспецифические (НСУ) были созданы с помощью зонда разработки стратегии описаны здесь. Эта стратегия опирается на выбор регионов, которые отображают низкую вероятность внутреннего спаривание как предсказано в вторичной структуре lncRNA и на разработке конкретных зонды с сильное сродство для этих регионов. Представитель в результате этих прогнозов биоинформатики, картину предсказал вторичная структура последовательность Neat1 (нуклеотидов 1480 до 2000) совместно с позиции двух разработан таким образом зонды приведены на рисунке 2.

Разработанные датчики были направлены в крыса Neat1 или Malat1 для GH4C1 культивируемых клеток и для мыши Neat1 для ткани гипофиза экстрактов (Таблица 1). Относительный обогащения в Neat1 или Malat1 был рассчитан на неспецифические и специфические зонды относительно ввода образцов. Рисунок 3 показывает эффективность конкретных зондов в раскрывающемся Neat1 в крыса GH4C1 гипофиза клеточной линии (Рисунок 3А) и в мыши гипофиза ткани экстрактов (рис. 3B). При использовании протокола дизайн зонд для создания конкретных олигонуклеотида (так), зонды, направленных Malat1, один эффективный зонд был получен пока еще не была достаточно эффективной и был удален (рис. 4A).

После РНК выпадающее процедура RT-ПЦР эксперименты, некоторые РНК, оценку с конкретными грунтовки (Таблица 1) были продемонстрированы быть связано с Neat1 или Malat1 в GH4C1 выдержки. РНК, связанные с Neat1 в GH4C1 клеточных экстрактов были также показаны ассоциироваться с Neat1 в ткани гипофиза экстрактов. Действительно после Neat1 РНК pull-down, Malat1 было установлено быть мишенью Neat1 в линии клеток GH4C1 и экстракты ткани гипофиза мыши (Рисунок 5A). Взаимно Neat1 значительно обогатилась после Malat1 РНК раскрывающемся с использованием конкретного ПЭП в GH4C1 клетках (рис. 4В). Подчеркивая тесную связь между двумя lncRNAs, эти результаты согласуются с потенциальной роли совместного Neat1 и Malat1, предложенная Malat1 нокаут мышей, которые отображают изменения в Neat1 РНК выражение18, 19. стенограммы двух основных гормонов гипофиза, гормон роста (Gh) (Рисунок 5B) и Пролактин (ПРЛ) (рис. 5 c) значительно обогатились после Neat1 РНК раскрывающемся с конкретными зондов в GH4C1 клетки и гипофиза экстракты, предлагая возможность регулирования двух гормонов, Neat1. При сравнении двух конкретных зонды используются, оказалось, что их эффективность может варьироваться в зависимости от РНК считается (Рисунок 5B и 5 c рисунок). Эти результаты свидетельствуют о необходимости разработки нескольких конкретных зонды для того, чтобы выбрать те отображение не только эффективность в обогащении раскрывающемся lncRNA, но и эффективность в обогащении своих целей РНК.

Метод pull-down РНК может также сопровождаться РНК высокопроизводительного секвенирования получить полный список целей РНК lncRNA интерес13. РНК seq анализ на GH4C1 гипофиза клетки после того, как была выполнена раскрывающемся Neat1 РНК с помощью двух конкретных зондов, описанных выше. Следует отметить, что отрицательный контроль с помощью НСУ также может быть подвергнут анализу РНК seq, если уровень РНК оправился после выпадающее РНК с НСУ является достаточным, чтобы позволить строительство библиотек. Это было не в предыдущий опыт13. Библиотеки, которые были созданы после использования конкретных зондов были проанализированы с помощью шляпе/запонки газопровода20 и только стенограммы с ценностями фрагмента за kilobase за миллион сопоставленных гласит (FPKM) выше, чем 1 были приняты во внимание. Списки, полученные с двух конкретных зондов, направленных Neat1 (Таблица 1) были пересечены оценить специфичность результатов. 4,268 гены были найдены связанные с paraspeckles, который представлял 28% выразили стенограмм в GH4C1 клетки13. В соответствии с результатами, полученными с помощью ПЦР анализа (Рисунок 5A-C), стенограммы Gh, ПРЛ и Malat1 были найдены ассоциироваться с Neat1. Поэтому метод выпадающее РНК доказано быть эффективным инструментом для изучения взаимодействия между lncRNAs и их целей РНК.

Figure 1
Рисунок 1: графическое представление РНК тянуть вниз процедуры. В первый день клетки или ткани были сшитого с параформальдегида лизированы и sonicated перед шагом гибридизации, которая была выполнена путем добавления биотинилированным конкретные зондов. Магнитные стрептавидина бусины были затем добавляется отдельный конкретный материал от остальной части lysate клетки. На второй день бусины были изолированы с помощью магнита и промыть несколько раз. Де сшивки шаг позволил восстановления РНК, которые были очищены и использованы для RT-ПЦР или РНК seq анализа. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2: вторичная структура Neat1 последовательности (нуклеотидов 1480 до 2000) как предсказано биоинформатики ресурса (веб-сервер RNAstructure; низкие свободной энергии структура). Структура окрашен по степени вероятности низкопробный спаривать. Два зонда олигонуклеотиды (СО1 и SO2) в красном расположены вдоль структуры Neat1 РНК. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3: Проверка ПЦР Neat1 обогащения против ввода. ПЦР проверки обогащения Neat1 против ввода после Neat1 РНК тянуть два различных конкретных зонды (СО1 rn и SO2-rn для GH4C1 клеток и СО1 мм и SO2-мм для ткани гипофиза) по сравнению с неспецифической один (НСБ rn для GH4C1 клеток и НСУ мм для гипофиза ткани) в клетках крыс GH4C1 (A) и гипофиза мыши ткани экстрактов (B). Результаты являются среднее ± SEM, полученные в экспериментах 3 до 10. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 5

Рисунок 4: Проверка ПЦР Malat1 и Neat1 обогащения против ввода после Malat1 РНК тянуть вниз. ПЦР проверка Malat1 (A) и Neat1 (B) обогащения против ввода после Malat1 РНК тянуть два различных конкретных зонды (SO3-rn и SO4-rn) по сравнению с неспецифической один (НСБ rn) в GH4C1 клетках крыс. Результаты являются среднее ± SEM, полученные в 3 экспериментов. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 4
Рисунок 5: Проверка ПЦР Malat1, Gh, ПРЛ обогащения против ввода после Neat1 РНК тянуть вниз. Проверка ПЦР Malat1 (A), Gh (B), обогащения ПРЛ (C) против ввода после Neat1 РНК тянуть вниз с помощью различных конкретных зондов по сравнению с неспецифическими в GH4C1 крыса клетки и ткани гипофиза мыши экстрактов. Результаты являются среднее ± SEM, полученные в экспериментах 3-8. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

ЗОНД ИМЕНА Последовательности
НСУ Rn TAAAATACCATTTGATGTTTGAAATTAT
СО1 Rn CTCCACCATCATCAATCCTCTGGAC
SO2-Rn GCCTTCCCACATTTAAAAACACAAC
SO3-Rn AACTCGTGGCTCAAGTGAGGTGACA
SO4-Rn AAGACTCTCAGGCTCCTGCTCATTC
НСУ мм GTTTGTGGTTTAACAGTGGGAAGGC
СО1 мм GCCTTCCCACTGTTAAACCACAAAC
SO2-мм CTCACCCGCACCCCGACTCCTTCAA
ПЦР ПРАЙМЕРЫ:
Rattus Омар
Neat1 AAGGCACGAGTTAGCCGCAAAT
TGTGCACAGTCAGACCTGTCATTC
Malat1 GAAGGCGTGTACTGCTATGCTGTT
TCTCCTGAGGTGACTGTGAACCAA
GH1 CCGCGTCTATGAGAAACTGAAGGA
GGTTTGCTTGAGGATCTGCCCAAT
ПРЛ TGAACCTGATCCTCAGTTTGGT
AGCTGCTTGTTTTGTTCCTCAA
MUS musculus
Neat1 TGGGCCCTGGGTCATCTTACTAGATA
CACAGCTGTTCCAATGAGCGATCT
GH1 CTCGGACCGTGTCTATGAGAAACTGA
TTTGCTTGAGGATCTGCCCAACAC
ПРЛ TGAACCTGATCCTCAGTTTGGT
AGCTGCTTGTTTTGTTCCTCAA

Таблица 1: Последовательности ДНК олигонуклеотидных зондов и ПЦР праймеры

Discussion

Длиной некодирующих РНК (lncRNAs), их количество и разнообразие представляют большое поле исследований и их роли в основном все еще для того чтобы быть обнаружены. Многие из этих lncRNAs ядерной локализации и среди них, некоторые вовлечены в пути регулирования экспрессии генов посредством транскрипционный анализ или посттранскрипционного механизмов. Один из текущих задач в этой области — понять актуальность этих lncRNAs в post-transcriptional обработки РНК. Для этой цели РНК, мишенью lncRNAs должны быть определены. Вдохновленный предыдущих исследований было сосредоточено на ассоциации lncRNAs с хроматином, мы разработали процедуру, которая позволяет выявить РНК, связанные с lncRNA. Успех этого протокола, названный РНК выпадающее, зависит главным образом от двух важных шагов, а именно дизайн анти смысле ДНК олигонуклеотидных зондов, должны специально и исключительно гибридизировать с lncRNA интерес и в условиях ткани или клетки для фиксации, для сохранения целостности сети между всеми партнерами, молекулярной.

Ранее опубликованные протоколы, предусматриваются процедуры изолировать lncRNA вместе с его связанного хроматина последовательностей (щебечут1,2, диаграмма3,4). В этих протоколах различные стратегии были заняты в разработке зондов олигонуклеотида биотинилированным анти смысле ДНК. В процедуре щебечут авторы использовали бассейн ДНК биотинилированным олигонуклеотидных зондов, охватывающих всю длину lncRNA интерес после исключения всех избыточных и неспецифической зондов1,2. В протоколе диаграммы авторы определили регионы lncRNA, которые являются более доступными для гибридизации и разработан захвата олигонуклеотиды, предназначенных для этих регионов. Эти регионы были выбраны на основе их чувствительность РНКазы-H. Действительно используя свойство РНКазы-H для гидролизуют РНК на сайты связывания РНК-ДНК, олигонуклеотиды, которые гибридизируйте доступных сайтов в lncRNA производят РНК-ДНК гибриды и привести к ферментативного расщепления lncRNA. Авторы трех из этих олигонуклеотиды захвата кандидат выбран и использовали их в коктейль3,4.

Процедура мы использовали, чтобы дизайн анти смысле ДНК биотинилированным олигонуклеотидных зондов был близок к используемому в протоколе диаграммы, но гибридизации доступные регионы желаемого lncRNA не были выбраны на основе их чувствительность РНКазы-H, но Согласно их низкую вероятность внутреннего низкопробный спаривать как определяется биоинформатики моделирование lncRNA вторичной структуры. Необходимо заметил, что различные вторичные структуры будет прогнозироваться с использованием различных алгоритмов, и зонды выбираться должны быть те, которые гибридизируйте доступных последовательностей lncRNA в наибольшее количество вторичных структур предсказал. Те же результаты были получены с помощью коктейль трех разработан, конкретные зондов или единичного пробоотборника индивидуально. Это побудило использование двух отдельных, конкретные зондов и рассмотрение положительных результатов как те, которые являются общими для этих двух зондов. Наконец, поэтому рекомендуется в начале развития метода, для оптимального результата, и чтобы иметь возможность оценить специфичность результатов раскрывающемся дизайн 3 различных анти чувство олигонуклеотида зонды и затем сравнить экспериментально, их эффективность, особенно поскольку зонд эффективности может быть изменено, подготовка lysate клетки. Тем не менее процедура зонд дизайн, основанный на моделирование биоинформатики lncRNA вторичной структуры, которые мы использовали по-прежнему дешевле, чем, основанной на пулах черепица олигонуклеотидных зондов2, и это было меньше времени, чем метод на основе H РНКазы чувствительность4.

Отрицательный контроль также должно выполняться с использованием как негативные захвата олигонуклеотида олигонуклеотида биотинилированным ДНК смысле зондов или платные олигонуклеотидных зондов или олигонуклеотиды, направленных против несвязанных РНК. Из-за существования естественных антисмысловых стенограммы lncRNAs использование олигонуклеотидных зондов смысл иногда может быть неадекватной. Независимо от зонда олигонуклеотида, отобранных для отрицательного контроля необходимо проверить путем взрыва, что он не гибридизируйте с известным РНК и иметь в виду, что этот олигонуклеотида могут скрещиваться до сих пор удаления заметки lncRNA.

Lysates клетки используется в этих экспериментах выпадающее РНК были получены от 106 -107 клеток при работе с культивируемых клеток и от 1 до 10 мг, при работе с ткани. Подготовка lysates клетки необходимо адаптировать в зависимости от типа ткани или клетки, используемый с двух основных шагов, которые должны быть оптимизированы: а именно, сшивки шаг, который позволяет формирование ковалентных связей между lncRNA и его молекулярной партнерами и Sonication шаг, который уменьшает вязкость путем измельчения хроматина.

Цель cross-linking шаг является обеспечить, чтобы все РНК цели остаются закрытыми для lncRNA, вызывая формирование сети между всеми партнерами, молекулярные. Параформальдегида лечения шаг, который будет образуют ковалентные связи между lncRNA и его партнерами позволяет сети быть сетчатые. В протоколе диаграммы, было предложено при работе с ядерными lncRNA, для выполнения первой процедуры с параформальдегида ячейки в целом lysate и второй лечение изолированных нуклеиновых фракция3,4. Мы наблюдали этот дополнительный шаг снизилась эффективность зондов, вероятно путем сокращения доступности lncRNA в клетках. Следовательно степени ретикуляции, параформальдегид должен быть адаптирован с учетом клетки или ткани типа используется, локализации lncRNA интерес и эффективности разработанных датчиков.

Во время лизировать клетки, хроматина выпущена в lysate и увеличивает его вязкость; Это необходимо лоскуток хроматина, sonication для увеличения текучести образцов и таким образом облегчить доступность олигонуклеотидных зондов к lncRNA интерес. Однако sonication также будет перерабатывать РНК, экстрагируют lncRNA интерес. То важно свести к минимуму время sonication таким образом, что в то время как она эффективно уменьшает вязкость lysate, она также позволяет получение РНК фрагменты с длиной состоит между 200-800 bp. Обратите внимание, что sonication время будет весьма в зависимости от количества и типа ткани или клетки культивировали.

В заключение описанную здесь процедуру позволяет в 2-3 дня захвата целей РНК желаемой lncRNA. В сочетании с RT-ПЦР, эти методы позволят ищет конкретной ассоциации и регулирование мРНК, желаемого lncRNA как кандидат подход. Геном широкий подход РНК выпадающее эксперименты могут быть проанализированы по высокой пропускной способностью РНК последовательности позволяет извлечения всех РНК, связанные с желаемой lncRNA. Независимо от аналитической выбранной стратегии, РНК выпадающее процедура должна представить новые значительные знания о РНК регулирования по lncRNAs.

Disclosures

Авторы не имеют ничего сообщать.

Acknowledgments

Эта работа была поддержана университета Экс-Марсель и CNRS и финансируется грантом от Pfizer лабораторий.

Materials

Name Company Catalog Number Comments
Bioruptor Plus Diagenode B01020001 Sonicator
Dynabeads My One Thermo-Fisher 65001 Magnetic streptavidin beads
Formamide Thermo-Fisher 15515-026
Gel electrophoresis apparatus Advance Mupid-One Gel electrophoresis apparatus
Proteinase K Sigma P2308
RNA XS purification kit Macherey-Nagel 740902 RNA purificationkit
RNAseOUT Thermo-Fisher 10777-019 RNAse inhibitor
Trizol Thermo-Fisher 15596018 RNA purification
Tube Rotator Stuart SB2 Eppendorf tube rotator
RNA to DNA Thermo-Fisher 4387405 Reverse transcription kit
iTaq Universal SYBR Green Supermix BioRad 1725124 qPCR reagent
Applied 7500 Fast Thermo-Fisher 4351107 qPCR apparatus
Illumina TruSeq Stranded mRNA Sample Preparation kit Illumina 20020594 DNA library construction kit
Illumina NextSeq 500 Illumina SY-415-1002 NGS system

DOWNLOAD MATERIALS LIST

References

  1. Chu, C., Qu, K., Zhong, F. L., Artandi, S. E., Chang, H. Y. Genomic maps of long noncoding RNA occupancy reveal principles of RNA-chromatin interactions. Mol Cell. 667-678 (2011).
  2. Chu, C., Quinn, J., Chang, H. Y. Chromatin isolation by RNA purification (ChIRP). J Vis Exp. e3912 (2012).
  3. Simon, M. D., Wang, C. I., Kharchenko, P. V., West, J. A., Chapman, B. A., Alekseyenko, A. A., Borowsky, M. L., Kuroda, M. I., Kingston, R. E. The genomic binding sites of a noncoding RNA. Proc Natl Acad Sci U S A. 20497-20502 (2011).
  4. Simon, M. D. Capture hybridization analysis of RNA targets (CHART). Curr Protoc Mol Biol. Unit 21.25 (2013).
  5. Reuter, J. S., Mathews, D. H. RNAstructure: software for RNA secondary structure prediction and analysis. BMC Bioinformatics. 11, 129 (2010).
  6. Sun, X., Haider Ali, M. S. S., Moran, M. The role of interactions of long non-coding RNAs and heterogeneous nuclear ribonucleoproteins in regulating cellular functions. Biochem J. 2925-2935 (2017).
  7. Gruber, A. R., Lorenz, R., Bernhart, S. H., Neuböck, R., Hofacker, I. L. The Vienna RNA websuite. Nucleic Acids Res. W70-W74 (2008).
  8. Tollervey, J. R., Curk, T., Rogelj, B., Briese, M., Cereda, M., Kayikci, M., König, J., Hortobágyi, T., Nishimura, A. L., Zupunski, V., Patani, R., Chandran, S., Rot, G., Zupan, B., Shaw, C. E., Ule, J. Characterizing the RNA targets and position-dependent splicing regulation by TDP-43. Nat Neurosci. 452-458 (2011).
  9. Riva, P., Ratti, A., Venturin, M. The long non-coding RNAs in neurodegenerative diseases: novel mechanisms of pathogenesis. Curr Alzheimer Res. (27338628), (2016).
  10. Barry, G., Briggs, J. A., Hwang, D. W., Nayler, S. P., Fortuna, P. R., Jonkhout, N., Dachet, F., Maag, J. L., Mestdagh, P., Singh, E. M., Avesson, L., Kaczorowski, D. C., Ozturk, E., Jones, N. C., Vetter, I., Arriola-Martinez, L., Hu, J., Franco, G. R., Warn, V. M., Gong, A., Dinger, M. E., Rigo, F., Lipovich, L., Morris, M. J., O'Brien, T. J., Lee, D. S., Loeb, J. A., Blackshaw, S., Mattick, J. S., Wolvetang, E. J. The long non-coding RNA NEAT1 is responsive to neuronal activity and is associated with hyperexcitability states. Sci Rep. 40127 (2017).
  11. Adriaens, C., Standaert, L., Barra, J., Latil, M., Verfaillie, A., Kalev, P., Boeckx, B., Wijnhoven, P. W., Radaelli, E., Vermi, W., Leucci, E., Lapouge, G., Beck, B., van den Oord, J., Nakagawa, S., Hirose, T., Sablina, A. A., Lambrechts, D., Aerts, S., Blanpain, C., Marine, J. C. p53 induces formation of NEAT1 lncRNA-containing paraspeckles that modulate replication stress response and chemosensitivity. Nat Med. (2016).
  12. Fang, J., Qiao, F., Tu, J., Xu, J., Ding, F., Liu, Y., Akuo, B. A., Hu, J., Shao, S. High expression of long non-coding RNA NEAT1 indicates poor prognosis of human cancer. Oncotarget. (2017).
  13. Torres, M., Becquet, D., Blanchard, M. P., Guillen, S., Boyer, B., Moreno, M., Franc, J. L., François-Bellan, A. M. Circadian RNA expression elicited by 3'-UTR IRAlu-paraspeckle associated elements. Elife. (2016).
  14. Fox, A. H., Lamond, A. I. Paraspeckles. Cold Spring Harbor Perspectives in Biology. Available from: http://cshperspectives.cshlp.org/content/2/7/a000687.long (2010).
  15. Chen, L. L., DeCerbo, J. N., Carmichael, G. G. Alu element-mediated gene silencing. EMBO J. 1694-1705 (2008).
  16. Tripathi, V., Ellis, J. D., Shen, Z., Song, D. Y., Pan, Q., Watt, A. T., Freier, S. M., Bennett, C. F., Sharma, A., Bubulya, P. A., Blencowe, B. J., Prasanth, S. G., Prasanth, K. V. The nuclear-retained noncoding RNA MALAT1 regulates alternative splicing by modulating SR splicing factor phosphorylation. Mol Cell. 925-938 (2010).
  17. Engreitz, J. M., Sirokman, K., McDonel, P., Shishkin, A. A., Surka, C., Russell, P., Grossman, S. R., Chow, A. Y., Guttman, M., Lander, E. S. RNA-RNA Interactions Enable Specific Targeting of Noncoding RNAs to Nascent Pre-mRNAs and Chromatin Sites. Cell. 188-199 (2014).
  18. Nakagawa, S., Ip, J. Y., Shioi, G., Tripathi, V., Zong, X., Hirose, T., Prasanth, K. V. Malat1 is not an essential component of nuclear speckles in mice. RNA. (2012).
  19. Zhang, B., Arun, G., Mao, Y. S., Lazar, Z., Hung, G., Bhattacharjee, G., Xiao, X., Booth, C. J., Wu, J., Zhang, C., Spector, D. L. The lncRNA Malat1 is dispensable for mouse development but its transcription plays a cis-regulatory role in the adult. Cell Rep. 111-123 (2012).
  20. Trapnell, C., Roberts, A., Goff, L., Pertea, G., Kim, D., Kelley, D. R., Pimentel, H., Salzberg, S. L., Rinn, J. L., Pachter, L. Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat Protoc. 562-578 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics