RNA Pull-down förfarande att identifiera RNA mål av en lång icke-kodande RNA

Genetics
 

Summary

Denna RNA pull-down-metod kan identifiera RNA målen i en lång icke-kodande RNA (lncRNA). Baserat på hybridisering av hemgjorda, utformade anti känsla DNA oligonukleotiden sonder specifika för denna lncRNA i ett lämpligt fast vävnad eller cellinje, tillåter det effektivt fångst av alla RNA mål av lncRNA.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Torres, M., Becquet, D., Guillen, S., Boyer, B., Moreno, M., Blanchard, M. P., Franc, J. L., François-Bellan, A. M. RNA Pull-down Procedure to Identify RNA Targets of a Long Non-coding RNA. J. Vis. Exp. (134), e57379, doi:10.3791/57379 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Långa icke-kodande RNA (lncRNA), vilka sekvenser av mer än 200 nukleotider utan definierade läsning ram, tillhör den regulatoriska icke-kodande rnas familj. Även om deras biologiska funktioner förblir i stort sett okända, numrera av dessa lncRNAs har ökat stadigt och det uppskattas nu att människor kan ha mer än 10 000 sådana avskrifter. Några av dessa är kända för att vara inblandade i viktiga rättsliga vägar av genuttryck som äger rum på transkriptionell nivå, men också på olika steg av RNA co- och post-transcriptional mognad. I de senare fallen har RNAs som riktas av lncRNA identifieras. Det är anledningen till varför det är användbart att utveckla en metod som möjliggör identifiering av RNAs associerade direkt eller indirekt med ett lncRNA sevärdheter.

Detta protokoll, som inspirerades av tidigare publicerade protokoll så att isoleringen av ett lncRNA tillsammans med dess associerade kromatin-sekvenser, anpassades till tillåta isolering av associerade RNAs. Vi fast beslutna att två steg är avgörande för effektiviteten i detta protokoll. Först är utformningen av särskilda anti känsla DNA oligonukleotiden sonder kan hybridisera till lncRNA sevärdheter. I detta syfte lncRNA sekundära struktur förutspåddes av bioinformatik och anti känsla oligonukleotiden sonder utformades med en stark affinitet för regioner som visar en låg sannolikhet för inre bas ihopkoppling. Det andra avgörande steget i proceduren är beroende av fixativ villkoren av vävnad eller odlade celler som har att bevara nätverket mellan alla molekylär partner. Tillsammans med hög genomströmning RNA-sekvensering, kan detta RNA nedrullningsbara protokoll ge den hela RNA-interactome av ett lncRNA sevärdheter.

Introduction

Det övergripande målet för den metod som beskrivs här är att identifiera RNA molekylär partners en lång kodande RNA (lncRNA). LncRNA motsvarar sekvenser av mer än 200 nukleotider utan definierade läsning ram. Några av dem har visat sig vara inblandade i uttrycket genreglering, inte bara på transkriptionell nivå, men också på olika steg av RNA co- och post-transcriptional mognad. I de senare fallen är molekylär partner av lncRNA RNAs som ska identifieras. En metod som möjliggör identifiering av RNAs associerade direkt eller indirekt med ett lncRNA av intresse skulle då vara viktigt att utveckla.

Tidigare publicerade metoder, såsom kromatin isolering av RNA rening (ChIRP)1,2 och fånga hybridisering analys av RNA mål (diagram)3,4, tillåter hög genomströmning upptäckten av RNA-bundna proteiner och genomisk bindningsställen för en specifik lncRNA. I dessa två metoder, lncRNA sevärdheter var först hybridiseras till biotinylerade kompletterande oligonukleotider, och anläggningen var då isolerat med streptividin pärlor. Den största skillnaden mellan dessa två tekniker är relaterad till utformningen av sonder som är avsedda för lncRNAs. ChIRP, strategin inspirerad av RNA fisk, bestod av att utforma en pool av korta kompletterande DNA oligonukleotiden sonder att kakla hela längden av lncRNA. Däremot i diagram anpassat författarna ett RNase H mappning test på lncRNAs sond platser tillgängliga för hybridisering.

Det förfarande som föreslås här att design den anti känsla DNA biotinylerade oligonukleotiden sonder använder bioinformatik modellering av lncRNA sekundärt strukturera5 Markera sonder med en stark affinitet för regioner som visar en låg sannolikhet för interna basera ihopkoppling. Detta förfarande har fördelen att vara billigare än de som baseras på pooler av plattsättning oligonukleotiden sonder2 och mindre tidskrävande än de baserat på RNAse-H känslighet4.

Eftersom det finns en växande mängd bevis för post-transcriptional genreglering av lncRNAs6, är det mycket användbart för att utveckla en strategi som gör det möjligt för fångst av RNAs som är mål för ett lncRNA. Dessutom för att vara användbara för de flesta tillämpningar, var metoden optimerad både i odlade celler och vävnad extrakt.

Protocol

Alla förfaranden utfördes i strikt överensstämmelse med Europeiska ekonomiska gemenskapen för skötsel och användning av försöksdjur (86/609/EEG och 2010/63/UE) och under en licens beviljas till D. Becquet (Préfecture des Bouches-du-Rhône, tillstånd nr 13-002).

1. sonden Design

  1. Med den primära sekvensen av lncRNA sevärdheter, generera dess sekundära struktur på ”RNAstructure Webserver”5.
    Obs: På denna plats, olika algoritmer kan användas. De tre prognosverktyg som ger bäst resultat för de sond mönster är: ”Fold” (lägsta fria energistruktur), ”MaxExpect” (mycket troligt baspar) och ”Probnot” (sannolikt baspar inklusive pseudoknots). Dessa tre analyser kan utföras och jämfört. Andra webbservrar, såsom den Vienna RNA websuite7, kan också användas.
    1. Välj regioner som visar en låg sannolikhet för inre bas ihopkoppling och designa anti känsla oligonukleotiden sonder av 25 baser med en stark affinitet för dessa regioner.
      Obs: GC innehållet i dessa sonder bör bestå mellan 40 och 60%. Med hjälp av ett linjeringsverktyg Sök (Blast), kontrollera att de valda anti känsla oligonukleotiden sonderna inte erkänner nukleotidsekvenser i andra RNA som uttrycks i den valda cellsystem.
  2. Design också en icke-specifik DNA oligonukleotiden sond av 25 baser som visar varken affinitet för lncRNA sevärdheter inte heller för andra RNA-sekvenser i genomet av intresse.
  3. Beställ sonderna med biotin i 3'-slutet.
    Obs: För att minska sterisk hindret, avståndet mellan oligonukleotiden och Biotin har ökas med en triethyleneglycerol spacer. För ett optimalt resultat, och för att kunna bedöma resultaten av pull-down specificitet, det rekommenderas att design 3 olika anti känsla oligonukleotiden sonder och sedan experimentellt jämföra deras effektivitet.

2. cross-linking

  1. Odlade cell cross-linking
    1. Kultur GH4C1 sommatolactotroph hypofysen celler i Hams F10 medium kompletteras med 15% häst serum och 2% fetalt kalvserum. Odla cellerna till sammanflödet i 78,5 cm2 kultur plattor. Detta motsvarar cirka 1 x 107 celler.
    2. Ta bort cellodlingsmedium från en konfluenta GH4C1 78,5 cm2 kultur plattan, sedan skölj med 1 x medium mängden fosfat buffrad saltlösning (PBS)
    3. Fixa cellerna med en 1% PARAFORMALDEHYD lösning i PBS (10 mL till en 78,5 cm2 rätter); Denna lösning måste beredas från 4% PARAFORMALDEHYD stamlösning. Tvärbinda under omrörning i 10 minuter vid rumstemperatur (RT).
      FÖRSIKTIGHET: PARAFORMALDEHYD (PFA) är giftigt, och måste hanteras med försiktighet.
    4. Släcka PARAFORMALDEHYD åtgärden genom att lägga till 1/10 volym av glycin 1,25 M (1 mL per 10 mL PARAFORMALDEHYD lösning); agitera 5 min vid RT.
    5. Kassera massmedia vid aspiration och skölj två gånger (5 min) med 1 X medium volymen av PBS.
    6. Lägga till en volym av PBS som motsvarar 1/10 av volymen av media, samla celler med en cell skrapan och överför sedan till ett centrifugrör.
    7. Snurra på 510 g vid 4 ° C i 5 min.
    8. Ta bort så mycket supernatanten som möjligt.
    9. Lagra pellets på obestämd tid som behövs vid-80 ° C.
  2. Vävnaden Cross-linking
    1. Sätter 5 mg färsk erhållna mus hypofysen vävnad i en lösning av 1% PARAFORMALDEHYD utspätt i PBS (cirka 10 x volym av vävnaden), agitera för 10 min vid RT.
    2. Släcka PARAFORMALDEHYD åtgärden genom att lägga till en 1,25 M glycin lösning (1 mL per 10 mL PARAFORMALDEHYD lösning) och agitera 5 min vid RT.
    3. Ignorera media av aspiration och skölj två gånger med PBS (cirka 10 x volym av vävnaden). Ta bort så mycket supernatanten som möjligt.
    4. Lagra tvärbunden vävnaden på obestämd tid vid-80 ° C.

3. cell eller vävnad Lysis

  1. Förbereda den lyseringsbuffert (50 mM Tris-HCl pH 7.0, 10 mM EDTA, 1% SDS kompletteras med 200 U/mL RNAse inhibitor lösning och en cocktail av proteaser hämmare 5 µL/mL).
  2. För att erhålla lyserat prover utan föregående upptining, återsuspendering den cell pellets eller tvärbunden vävnader med denna buffert (ca 1 mL per 100 mg cellpelleten eller vävnad). En cellpelleten som erhållits från 1 x 107 celler ger upphov till ett lyserat prov innehållande ungefär 20 mg protein.
    Obs: Beroende på vävnaden används, ett steg för mekaniska störningar bör läggas. I det här fallet är det viktigt att undvika uppvärmning av proverna under detta ytterligare steg.

4. ultraljudsbehandling

  1. Optimering av ultraljudsbehandling villkor
    1. Programmera den någon sonikator med 2 till 5 serie av 30 s ON och 30 s OFF.
    2. Utföra tester för att optimera ultraljudsbehandling villkor på utspädda lyserat prover (utspädningsfaktorn ½ eller ¼ motsvarar cirka 10 eller 5 mg protein). Plats efter utspädning lyserat prover i 4 ° C vattenbad och börja ultraljudsbehandling serien.
    3. Rena RNAs antingen med en RNA rening kit eller med ett RNA isolering reagens (t.ex., Trizol).
    4. Ladda totalityen av renat RNA på en 1% agaros gel-elektrofores i TBE buffert, kontrollera längden på RNA fragment. Denna längd bör variera mellan 200 och 800 bp.
      Obs: Beroende RNA fragment storlek, anti känsla oligonukleotiden sonderna effektivitet kan variera. Då rekommenderas att kontrollera effektiviteten i sonderna under olika förhållanden av ultraljudsbehandling.
  2. Ultraljudsbehandling av lyserat proverna
    1. Plats lyserat prover som motsvarar 20 mg av proteiner (erhålls efter steg 3,2) i 4 ° C vatten bad och starta ultraljudsbehandling serien som optimerad i steg 4.1.
    2. Omedelbart efter ultraljudsbehandling, Centrifugera under 5 minuter vid 12 000 g vid 4 ° C. Överföra supernatanterna i nya centrifugrör.
      Obs: För att säkerställa homogenitet, replikerar supernatanterna kan poolade och omfördelas i detta steg.

5. RNA Pull-down

  1. Dag 1 – hybridisering steg
    1. Lägg till 2 volymer av hybridisering buffert (50 mM Tris-HCl pH 7.0, 750 mM NaCl, 1 mM EDTA, 1% SDS, 15% formamid lagt till tillfället) till supernatanterna samlas in efter ultraljudsbehandling steget. Vortex.
    2. Överför 20 µL av varje provet i ett centrifugrör (input prover) och förvaras vid-20 ° C.
    3. Lägga till 100 pmol av biotinylerade oligonukleotiden sonder (specifika eller icke-specifik, se tabell 1) varje prov. Inkubera i 4-6 h under måttlig agitation på en tube rotator på RT.
    4. Tillsätt 50 µL av magnetiska streptividin pärlor kompletteras med 200 U/mL RNAse inhibitor lösning och en cocktail av proteaser hämmare 5 µL/mL.
    5. Inkubera över natten under måttlig agitation på tube rotator på RT.
  2. Dag 2 – RNA isolering steg
    1. Använda magnetiska stöd för att separera pärlor från cell lysate, avlägsna supernatanten och tvätta pärlorna med 900 µL tvättlösning (SDS 0,5%, SSC 2 x). Upprepa varvat 5 gånger med 5 min agitation på rotatorn på RT.
    2. Efter den sista tvättningen, häll upp en sista gång och tillsätt 95 µL av Proteinease K buffert (10 mM Tris-HCl pH 7.0, 100 mM NaCl, 1 mM EDTA, 0,5% SDS) och 5 µL proteinas-K (20 mg/mL) till proverna.
    3. På isen, Tina de ingående proverna (20 μL) och tillsätt 75 µL Proteinease K buffert och 5 µL proteinas-K (20 mg/mL).
    4. Inkubera alla prover med proteinas K för 45 min vid 50 ° C sedan 10 min vid 95 ° C.
    5. Chill provet på is för 3 min innan separera pärlorna från RNAs med magnetiska stöd. Förvara supernatanten och kasta pärlor.
    6. Rena RNAs med en RNA rening kit, som bör innehålla ett DNA matsmältningen steg. Lagra RNAs vid-80 ° C.
    7. Utföra omvänd Transkription qPCR (RT-qPCR) med en RT följt av qPCR med specifika primers (tabell 1).
    8. Konstruera två DNA-bibliotek som motsvarar de två RNA pooler erhålls med var och en av de särskilda Neat1 sonderna (tabell 1). Utföra sekvensering på en nästa generations sekvensering system.

Representative Results

Flera nyare studier har visat att lncRNAs spelar en viktig roll i nästan varje viktig biologisk process och att denna roll uppnås genom kontroll av genuttryck som inträffar både på den transkriptionell och post-transcriptional nivåer visar i det senare fallet att RNAs kan vara målet för lncRNAs6.

LncRNA nukleära berikad riklig avskriften 1 (Neat1) är inblandad i olika neuropathologies som frontotemporal demens, amyotrofisk lateral skleros eller epilepsi8,9,10, och är också misregulated i olika cancerformer11,12.

Detta lncRNA är också känd för att den strukturella komponenten i särskilda kärn organ, paraspeckles, och att vara inblandade i post-transcriptional dygnsrytm gen uttryck13. Paraspeckles som finns i varje cellkärna och bildas runt inte bara Neat1, vilket är nödvändigt för deras bildning, men också runt flera RNA-bindande proteiner (RBP)14, är verkligen kända för att kunna behålla RNA mål inom kärnan15 . Bildandet av paraspeckles uppnås genom föreningen av de olika komponenterna. Denna formation visades att visa en dygnsrytm rytmiska mönster körning en rytmisk kärnkraft lagring av RNA mål13. Nukleära lagring av RNA mål av paraspeckles kan uppstå genom bindning till RBP eller direkt via RNA/RNA association, men omfattningen av RNAs riktade av paraspeckles skulle fastställas. Att identifiera RNA riktade direkt eller indirekt av Neat1, en RNA nedrullningsbara protokollet var utformat som gör att isolering och identifiering av alla Neat1 RNA mål i odlade celler samt som i vävnadsprover (se figur 1 för en grafisk presentation av tekniken).

Protokollet var också tillämpats för identifiering av RNA målen i en en annan lncRNA metastaser associerade lunga adenokarcinom avskrift 1 (Malat1). Malat1 är en mycket bevarat och uttryckt lncRNA Funna i nukleära fläckarna tillsammans med flera RNA skarvning faktorer. Malat1 är kända för att vara inblandade i regleringen av den skarvning av flera begynnande pre-mRNA16,17.

Specifika (SO) och icke-specifik oligonukleotiden (NSO) sonder genererades med sonden design strategin beskrivs här. Denna strategi bygger på val av regioner som visar en låg sannolikhet för interna base ihopkoppling som förutspådde av det sekundära strukturerar av lncRNA och utformningen av särskilda sonder med en stark affinitet för dessa regioner. Som ett representativt resultat av dessa bioinformatik förutsägelser, en bild av den förutspådda sekundärt strukturen av en sekvens av Neat1 (1 480 till 2.000 nukleotider) tillsammans med placeringen av två utformad så sonder ges i figur 2.

Designade sonderna riktades till råtta Neat1 eller Malat1 för GH4C1 odlade celler och musen Neat1 för hypofysen vävnad extrakt (tabell 1). Den relativa anrikningen i Neat1 eller Malat1 har beräknats för ospecifika och specifika sonder i förhållande till de ingående proverna. Figur 3 visar effektiviteten av de särskilda sonderna till pull-down Neat1 hos råtta GH4C1 hypofysen cellinje (figur 3A) och i mus hypofysen vävnad extrakt (figur 3B). När med sonden design-protokollet för att generera särskilda oligonukleotiden (så) sonder riktad till Malat1, kasseras en effektiv sonden erhölls medan en annan inte var tillräckligt effektiv och (figur 4A).

Efter en RNA nedrullningsbara procedur följt av RT-qPCR experiment, vissa RNAs bedömas med särskild grundfärg (tabell 1) visats vara associerade med Neat1 eller Malat1 i GH4C1 extrakt. RNASEN associerade med Neat1 i GH4C1 cell extrakt visades också att förknippas med Neat1 i hypofysen vävnad extrakt. Faktiskt, efter Neat1 RNA pull-down, Malat1 befanns vara riktad av Neat1 både i raden GH4C1 cellen och i hypofysen mus vävnad extrakt (figur 5A). Neat1 var ömsesidigt, avsevärt berikad efter Malat1 RNA nedrullningsbara utfört med en specifik sond i GH4C1 celler (figur 4B). Genom att betona det nära sambandet mellan de två lncRNAs, dessa resultat är förenliga med den potentiella samreglerande rollen som Neat1 och Malat1 som föreslagits av Malat1 knockoutmöss som visar variationer i Neat1 RNA uttryck18, 19. avskrifter av två huvudsakliga hypofysen hormoner, tillväxthormon (Gh) (figur 5B) och prolaktin (Prl) (figur 5 c) berikades betydligt efter Neat1 RNA pull-down med särskilda sonder i både GH4C1 celler och hypofysen extrakt, vilket tyder på en eventuell reglering av två hormoner av Neat1. När man jämför de två särskilda sonder används, visade det sig att deras effektivitet kan variera beroende på RNA målet ansåg (figur 5B och figur 5 c). Dessa resultat belysa behovet av att utforma flera särskilda sonder för att välja de visar inte bara den bästa effektiviteten i anrikningen av den nedrullningsbara lncRNA, men också den bästa effektiviteten i anrikningen av målen RNA.

Den RNA pull-down-metoden kan också följas av RNA hög genomströmning sekvensering att erhålla omfattande listan över RNA mål av ett lncRNA intresse13. En RNA-seq analys på GH4C1 hypofysen celler efter Neat1 RNA pull-down med hjälp av de två särskilda sonder som beskrivs ovan utfördes. Det bör noteras att en negativ kontroll med hjälp av en NSO också kunde genomgå RNA-seq analys, om nivån på RNA återhämtat sig efter den RNA nedrullningsbara med NSO är tillräcklig för att möjliggöra byggandet av bibliotek. Detta var inte fallet i tidigare erfarenhet13. Bibliotek som har skapats efter användning av särskilda sonder analyserades med hjälp av Tophat/manschettknappar pipeline-20 och endast avskrifter med värden av fragmentet per kilobase per miljoner av mappade läser (FPKM) högre än 1 beaktades. Listorna erhålls med de två särskilda sonder som riktas till Neat1 (tabell 1) korsades för att bedöma resultaten specificitet. 4.268 gener som är associerade med paraspeckles, som utgjorde 28% av uttryckt avskrifter i GH4C1 celler13påträffades. Överensstämmer med resultat som erhållits med qPCR-analys (Figur 5A-C), avskrifter av Gh, Prl och Malat1 befanns vara associerade med Neat1. Den RNA pull-down-metoden har därför visat sig vara ett effektivt verktyg för att utforska samspelet mellan lncRNAs och deras RNA mål.

Figure 1
Figur 1: grafisk representation av RNA dra ner förfarande. Den första dagen, var celler eller vävnader tvärbunden med paraformaldehyd, lyserat och sonicated innan steget hybridisering som utfördes genom att lägga till biotinylerade särskilda sonder. Magnetiska streptividin pärlor har sedan lagts till separat visst material från resten av cellen lysate. Den andra dagen, var pärlor isolerade av en magnet och tvättas flera gånger. Ett de-crosslinking steg tillåtna återvinning av RNAs som renas och användes för RT-qPCR eller RNA-seq analys. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: sekundärt strukturera av en Neat1 sekvens (nukleotid 1 480 till 2.000) som förutspådde av bioinformatik resurs (den RNAstructure webservern, lägsta fria energistruktur). Strukturen är färgad enligt graden av sannolikhet för bas ihopkoppling. De två oligonukleotider sonderna (SO1 och SO2) i rött är placerade längs den Neat1 RNA-strukturen. Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3: qPCR validering av Neat1 anrikning kontra input. qPCR validering av Neat1 anrikning kontra ingång efter Neat1 RNA dra ner av två olika särskilda sonder (SO1-rn och SO2-rn för GH4C1 celler och SO1-mm och SO2-mm för hypofysen vävnad) jämfört med en icke-specifik en (NSO-rn för GH4C1 celler och NSO-mm för hypofysen vävnad) i GH4C1 rat celler (A) och i mus hypofysen vävnad extrakt (B). Resultaten är medelvärde ± SEM erhållits i 3 till 10 experiment. Klicka här för att se en större version av denna siffra.

Figure 5

Figur 4: qPCR validering av Malat1 och Neat1 anrikning kontra ingång efter Malat1 RNA dra ner. qPCR validering av Malat1 (A) och Neat1 (B) berikning kontra ingång efter Malat1 RNA dra ner av två olika särskilda sonder (SO3-rn och SO4-rn) jämfört med en icke-specifik en (NSO-rn) i GH4C1 rat celler. Resultaten är medelvärde ± SEM erhållits i 3 experiment. Klicka här för att se en större version av denna siffra.

Figure 4
Figur 5: qPCR validering av Malat1, Gh, Prl berikning kontra ingång efter Neat1 RNA dra ner. qPCR validering av Malat1 (A), Gh (B), Prl (C) berikning kontra ingång efter Neat1 RNA dra ner med hjälp av olika särskilda sonder jämfört med en icke-specifik en i GH4C1 rat celler och mus hypofysen vävnad extrakt. Resultaten är medelvärde ± SEM erhållits i 3 till 8 experiment. Klicka här för att se en större version av denna siffra.

SONDEN NAMN Sekvenser
NSO-Rn TAAAATACCATTTGATGTTTGAAATTAT
SO1-Rn CTCCACCATCATCAATCCTCTGGAC
SO2-Rn GCCTTCCCACATTTAAAAACACAAC
SO3-Rn AACTCGTGGCTCAAGTGAGGTGACA
SO4-Rn AAGACTCTCAGGCTCCTGCTCATTC
NSO-mm GTTTGTGGTTTAACAGTGGGAAGGC
SO1-mm GCCTTCCCACTGTTAAACCACAAAC
SO2-mm CTCACCCGCACCCCGACTCCTTCAA
qPCR GRUNDFÄRGER:
Rattus norvegicus
Neat1 AAGGCACGAGTTAGCCGCAAAT
TGTGCACAGTCAGACCTGTCATTC
Malat1 GAAGGCGTGTACTGCTATGCTGTT
TCTCCTGAGGTGACTGTGAACCAA
Gh1 CCGCGTCTATGAGAAACTGAAGGA
GGTTTGCTTGAGGATCTGCCCAAT
PRL TGAACCTGATCCTCAGTTTGGT
AGCTGCTTGTTTTGTTCCTCAA
Mus musculus
Neat1 TGGGCCCTGGGTCATCTTACTAGATA
CACAGCTGTTCCAATGAGCGATCT
Gh1 CTCGGACCGTGTCTATGAGAAACTGA
TTTGCTTGAGGATCTGCCCAACAC
PRL TGAACCTGATCCTCAGTTTGGT
AGCTGCTTGTTTTGTTCCTCAA

Tabell 1: Sekvenser av DNA oligonukleotiden sonder och qPCR grundfärger

Discussion

Långa icke-kodande RNAs (lncRNAs) av deras antal och mångfald representerar ett stort fält av forskning och de flesta av sina roller är fortfarande att bli upptäckta. Många av dessa lncRNAs har en cellkärnelokalisering och bland dem, några är inblandade i rättsliga vägar av genuttryck med transkriptionell eller postttransskriptionell mekanismer. En av de nuvarande utmaningarna på detta område är att förstå betydelsen av dessa lncRNAs post-transcriptional bearbetning av RNAs. För detta ändamål måste RNAs riktade av lncRNAs identifieras. Inspirerad av tidigare studier fokuserat på sambandet mellan lncRNAs och kromatin, utvecklade vi ett förfarande som möjliggör identifiering av RNAs associerade med ett lncRNA. Framgången av detta protokoll, heter RNA pull-down, beror främst på två avgörande steg, nämligen utformningen av anti känsla DNA oligonukleotiden sonder som har till specifikt och uteslutande hybridisera med lncRNA sevärdheter och villkoren för vävnad eller cell fixering som måste bevara integriteten i nätverket mellan alla molekylär partner.

Tidigare publicerade protokoll anges förfaranden för att isolera ett lncRNA tillsammans med dess associerade kromatin-sekvenser (ChIRP1,2, diagram3,4). I dessa protokoll användes olika strategier till design den anti känsla DNA biotinylerade oligonukleotiden sonder. I förfarandet för ChIRP använde författarna en pool av DNA biotinylerade oligonukleotiden sonder som omfattar hela längden av lncRNA sevärdheter efter uteslutning av alla överflödiga och icke-specifika sonder1,2. I diagram protokollet, författarna identifierat de regioner i lncRNA som är mer tillgängliga för hybridisering och utformade fånga oligonukleotider som riktar dessa regioner. Dessa regioner har valts ut på grundval av deras RNase-H känslighet. Faktiskt använda egenskapen för RNAse-H för att hydrolysera RNAs på platser av RNA-DNA-bindning, de oligonukleotider som hybridiserar till tillgängliga platser i lncRNA producera RNA-DNA hybrider och leda till enzymatisk klyvning av lncRNA. Författarna valde tre av dessa kandidat fånga oligonukleotider och använde dem i en cocktail3,4.

Förfaranden som vi brukade design anti känsla DNA biotinylerade oligonukleotiden sonderna var nära som används i diagrammet protokollet, men de önskade lncRNA hybridisering-tillgängliga regionerna inte valdes på grundval av deras RNAse-H känslighet, men enligt deras låg sannolikhet att inre bas parning som bestäms av bioinformatik modellering av lncRNA sekundärt strukturera. Det måste märkas att olika sekundära strukturer kommer förutsägas med hjälp av olika algoritmer och sonder väljas bör vara de som hybridiserar till tillgängliga sekvenser av lncRNA största antal sekundära strukturer förutspådde. Samma resultat erhölls med antingen en cocktail av tre utformad, särskilda sonder eller en enda sond individuellt. Detta föranledde användningen av två separata, särskilda sonder och beaktande av positiva resultat som de som är gemensamma för dessa två sonder. Slutligen, det rekommenderas därför i början av utvecklingen av metoden för ett optimalt resultat och för att kunna bedöma resultaten av pull-down, att utforma 3 olika anti känsla oligonukleotiden specificitet sonder och sedan jämför experimentellt deras effektivitet, särskilt eftersom sonden effektivitet får ändras av cell lysate beredning. Dock tillvägagångssättet av sonden design baserad på bioinformatik modellering av lncRNA sekundära struktur vi använde förblev billigare än som baserat på pooler av plattsättning oligonukleotiden sonder2, och detta var mindre tidskrävande än metoden baserat på RNAse-H känslighet4.

En negativ kontroll bör också utföras med som negativ fånga oligonukleotiden antingen den känsla DNA biotinylerade oligonukleotiden sonder eller äggröra oligonukleotiden sonder eller oligonukleotider riktade mot en icke-närstående RNA. På grund av förekomsten av naturliga antisense avskrifter lncRNAs, kan användning av känsla oligonukleotiden sonder ibland vara otillräcklig. Oavsett oligonukleotiden sonden valts för den negativa kontrollen, är det nödvändigt att kontrollera av blast som det inte hybridiserar med en känd RNA och Tänk på att denna oligonukleotid kan hybridisera till ett fortfarande un-kommenterad lncRNA.

De cell-lysates som används i dessa RNA nedrullningsbara experiment erhölls från 106 107 celler när du arbetar med odlade celler, och från 1 till 10 mg när du arbetar med vävnad. Beredning av cell lysates måste anpassas beroende på vävnads- eller typ som används med två steg som behöver optimeras: nämligen det tvärbindande steg som tillåter bildandet av kovalenta bindningar mellan lncRNA och dess molekylära partner, och den ultraljudsbehandling steg som minskar viskositeten genom fragmentering kromatin.

Syftet med det tvärbindande steget är att säkerställa att alla RNA mål förblir stängd för lncRNA genom att inducera bildandet av ett nätverk mellan alla molekylär partner. En PARAFORMALDEHYD behandling steg som kommer att bilda kovalenta bindningar mellan lncRNA och dess partner kan nätverket vara nätstruktur. I diagram protokollet, det föreslogs om arbetar med kärnkraft lncRNA, för att utföra en första behandling med PARAFORMALDEHYD på hela cell lysate och en andra behandling på isolerade nucleic bråkdel3,4. Vi konstaterade att detta kompletterande steg minskat effektiviteten i sonderna, förmodligen genom att minska lncRNA tillgängligheten i cellerna. Därför graden av gårdslokaliserade av PARAFORMALDEHYD måste anpassas med hänsyn till cellen eller vävnadstyp används, lokalisering av lncRNA sevärdheter och effektiviteten av de designade sonderna.

Samtidigt lyseringslösning cellerna, kromatinet släpps i den lysate och ökar dess viskositet; Det är då nödvändigt att strimla kromatinet av ultraljudsbehandling att öka rörligheten på proverna och därmed underlätta tillgängligheten till oligonukleotiden sonder till lncRNA sevärdheter. Ultraljudsbehandling kommer dock också strimla RNASEN extraheras med lncRNA sevärdheter. Det är då viktigt att minimera den ultraljudsbehandling tid på ett sådant sätt att det minskar effektivt viskositeten hos den lysate, det tillåter också obtainmenten av RNA fragment med en längd består mellan 200-800 bp. Observera att ultraljudsbehandling tiden kommer att vara mycket beroende av både kvantitet och typ av vävnad eller odlade celler används.

Sammanfattningsvis kan det förfarande som beskrivs här i 2-3 dagar tillfångatagandet av RNA målen i en önskad lncRNA. Tillsammans med RT-qPCR, tillåter dessa metoder söker en specifik association och reglering av en mRNA av den önskade lncRNA som en kandidat. En genome-wide strategi, kan RNA nedrullningsbara experiment analyseras med hög genomströmning RNA-sekvensering tillåta hämtning av alla RNAs associeras med de önskade lncRNA. Oavsett analytiska strategin, bör RNA nedrullningsbara förfarandet ge nya betydande kunskaper om RNA förordning av lncRNAs.

Disclosures

Författarna har något att avslöja.

Acknowledgments

Detta arbete stöddes av Aix-Marseille universitet och CNRS och finansieras av ett bidrag från Pfizer laboratorier.

Materials

Name Company Catalog Number Comments
Bioruptor Plus Diagenode B01020001 Sonicator
Dynabeads My One Thermo-Fisher 65001 Magnetic streptavidin beads
Formamide Thermo-Fisher 15515-026
Gel electrophoresis apparatus Advance Mupid-One Gel electrophoresis apparatus
Proteinase K Sigma P2308
RNA XS purification kit Macherey-Nagel 740902 RNA purificationkit
RNAseOUT Thermo-Fisher 10777-019 RNAse inhibitor
Trizol Thermo-Fisher 15596018 RNA purification
Tube Rotator Stuart SB2 Eppendorf tube rotator
RNA to DNA Thermo-Fisher 4387405 Reverse transcription kit
iTaq Universal SYBR Green Supermix BioRad 1725124 qPCR reagent
Applied 7500 Fast Thermo-Fisher 4351107 qPCR apparatus
Illumina TruSeq Stranded mRNA Sample Preparation kit Illumina 20020594 DNA library construction kit
Illumina NextSeq 500 Illumina SY-415-1002 NGS system

DOWNLOAD MATERIALS LIST

References

  1. Chu, C., Qu, K., Zhong, F. L., Artandi, S. E., Chang, H. Y. Genomic maps of long noncoding RNA occupancy reveal principles of RNA-chromatin interactions. Mol Cell. 667-678 (2011).
  2. Chu, C., Quinn, J., Chang, H. Y. Chromatin isolation by RNA purification (ChIRP). J Vis Exp. e3912 (2012).
  3. Simon, M. D., Wang, C. I., Kharchenko, P. V., West, J. A., Chapman, B. A., Alekseyenko, A. A., Borowsky, M. L., Kuroda, M. I., Kingston, R. E. The genomic binding sites of a noncoding RNA. Proc Natl Acad Sci U S A. 20497-20502 (2011).
  4. Simon, M. D. Capture hybridization analysis of RNA targets (CHART). Curr Protoc Mol Biol. Unit 21.25 (2013).
  5. Reuter, J. S., Mathews, D. H. RNAstructure: software for RNA secondary structure prediction and analysis. BMC Bioinformatics. 11, 129 (2010).
  6. Sun, X., Haider Ali, M. S. S., Moran, M. The role of interactions of long non-coding RNAs and heterogeneous nuclear ribonucleoproteins in regulating cellular functions. Biochem J. 2925-2935 (2017).
  7. Gruber, A. R., Lorenz, R., Bernhart, S. H., Neuböck, R., Hofacker, I. L. The Vienna RNA websuite. Nucleic Acids Res. W70-W74 (2008).
  8. Tollervey, J. R., Curk, T., Rogelj, B., Briese, M., Cereda, M., Kayikci, M., König, J., Hortobágyi, T., Nishimura, A. L., Zupunski, V., Patani, R., Chandran, S., Rot, G., Zupan, B., Shaw, C. E., Ule, J. Characterizing the RNA targets and position-dependent splicing regulation by TDP-43. Nat Neurosci. 452-458 (2011).
  9. Riva, P., Ratti, A., Venturin, M. The long non-coding RNAs in neurodegenerative diseases: novel mechanisms of pathogenesis. Curr Alzheimer Res. (27338628), (2016).
  10. Barry, G., Briggs, J. A., Hwang, D. W., Nayler, S. P., Fortuna, P. R., Jonkhout, N., Dachet, F., Maag, J. L., Mestdagh, P., Singh, E. M., Avesson, L., Kaczorowski, D. C., Ozturk, E., Jones, N. C., Vetter, I., Arriola-Martinez, L., Hu, J., Franco, G. R., Warn, V. M., Gong, A., Dinger, M. E., Rigo, F., Lipovich, L., Morris, M. J., O'Brien, T. J., Lee, D. S., Loeb, J. A., Blackshaw, S., Mattick, J. S., Wolvetang, E. J. The long non-coding RNA NEAT1 is responsive to neuronal activity and is associated with hyperexcitability states. Sci Rep. 40127 (2017).
  11. Adriaens, C., Standaert, L., Barra, J., Latil, M., Verfaillie, A., Kalev, P., Boeckx, B., Wijnhoven, P. W., Radaelli, E., Vermi, W., Leucci, E., Lapouge, G., Beck, B., van den Oord, J., Nakagawa, S., Hirose, T., Sablina, A. A., Lambrechts, D., Aerts, S., Blanpain, C., Marine, J. C. p53 induces formation of NEAT1 lncRNA-containing paraspeckles that modulate replication stress response and chemosensitivity. Nat Med. (2016).
  12. Fang, J., Qiao, F., Tu, J., Xu, J., Ding, F., Liu, Y., Akuo, B. A., Hu, J., Shao, S. High expression of long non-coding RNA NEAT1 indicates poor prognosis of human cancer. Oncotarget. (2017).
  13. Torres, M., Becquet, D., Blanchard, M. P., Guillen, S., Boyer, B., Moreno, M., Franc, J. L., François-Bellan, A. M. Circadian RNA expression elicited by 3'-UTR IRAlu-paraspeckle associated elements. Elife. (2016).
  14. Fox, A. H., Lamond, A. I. Paraspeckles. Cold Spring Harbor Perspectives in Biology. Available from: http://cshperspectives.cshlp.org/content/2/7/a000687.long (2010).
  15. Chen, L. L., DeCerbo, J. N., Carmichael, G. G. Alu element-mediated gene silencing. EMBO J. 1694-1705 (2008).
  16. Tripathi, V., Ellis, J. D., Shen, Z., Song, D. Y., Pan, Q., Watt, A. T., Freier, S. M., Bennett, C. F., Sharma, A., Bubulya, P. A., Blencowe, B. J., Prasanth, S. G., Prasanth, K. V. The nuclear-retained noncoding RNA MALAT1 regulates alternative splicing by modulating SR splicing factor phosphorylation. Mol Cell. 925-938 (2010).
  17. Engreitz, J. M., Sirokman, K., McDonel, P., Shishkin, A. A., Surka, C., Russell, P., Grossman, S. R., Chow, A. Y., Guttman, M., Lander, E. S. RNA-RNA Interactions Enable Specific Targeting of Noncoding RNAs to Nascent Pre-mRNAs and Chromatin Sites. Cell. 188-199 (2014).
  18. Nakagawa, S., Ip, J. Y., Shioi, G., Tripathi, V., Zong, X., Hirose, T., Prasanth, K. V. Malat1 is not an essential component of nuclear speckles in mice. RNA. (2012).
  19. Zhang, B., Arun, G., Mao, Y. S., Lazar, Z., Hung, G., Bhattacharjee, G., Xiao, X., Booth, C. J., Wu, J., Zhang, C., Spector, D. L. The lncRNA Malat1 is dispensable for mouse development but its transcription plays a cis-regulatory role in the adult. Cell Rep. 111-123 (2012).
  20. Trapnell, C., Roberts, A., Goff, L., Pertea, G., Kim, D., Kelley, D. R., Pimentel, H., Salzberg, S. L., Rinn, J. L., Pachter, L. Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat Protoc. 562-578 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics