Магнитные активированный ячейку Сортировка стратегии изоляции и очищают синовиальной жидкости производные мезенхимальных стволовых клеток из кролика модели

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Эта статья представляет простой и экономического протокола для простой изоляция и очищение мезенхимальных стволовых клеток из Новой Зеландии белый кролик синовиальной жидкости.

Cite this Article

Copy Citation | Download Citations

Jia, Z., Liang, Y., Li, X., Xu, X., Xiong, J., Wang, D., Duan, L. Magnetic-Activated Cell Sorting Strategies to Isolate and Purify Synovial Fluid-Derived Mesenchymal Stem Cells from a Rabbit Model. J. Vis. Exp. (138), e57466, doi:10.3791/57466 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Мезенхимальных стволовых клеток (МСК) являются источником основной ячейки для терапии на основе ячеек. MSCs от суставная полость синовиальной жидкости могут потенциально использоваться для хряща тканевой инженерии. MSCs с синовиальной жидкости (SF-MSCs) рассматривались в качестве перспективных кандидатов для регенерации суставного, и их потенциальных терапевтических выгод сделало их важной исследовательской темы в последнее время. SF-MSCs от колена полости Новой Зеландии белый кролик могут использоваться как оптимизированный трансляционная модель для оценки человека регенеративной медицины. С помощью на основе CD90 магнитные активированных клеток Сортировка (ПДК) технологии этот протокол успешно получает кролик SF-MSCs (rbSF-MSCs) от этой модели кролика и далее в полной мере демонстрирует MSC фенотип этих клеток, вызывая их различать в остеобласты, адипоциты и хондроцитов. Таким образом этот подход может быть применен в биологии исследования клеток и тканевой инженерии с использованием простой оборудования и процедур.

Introduction

MSCs были предложены как ценный источник для регенеративной медицины, особенно для поражения хряща. MSCs, включая хондроцитов, остеобласты, адипоциты, скелетные миоциты и висцеральных стромальные клетки, широко расширить области для трансплантации стволовых клеток из-за их высокой расширение скорость и несколькими линии дифференциации потенциальных1. МСК могут быть изолированы от скелетных мышц, синовиальной оболочки, костного мозга и жировой ткани2,3,4. Выводы также выясняется наличие MSCs в синовиальной жидкости, и предыдущие исследования выявили синовиальной жидкости производные MSCs (SF-MSCs) как перспективных кандидатов для регенерации суставного5,6.

Однако исследования и доклинические экспериментов на образцах подвергаются многие этические вопросы. Вместо этого кролики были и продолжают оставаться наиболее часто используемых видов животных, чтобы продемонстрировать, что трансплантация МСК можно отремонтировать повреждение хряща. В последние годы все большее число ученых изучили кролик мезенхимальных стволовых клеток (rbMSCs) как в пробирке и в естественных условиях, как эти клетки являются похож на человека MSCs в их клеточной биологии и тканей физиологии. Аналогично rbMSCs способны придерживаться пластиковых поверхностей, отображение шпинделя фибробластов морфологии как человека MSCs. Кроме того кролик мезенхимальных образцы являются простыми и легко получить7. Кроме того наиболее важные вопросы, что rbMSCs Экспресс поверхностных маркеров, например, CD44, CD90 и CD105, и что сохраняется мульти линии дифференциация потенциал, который согласуется критерии для идентификации населения MSC определяется международным обществом клеточной терапии8,9. В частности синовиальной жидкости chondroprogenitors способны не гипертрофическая chondrogenesis когда индуцированных TGF-β1, таким образом делая их источники подходящую ячейку для фенотипически суставного хряща регенерации10,11, 12.

Однако изоляции SF-MSCs значительно отличается от других тканей, в том числе пуповины, жировой ткани, периферической крови и костного мозга. В настоящее время наиболее распространенных подходов для очистки и сортировки SF-МСК являются проточной цитометрии и иммуномагнитная шарик-сортировка на основе, хотя метод цитометрия потоков требует конкретной среды и весьма дорогостоящих инструментов13.

Эта статья представляет процедура для простой и минимально инвазивной коллекции образцов синовиальной жидкости из Новой Зеландии белого кролика. Во время процедуры rbSF-MSCs, стабильно расширенной в пробирке и затем изолированы с CD90 положительное магнитное процедуры, основанные на шарик. Наконец протокол показывает, как получить MSCs с высокой чистоты и жизнеспособности из заготовленных клеток источников.

В этом протоколе изолированные rbSF-MSCs характеризуются, основанные на их морфологии, выражение определенных маркеров, и плюрипотентности для стволовых клеток. Потока на основе цитометрии Иммунофенотипирование показывает значительное положительное проявление CD44 и CD105, тогда как выражение CD45 и CD34 является отрицательным. Наконец в пробирке assay для rbSF-MSCs демонстрирует остеогенные, адипогенном и хондрогенном дифференциации этих клеток.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Все эксперименты на животных были проведены в соответствии с руководящими принципами регионального комитета по этике, и все животные процедуры были одобрены институциональный уход животных и использование Комитета Шэньчжэнь второй народных больницы, Shenzhen University.

1. изолировать и культура rbSF-MSCs

  1. Подготовка к процедуре животных
    1. Подготовить скелетоподобное Зрелые женщины Новой Зеландии белого кролика для коллекции rbSF-MSCs. выполнить клиническое обследование кроликов за один день до анестезии и arthrocentesis процедуры.
      Примечание: физическое обследование должно включать (2,0-2,5 кг), пол (женщины) и температуры тела, частоты дыхания и пульса. Параметр интервалы для клинически здоровых кроликов, 30-50 мин Частота дыхания, 220-280 мин для частоты сердечных сокращений и 38-39 ° C для температуры тела.
    2. Быстро животных для 6 h перед наркозом.
  2. Препараты и процедуры для животных анестезии
    1. Сдерживать кролика с клеткой (см. Таблицу материалы) и затем вставляют 3% Пентобарбитал натрия в Вену маргинальных уха в дозе 1 мл/кг для общей анестезии.
    2. Место кролика в удобном спинной лежачем положении.
    3. Контроль частоты дыхания, пульс и температура тела кролика во время анестезии.
    4. Используйте офтальмологической мазь на его глазах для предотвращения сухости во время анестезии.
    5. Оценка глубины анестезии, после Guedel в классификации14.
  3. Подготовка для изоляции MSCs и выращивания
    1. Выращивать rbSF-MSCs, подготовить 500 мл коммерческих питательной среды (см. Таблицу материалы) дополнены 10% коммерческих дополнение (см. Таблицу материалы), 10% плода бычьим сывороточным (ФБС) и 1% пенициллина и стрептомицина.
    2. Инкубируйте питательной среды при 37 ° C на водяной бане.
    3. Подготовка 500 мл фосфатный буфер (PBS) для изоляции клеток и клеток стирки.
    4. Подготовка 100 мл изотонический солевой раствор для процедуры arthrocentesis полость коленного сустава.
  4. Коллекция суставной синовиальной жидкости от колена кролика
    1. Выберите область около 5 x 5 см в размере вокруг коленного сустава и бритье волос кролика из этой области, с использованием безопасности электробритвы.
    2. Поочередно, лечить сайт процедура 3 x с повидон йод раствор и 75% этанола. Затем примените стерильные шторы после области тщательно просушить.
    3. Придать 1-2 мл изотонический солевой раствор, используя стерильные шприцы шприц (2 мл), в полости сустава колена из боковых суставной пространства, переместить колено 3-4 x, а затем высосать все синовиальной жидкости при комнатной температуре.
    4. Фильтр fluid синовиальной через 40 мкм нейлон клеток сито для удаления любого мусора в течение 4 ч.
  5. Культура rbSF-МСК
    1. Соберите отфильтрованные fluid в 50 мл пробирок и центрифуги при 1500 об/мин за 10 мин при комнатной температуре.
    2. Отбросить надосадке после центрифугирования, помыть лепешка с PBS, Ресуспензируйте лепешка с полной питательной среды и затем тарелка среднего блюдах 100 мм.
    3. Инкубируйте блюда при 37 ° C в атмосфере увлажненные, содержащих 5% CO2.
    4. После 48 ч пополните блюда со свежими средний удалить любой non сторонник клетки. Замените средство дважды в неделю в течение 2 недель, как проход 0 (P0).
      Примечание: Там должно быть около 1 х 104 адэрентных клеток. Жизнеспособных клеток/мл в SF, / мл1452около 2 x 10.
    5. После 14 дней после первоначального покрытия многие колоний следует сформировали в культуре блюда. Выберите колоний больше 2 мм в диаметре. Марк, где выбранные колонии расположены путем отслеживания их окружности на дне блюдо.
    6. Отказаться от колоний < 2 мм шириной, с использованием клеток скребки. Дайджест отдельных колоний с около 5 мкл трипсин 0.25%, с помощью клонирования цилиндр и передать новое блюдо колониях как проход 1 (P1).
  6. Послеоперационный уход за животными
    1. Следуйте стандартным институциональных оперативные процедуры для послеоперационного мониторинга и восстановления от анестезии.
    2. Контролировать жизненно важные признаки кролик каждые 10 мин, до тех пор, пока он пришел в сознание. Наконец передача сознательных животных в клетке. Не возвращать кролика, которая подверглась хирургии в компании других животных до тех пор, пока он полностью выздоровел.
    3. После операции, лечить сайт с 0.1% повидон йод, 2 x в день в течение 3 дней.

2. CD90-позитивные магнитные активирован ячейку Сортировка (ПДК) rbSF-MSCs и основной культуры

  1. Подготовка образца
    1. Когда клетки достигает около 80% confluency, аспирационная носитель, а затем добавить 1-2 мл 0,25% трипсина-ЭДТА в каждое блюдо.
    2. Инкубируйте блюда для 2-3 мин позволить мобильный отряд.
    3. После того, как отдельные клетки, добавьте равное количество питательной среды для инактивации трипсина.
    4. Передайте суспензию клеток через стрейнер клетки 40 мкм, сбора фильтрата в 15 мл трубку и затем спина вниз клетки на 600 g × 10 мин при комнатной температуре.
    5. Ресуспензируйте Пелле клеток в MACS работает буфер (PBS, рН 7,2, бычий сывороточный альбумин 0,5% и 2 мм ЭДТА) и затем подсчитать ячейки.
  2. Магнитные метки
    Примечание: Сортировать rbSF-MSCs с магнитной активации клеток, сортировка комплект, содержащий столбцы, стенд и сепараторы (см. Таблицу материалы).
    1. Определите номер ячейки, используя Горяева.
    2. Центрифуга суспензию клеток на 300 g × 10 мин при 4 ° C. Полностью удалить супернатант.
    3. 80 мкл буфера ресуспендирования за 107 всего клеток.
    4. Для 107 всего клеток добавьте 20 мкл микрошарики, конъюгированных с моноклональными антителами CD90 анти кролика.
    5. Смешайте магнитные бусы и ячейки равномерно в трубах, а затем инкубировать их в 4 ° C на 15 мин в темноте.
    6. Добавить 1 мл буфера на 107 клеток в трубку и затем центрифуги на 300 g × 10 мин при 4 ° C для мытья клетки. Отбросить надосадке после центрифугирования.
    7. Ресуспензируйте гранулы в 500 мкл буфера на 107 клеток.
  3. Магнитная сепарация
    1. Место столбец с крыльями столбца на фронт в магнитное поле магнитного сепаратора.
    2. Промойте столбце магнитный сепаратор (МС) с 500 мкл буфера за 107 клеток.
    3. Перевести подвеска одну ячейку в столбце. Пусть негативные клетки проходят через магнитное поле, чтобы отменить эти немеченого клетки.
    4. Промойте колонку 1-2 x с 500 мкл буфера за 107 клеток и отбросить потока через.
    5. Перевести столбец в пластиковых пробирок (15 мл).
    6. Добавить 1 мл буфера за 107 ячеек в столбце и немедленно вставьте поршень в столбце для промывки магнитно помеченных клеток.
    7. Повторите выше процедуру с второй столбец MS для повышения чистоты CD90+ клетки, которые могут обогатить eluted дроби.
    8. Центрифуга суспензию клеток на 300 g × 10 мин, аспирационная супернатант и Ресуспензируйте с питательной среды.
  4. Культура CD90+ rbSF-MSCs
    1. Прививать клетки в 100 мм блюда после сортировки магнитные активированных клеток.
    2. Инкубируйте блюда при 37 ° C в инкубаторе увлажненные ячейки с 5% CO2.
    3. Когда достигается 80-90% слияния основной культуры, около 7-10 дней, дайджест адэрентных клеток с 0,25% трипсина-ЭДТА и прохождения их в разведении 1:2 сделать проход 2 (P2).
    4. Используйте тот же метод для передачи клетки проход 3 (P3), которые могут быть использованы для анализов в пробирке .
      Примечание: После очистки и суб-культуры, получены около 1 x 10-7 rbSF-MSCs.

3. Определение rbSF-МСК

  1. Поверхности маркер подтверждения rbSF-МСК подачей cytometry
    1. Когда MSCs 80-90% притока на P3, вымыть клетки с PBS и относиться к ним с 1 мл 0,25% трипсина-ЭДТА. Затем Инкубируйте MSCs при 37 ° C на 2-3 мин до тех пор, пока отдельные клетки.
    2. Урожай ячейки, используя 10 мл PBS, передавать их в коническую пробирку (15 мл) и центрифуги их на 300 g × 5 мин при комнатной температуре.
    3. Выбросите supernatants. Ресуспензируйте Пелле клеток в 500 мкл PBS и перенести его в 1,5 мл трубку.
    4. Инкубировать 1: 100 разрежения конъюгированных FITC и PE-конъюгированных антител (изотипа, FITC-CD34/PE-CD45, FITC-CD105/PE-CD44) за 1 ч в темноте при 4 ° C.
    5. Центрифуга эту смесь на 300 g × 5 мин при комнатной температуре и вымыть клетки дважды с PBS центрифугированием на 300 g × 5 минут каждый раз. Выбросите supernatants.
    6. Ресуспензируйте клетки в 500 мкл PBS, передача суспензию клеток в раунд снизу трубку (5 мл) и проанализировать его с помощью проточный цитометр.
      Примечание: Получение данных на цитометр, с двумя каналами флуоресцирования: 533/30 и 585/40. Каждый изотип флуоресцирование использование isotype управления для регулировки напряжения соответствующий лазерный и значение минимальной силы света, необходимого для получения флуоресценции гистограмму, которая показывает левого и правого краев пика. Соберите как минимум 10 000 событий для статистического анализа.
  2. Multidifferentiation rbSF-МСК
    Примечание: Использование P3 rbSF-MSCs для multidifferentiation анализов в пробирке .
    1. Остеогенные дифференциация
      1. Подготовка среднего Остеогенные индукции: DMEM basic (1 x) содержащий 50 мм L-Аскорбиновая кислота-2-фосфат, 10 мм α-метронидазол, и 100 Нм дексаметазона.
      2. Семя клетки на 103 клеток/см2 в пластине 6-ну тканевые культуры и культуры их в среде Остеогенные индукции.
      3. Изменение среднего индукции каждые 3 дня за 3 недели.
      4. Исправить клетки с 4% формальдегида для 30 мин при комнатной температуре, после завершения дифференциация, запятнать клетки с 1% ализарин красный для 5 минут, а затем вымыть их 3 x с PBS15.
    2. Адипогенном дифференциация
      1. Подготовка среднего адипогенном индукции: DMEM basic (1 x), состоящий из 100 мм индометацина, 10 мг/мл содержит рекомбинантного инсулина человека, дексаметазона 1 мм и 0,5 мм 3-изобутил-1-метилксантина.
      2. Лечить P3 rbSF-MSCs на 3 недели в адипогенном среде индукции.
      3. После 3 недель пятно вакуолей нейтральных липидов, используя O Красного масла для подтверждения адипогенном дифференциации. Исправьте клетки в 4% раствор формальдегида для 30 мин при комнатной температуре и затем промойте их 3 x с PBS16.
    3. Хондрогенном дифференциация
      1. Подготовка среднего индукции хондрогенном: DMEM basic (1 x), состоящая из 10 нг/мл TGFβ1, 1% ее дополнения, 0,35 мм L-пролина, 100 Нм дексаметазона, 50 мм, L-Аскорбиновая кислота-2-фосфат и 1 мм пируват натрия.
      2. Используйте Пелле культивирования для индукции хондрогенном. Центрифуга 5 × 105 P3 rbSF-MSCs на 1500 об/мин за 10 мин в полипропиленовых труб (15 мл) сформировать лепешки.
      3. Культура гранулы за 3 недели с хондрогенном индукции среднего.
      4. Измените носитель каждые 3 дня за 3 недели.
      5. После 3 недель индукции, вставлять ячейки гранулы с парафином, раздел ломтиками 4 мм и выведение их с помощью 0,1% толуидиновый синий для 30 мин при комнатной температуре17.
  3. Общая добыча РНК и анализ количественных реального времени полимеразной цепной реакции (qRT-PCR)
    1. Изолировать всего РНК клеток после индукции дифференцировки 3 недели, с использованием коммерческих РНК добыча комплект (см. Таблицу материалы).
      1. Удалите средство культуры в культуры блюдо и затем добавьте 1 mL реагента изоляции.
      2. Лизируйте клетки путем неоднократных дозирование до тех пор, пока решение однородной. Проинкубируйте его при комнатной температуре в течение 3 мин.
      3. Перенесите lysate клетки в пробки microcentrifuge 1,5 мл.
      4. 100 мкл хлороформ, встряхните его на руку 15 x и инкубировать смесь при комнатной температуре в течение 3 мин.
      5. Центрифуга для трубки на 12000 g × 15 мин при 4 ° C. Перенесите supernatants в новые пробки microcentrifuge 1,5 мл.
      6. Добавьте 500 мкл изопропанола и осадка РНК для 10 мин при комнатной температуре.
      7. Центрифуга на 12 000 × g для 10 minat 4 ° C. Пелле РНК должны быть видны в нижней части трубки.
      8. Удалить супернатант и затем добавить 500 мкл 75% этанола. Кратко вращайте трубу за несколько секунд, чтобы помыть лепешка РНК. Центрифуга на 7500 g × 5 мин при 4 ° C.
      9. Удаление остаточных этанола.
      10. Растворяют гранулы РНК в 10 мкл DEPC воды и поместите трубки на льду.
    2. Реверс транскрибировать всего РНК в cDNA с ДНК-синтез комплекта (см. Таблицу материалы).
      Примечание: Выполните следующие процедуры на льду.
      1. Подготовьте смесь мастер обратной транскрипции.
      2. Добавьте 25 мкл лечение DNase РНК в каждую пробирку с 1 мкг РНК.
      3. Инкубировать смесь при следующих температурах с использованием ПЦР тепловая велосипедист: 26 ° C в течение 10 мин (чтобы случайно hexamers для отжига), 42 ° C по 45 мин (обратная транскрипция) и 75 ° C в течение 10 мин (для инактивации обратная транскриптаза).
      4. Сразу же анализировать результирующие cDNA, Количественная ПЦР в реальном времени, или хранить его при-20 ° C.
    3. Выполните анализ выражения гена с системой Количественная ПЦР в реальном времени.
      1. Используйте Мастер микс qRT-PCR (см. Таблицу материалы) для выполнения ПЦР. Праймеры PCR для GAPDH, Runx2, общ и PPARγ, перечислены в таблице 1.
      2. Вычислите с помощью методаΔΔCT 2экспрессии генов.
      3. Проводить статистический анализ с использованием стандартного статистического программного обеспечения. Используйте независимые t тест для сравнения средств группы.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Изоляция, очистки и культура rbSF-МСК:
Этот протокол использует MACS для изоляции rbSF-MSCs, основанный на выражение MSC поверхности маркера CD90. Диаграмма потока процесса rbSF-MSCs изоляции, очищения и характеристика и протокол культуры в vitro показано на рисунке 1.

Морфология клеток после магнитные активированных клеток, сортировка (ПДК) с CD90:
Во-первых для МАКОВ, immunolabel MSCs с CD90 магнитные бусы. После центрифугирования Ресуспензируйте максимум 107 клеток в 80 мкл помощи сортировки буфера и затем 20 мкл CD90 магнитные бусы, следуют vortexing и инкубации на 4 ° C на 15 мин. После этого вымыть клетки с 1 мл раствора буфере сортировки и Ресуспензируйте их в 500 мкл буфере сортировки. Прежде чем приступить с магнитной сортировки, повторите шаг стирки. Это критический процедура показана на рисунке 2.

До сортировки, сторонником кролик синовиальной жидкости клеточных популяций отображается гетерогенных морфологии, содержащих клеток различных типов и размеров (рис. 3A-C). После MACS клеточных популяций выставлены однородных морфологии. Номер ячейки был увеличен с суб-культуры (рис. 3D-F).

Поверхность характеристики MACS-обогащенный rbSF-MSCs:
Флуоресценции-активированный ячейку Сортировка (FACS) была исполнена MACS с CD90 анализировать обогащения rbSF-MSCs. До МАКОВ популяции клеток состоял из примерно 40% MSCs (Рисунок 4 cD; изотипа элементов в рисунке 4A,B). После Mac обогащенный населения содержится примерно > 99% MSCs (Рисунок 4E,F). Маркеры клеток гемопоэтических линии CD34 и CD45 0.318%, оба редко высказывались после Mac, который является сокращением от их первоначального выражения на 25,9%. Перед выбором, насчитывалось около 28% CD90+ клеток (рис. 4 g); После очистки, около 98% CD90+ клетки были получены (рис. 4 H).

Мультилинейного потенциал дифференциация rbSF-МСК:
Характеризовать способность rbSF-MSCs дифференцироваться в различных линий, таких как остеогенные, адипогенном и хондрогенном клеток, rbSF МСК, обогащенная MACS были одновременно культивировали в среде конкретной дифференциации и в дифференциация среднего без цитокинов в качестве элементов управления. Когда было завершено индукции, линии специфических маркеров были проанализированы по окрашиванию и RT-PCR. Ализарин красный пятнать соединений кальция показали, что минерализованных конкреций сформировали в rbSF-MSCs после 3 недель в условиях Остеогенные индукции (Рисунок 5A). После 3 недель адипогенном индукции накопление липидов богатых вакуоли могут быть обнаружены внутриклеточных нефти O красного окрашивания (Рисунок 5B). 21 дней хондрогенном индукции Пелле ячейки был гистологически assayed с толуидиновый синий пятнать. Клетки позитивные для окрашивания (чтобы протеогликана) были расценены как хондроцитов подобных клеток (рис. 5 c). Подобно к этому результату, количественный анализ экспрессии генов дифференциации потенциальных также доказал возможность дифференциации этих клеток. Уровни выражения общ (хондроцитов маркер), PPARγ (маркер адипогенном) и Runx2 (маркер остеобластов) были upregulated в искусственных условиях. Эти данные оказались Multipotent с дифференциация возможности rbSF-MSCs в trilineages (рис. 5 d).

Figure 1
Рисунок 1: полная схема изоляции, очистки и характеристику SF-MSCs Новой Зеландии белые кролики. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2: протокол для магнитных активированных клеток, сортировка (ПДК) с CD90. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3: морфология монослоя культивируемых rbSF-MSCs до и после MACS как рассмотрении обычных Перевернутый микроскопии. A-C) До сортировки, сторонником кролик синовиальной жидкости клеточных популяций отображения гетерогенности. Они содержат клеток различных типов и размеров, например овал, Лонг шпинделя, короткие шпинделя и севрюга морфология. Основные морфология P2 и P6 является шпинделе морфология (A: P2, B: P3, C: P6). D-F) После Mac с CD90 клеточных популяций экспонат однородных морфологии. С суб-культуры, увеличивает номер ячейки (D: P2, E: P3, F: P6). Шкалы бар = 100 µm. пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 4
Рисунок 4: выявление поверхностных маркеров rbSF-MSC. С помощью анализа цитометрия потоков, rbSF-MSCs являются позитивными для MSC маркеры CD44 и CD105, а негативный для эндотелиальных клеток маркер CD34 и маркер гемопоэтических клеток CD45. До МАКОВ эти клетки имеют низкий уровень положительности CD44 и CD105. Однако после Mac, уровень положительности был высоким. A, B) Эти Топ два изображения показывают изотипа данных элемента управления. C, D) Эти результаты показывают, что прежде чем MACS населения rbSF-MSC состоит из примерно 40% MSC клеток. E, F) После MACS обогащенный населения содержит > 99% MSC клетки. G, H) Эти изображения показывают потока cytometry анализ CD90+ маркер, (G) до и (H) после сортировки MACS. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 5
Рисунок 5: анализ линии специфических маркеров путем пятнать и RT-PCR. A) ализарин красный пятнать демонстрирует, что минерализованных конкреций формируют под Остеогенные индукции 3 недели. B) после 3 недель адипогенном индукции, накопление липидов богатых вакуолей обнаруживается путем пятнать внутриклеточных O Красного масла. C) за 3 недели хондрогенном индукции, клетки Пелле гистологически assayed с толуидиновый синий пятнать. Клетки позитивные для окрашивания (чтобы протеогликана) были расценены как хондроцитов подобных клеток. Шкалы бар = 100 µm. D) после культивирования на 3 недели, относительная мРНК, выражение остеобластов маркеров (Runx2), адипогенном маркеров (PPARγ) и хондрогенном маркеры (Agg) обнаружено. Для всех анализов, p значений < 0.01 считались статистически значимых различий с использованием Крускала-Уоллиса (показано как **). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Гены Вперед грунт (5'-3') Обратный грунт (5'-3')
Runx2 TATGAAAAACCAAGTAGCAAGGTTC GTAATCTGACTCTGTCCTTGTGGAT
ОБЩ GCTACACCCTAAAGCCACTGCT CGTAGTGCTCCTCATGGTCATC
PPARΓ2 GCAAACCCCTATTCCATGCTG CACGGAGCTGATCCCAAAGT
GAPDH GGAGAAAGCTGCTAA ACGACCTGGTCCTCGGTGTA

Таблица 1: Список генов и праймеры, используемые в данном исследовании для количественной ПЦР в реальном времени.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Существование MSCs в синовиальной жидкости обеспечивает альтернативу для терапии на основе ячеек. Предыдущие исследования показали, что травмы сайты содержат большее количество мезенхимальных стволовых клеток в их синовиальной жидкости, которая может быть положительно коррелирует с периода после травмы5. MSCs в синовиальной жидкости может быть полезным для ткани для повышения спонтанные исцеления после травмы18,19. Клиническое применение SF-MSCs редко были охвачены в литературе, главным образом потому, что механизмы SF-MSCs в суставах оставаться неопределенным20. Джонс и др. 21 сообщила, что цифры hSF-MSC в коленных суставах значительно увеличить 7 раз на ранних этапах остеоартроза (ОА). Они думали, что увеличение SF-MSCs может способствовать сохранению физиологического гомеостаза суставов.

Идеальная модель животных является незаменимым инструментом в развитии терапии, используя регенерирующими и трансляционной медицины. Хотя существуют очевидные различия между людьми и кролика, кролика широко используется как животной модели для изучения ткани регенерации7, таким образом, что побудило нас выбирать его как модель для изучения SF-MSCs. Одним из более сложных препятствий в этом начинании является, что изоляции SF-MSCs часто приводит к переменным успехом ставки и низкие колонии частоты, как сообщалось в предыдущих исследований5. Таким образом многочисленные исследователи сосредоточили на показатели успеха и оптимизации изоляции MSCs от SF.

Этот studyeffectively используется процедура MACS для сортировки высокой чистоты и жизнеспособности CD90+ ОМАСКР кролик синовиальной жидкости22. Эта система MACS использует магнитные микрошарики, конъюгированных с весьма специфических антител, в этом случае в сочетании с определенной ячейки поверхностного антигена, CD90 и позволяет для выбора конкретного целевого типа клеток, а именно CD90 выражая клетки. До очистки с CD90 микрошарики мы обычно культуры первичной rbSF-MSCs на 14 дней. В этот период многие колонии формируются в культуре блюда. Этот протокол предполагает выбор колоний больше 2 мм в диаметре. При использовании клонирования цилиндр для отбора колонии, мы тщательно соблюдать его под микроскопом. Единую колонию далее распространяются для очистки.

Во время процесса очистки и разделения CD90 выражая клетки, которые были помечены магнитно привлекает магнитное поле разделителя в столбце, в то время как немеченого клетки проходят через. После стирки столбец удаляется из поля магнитного сепаратора, и клетки-мишени этого eluted из столбца. Этот конкретный MACS microbead подход позволяет изоляции rbSF-MSCs, которые конкретно выразили стволовых клеток поверхности маркеры CD44 и CD105, демонстрируя, что эти изолированные клетки являются мезенхимальные стволовые клетки, вместо того, чтобы гемопоэтических клеток23. Эти чистые rbSF-MSCs может быть культивировали в пробирке над долгое время без каких-либо существенных изменений морфологические особенности и маркер выражения. Кроме того rbSF-MSCs, обогащенная MACS демонстрируют способность Multipotent с дифференциации в нескольких линии клетки, в том числе в хондрогенном, адипогенном и Остеогенные клетки.

Операция MACS легко выполнять протокол и может быть сделано на скамейке23. Кроме того США продуктов питания и медикаментов (FDA) одобрило МАКОВ на основе microbead технологий, и таким образом легко выполнять для клинического применения24. CD90 является отметка поверхности мезенхимальных стволовых клеток, и исследователи показали, что положительные MSCs CD90 имеют лучше хондрогенном дифференциация способность25,26. Характеризуется плюрипотентности MSCs, основанный на словотолковании и выражение определенных маркеров для стволовых клеток27.

Это исследование имеет несколько ограничений. Первый недостаток этого протокола связано с поверхностных маркеров, которые мы рассмотрели. Основываясь на заявление Международного общества клеточной терапии (ИКСТ), минимальные критерии для определения Multipotent с MSCs позитивные для CD90 и CD105, CD44, CD73 и негативные для CD11b, CD14, CD34, CD79a или CD45 и HLA-DR-28. С целью смягчения усилия и затраты, необходимые для проверки всей панели исследователи в этом исследовании тщательно отобраны два негативных маркеров и два положительных маркеров рекомендуется. Во-вторых это занимает много времени для формирования в колониях, которые будут отобраны для дальнейшего изучения. Кроме того гипертрофия является серьезной проблемой во время индукции хондрогенном SF-MSCs в пробирке. На более поздней стадии, гипертрофический хондроцитов всегда Экспресс тип X коллагена (COLX), матрицы металлопротеиназы 13 (MMP13) щелочной фосфатазы (ALP) и связанных с коротышка транскрипции фактор 2 (Runx2)29. Исследования показывают, что культура трехмерной (3D) Пелле, динамичной культуры систем и coculture с хондроцитов пособие для MSC стабильно хондрогенном дифференциация30,31. В этом исследовании Пелле культуры система использовалась для индукции хондрогенном MSC чтобы избежать гипертрофия.

В заключение мы создали простой метод для изоляции и очистки MSCs из суставной полости промывочной жидкости и характеризуется MSCs, получили в нем. Этот протокол обеспечивает платформу для разведки и расследований суставной синовиальной жидкости производные MSCs потенциальной полезности в Роман регенерации совместных стратегий.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы заявляют, что они не имеют никаких финансовых интересов.

Acknowledgments

Это исследование финансово поддержали следующие гранты: естественные науки фонд Китая (№ 81572198; № 81772394); Фонд для строительства высокого уровня медицинской дисциплины Шэньчжэнь университета (№ 2016031638); Фонд медицинских исследований провинции Гуандун, Китай (No. A2016314); Шэньчжэнь науки и технологических проектов (No. JCYJ20170306092215436; LOL JCYJ20170412150609690; LOL JCYJ20170413161800287; LOL SGLH20161209105517753; LOL JCYJ20160301111338144).

Materials

Name Company Catalog Number Comments
Reagents
MesenGro StemRD MGro-500 1703 Warm in 37 °C water bath before use
MesenGro Supplement StemRD MGro-500 M1512 Component of MSCs culture medium
DMEM basic Gibco Inc. C11995500BT MSCs differentiation medium
Isotonic saline solution Litai, China 5217080305 Cavity arthrocentesis procedure reagent
Phosphate-Buffered Saline (PBS) HyClone Inc. SH30256.01B PBS, free of Ca2+/Mg2+
Fetal Bovine Serum (FBS) Gibco Inc. 10099-141 Component of MSCs culture medium
Povidone iodine solution Guangdong, China 150605 Sterilization agent
75% ethanol Lircon, china 170917 Sterilization agent
0.25% Trypsin/EDTA Gibco Inc. 25200-056 Cell dissociation reagent
1% Penicillin-Streptomycin Gibco Inc. 15140-122 Component of MSCs medium
MACS Running Buffer MiltenyiBiotec 5160112089 Containing phosphate-buffered saline (PBS), 0.5% bovine serum albumin(BSA), and 2 mMEDTA
CD90 antibody conjugated MicroBeads MiltenyiBiotec 5160801456 For magnetic activated cell sorting
Sodium pyruvate Sigma-Aldrich P2256 Component of MSCs chondrogenic differentiation
Dexamethasone Sigma-Aldrich D1756 Component of MSCs osteogenic differentiation
ITS BD 354352 1%, Component of MSCs chondrogenic differentiation
L-proline Sigma-Aldrich P5607 0.35 mM, Component of MSCs chondrogenic differentiation
L-ascorbic acid-2-phosphate Sigma-Aldrich A8960 50 mM, Component of MSCs chondrogenic differentiation
3-isobutyl-1-methylxanthine Sigma-Aldrich I5879 0.5 mM, Component of adipogenic differentiation
Indomethacin Sigma-Aldrich I7378 100 mM, Component of adipogenic differentiation
TGFβ1 Peprotech 100-21 10 ng/mL, Component of MSCs chondrogenic differentiation
α-glycerophsphate Sigma-Aldrich G6751 Component of MSCs osteogenic differentiation
CD34 Polyclonal Antibody, FITC Conjugated Bioss bs-0646R-FITC Hematopoietic stem cells marker
Mouse antirabbit CD44 Bio-Rad MCA806GA Thy-1 membrane glycoprotein (MSCs marker)
CD45 (Monoclonal Antibody) Bio-Rad MCA808GA Hematopoietic stem cells marker
CD105 antibody Genetex GTX11415 MSCs marker
Isopropyl alcohol Sigma-Aldrich I9030 Precipitates RNA extraction organic phases
Trichloromethane Wenge, China 61553 Extract total RNA
Trizol Invitrogen 15596-018 Isolate total RNA
SYBR green master mix Takara Bio, Japan RR420A PCR test
cDNA synthesis kit Takara Bio, Japan RR047A Reverse-transcribed to complementary DNA
Alizarin Red Sigma-Aldrich A5533 Staining of calcium compounds
Toluidine Blue Sigma-Aldrich 89640 Staining of cartilaginous tissue
Oil Red O solution Sigma-Aldrich O1391L Lipid vacuole staining
Equipment
MiniMACS Separator MiltenyiBiotec 130-042-102 For magnetic activated cell sorting
MultiStand MiltenyiBiotec 130-042-303 For magnetic activated cell sorting
MS Columns MiltenyiBiotec 130-042-201 For magnetic activated cell sorting
Cell Strainer FALCON Inc. 352340 40 μm nylon
Hemocytometer ISOLAB Inc. 075.03.001 Cell counting
Falcon 100 mm dish Corning 353003 Cell culture dish
Microcentrifuge tube Axygen MCT-150-C RNA Extraction and PCR
Centrifuge Tubes Sigma-Aldrich 91050 Gamma-sterilized
High-speed centrifuge Eppendorf 5804R Centrifuge cells
Carbon dioxide cell incubator Thermo scientific 3111 Cell culture
Real-Time PCR Instrument Life Tech QuantStudio Real-Time quantitative polymerase chain reaction
Flow cytometer BD Biosciences 342975 Cell analyzer
Pipettor Eppendorf O25456F Transfer the liquid
Cloning cylinder Sigma-Aldrich C3983-50EA Isolate and pick individual cell colonies
Sterile hypodermic syringe Double-Dove, China 131010 Arthrocentesis procedure
Rabbit cage Zhike, China ZC-TGD Restrain the rabbit

DOWNLOAD MATERIALS LIST

References

  1. Oreffo, R. O., Cooper, C., Mason, C., Clements, M. Mesenchymal stem cells: lineage, plasticity, and skeletal therapeutic potential. Stem Cell Reviews. 1, (2), 169-178 (2005).
  2. Asakura, A., Rudnicki, M. A., Komaki, M. Muscle satellite cells are multipotential stem cells that exhibit myogenic, osteogenic, and adipogenic differentiation. Differentiation. 68, (4-5), 245-253 (2001).
  3. De, B. C., Dell'Accio, F., Tylzanowski, P., Luyten, F. P. Multipotent mesenchymal stem cells from adult human synovial membrane. Arthritis Rheumatology. 44, (8), 1928-1942 (2001).
  4. Zuk, P. A., et al. Human adipose tissue is a source of multipotent stem cells. Molecular Biology of the Cell. 13, (12), 4279-4295 (2002).
  5. McGonagle, D., Jones, E., English, A., Emery, P. Enumeration and phenotypic characterization of synovial fluid multipotential mesenchymal progenitor cells in inflammatory and degenerative arthritis. Arthritis & Rheumatism. 50, (3), 817-827 (2004).
  6. Jia, Z., et al. Isolation and characterisation of human mesenchymal stem cells derived from synovial fluid by magnetic activated cell sorting (MACS). Cell Biology International. (2017).
  7. Bashir, M., et al. Isolation, culture and characterization of New Zealand white rabbit mesenchymal stem cells derived from bone marrow. Asian Journal of Animal & Veterinary Advances. 10, (8), 13-30 (2015).
  8. Song, X., et al. Differentiation potential of rabbit CD90-positive cells sorted from adipose-derived stem cells in vitro. In Vitro Cellular & Developmental Biology - Animal. 53, (1), 1-6 (2016).
  9. Lee, T. C., et al. Comparison of surface markers between human and rabbit mesenchymal stem cells. PLOS One. 9, (11), e111390 (2014).
  10. Stewart, M. C., Chen, Y., Bianchessi, M., Pondenis, H. Phenotypic characterization of equine synovial fluid-derived chondroprogenitor cells. Stem Cell Biology and Research. 3, (1), (2016).
  11. Prado, A. A. F., et al. Characterization of mesenchymal stem cells derived from the equine synovial fluid and membrane. BioMed Central Veterinary Research. 11, (1), 281 (2015).
  12. Yoshimura, H., et al. Comparison of rat mesenchymal stem cells derived from bone marrow, synovium, periosteum, adipose tissue, and muscle. Cell and Tissue Research. 327, (3), 449-462 (2007).
  13. Wu, C. C., et al. Intra-articular injection of platelet-rich fibrin releasates in combination with bone marrow-derived mesenchymal stem cells in the treatment of articular cartilage defects: an in vivo study in rabbits. Journal of Biomedical Materials Research Part B: Applied Biomaterials. 105, (6), 1536-1543 (2017).
  14. John, T., Lerche, P. Anesthesia and Analgesia for Veterinary Technicians. Mosby Elsevier. St. Louis, Missouri. (2011).
  15. Koyama, N., et al. Pluripotency of mesenchymal cells derived from synovial fluid in patients with temporomandibular joint disorder. Life Sciences. 89, (19-20), 741-747 (2011).
  16. Kim, Y. S., et al. Isolation and characterization of human mesenchymal stem cells derived from synovial fluid in patients with osteochondral lesion of the talus. American Journal of Sports Medicine. 43, (2), 399-406 (2015).
  17. Vereb, Z., et al. Immunological properties of synovial fluid-derived mesenchymal stem cell-like cells in rheumatoid arthritis. Annals of the Rheumatic Diseases. 74, (Suppl 1), A64-A65 (2015).
  18. Matsukura, Y., Muneta, T., Tsuji, K., Koga, H., Sekija, I. Mesenchymal stem cells in synovial fluid increase after meniscus injury. Clinical Orthopaedics & Related Research. 472, (5), 1357-1364 (2014).
  19. Morito, T., et al. Synovial fluid-derived mesenchymal stem cells increase after intra-articular ligament injury in humans. Rheumatology. 47, (8), 1137-1143 (2008).
  20. Hegewald, A. A., et al. Hyaluronic acid and autologous synovial fluid induce chondrogenic differentiation of equine mesenchymal stem cells: a preliminary study. Tissue & Cell. 36, (6), 431-438 (2004).
  21. Jones, E. A., et al. Synovial fluid mesenchymal stem cells in health and early osteoarthritis: detection and functional evaluation at the single cell level. Arthritis & Rheumatism. 58, (6), 1731-1740 (2008).
  22. Makker, K., Agarwal, A., Sharma, R. K. Magnetic activated cell sorting (MACS): utility in assisted reproduction. Indian Journal of Experimental Biology. 46, (7), 491-497 (2008).
  23. Schmitz, B., et al. Magnetic activated cell sorting (MACS) — a new immunomagnetic method for megakaryocytic cell isolation: comparison of different separation techniques. European Journal of Haematology. 52, (5), 267-275 (1994).
  24. Reinhardt, M., Bader, A., Giri, S. Devices for stem cell isolation and delivery: current need for drug discovery and cell therapy. Expert Review of Medical Devices. 12, (3), 353-364 (2015).
  25. Gronthos, S., Zannettino, A. C. W. A method to isolate and purify human bone marrow stromal stem cells. Mesenchymal Stem Cells. Prockop, D. J., Bunnell, B. A., Phinney, D. G. Vol. 449 of Methods in Molecular Biology 45-57 (2008).
  26. Krawetz, R. J., et al. Synovial fluid progenitors expressing CD90+ from normal but not osteoarthritic joints undergo chondrogenic differentiation without micro-mass culture. PLOS One. 7, (8), e43616 (2012).
  27. Ogata, Y., et al. Purified human synovium mesenchymal stem cells as a good resource for cartilage regeneration. PLOS One. 10, (6), e0129096 (2015).
  28. Dominici, M., et al. Minimal criteria for defining multipotent mesenchymal stromal cells: the International Society for Cellular Therapy position statement. Cytotherapy. 8, (4), 315-317 (2006).
  29. Gauci, S. J., et al. Modulating chondrocyte hypertrophy in growth plate and osteoarthritic cartilage. Journal of Musculoskeletal & Neuronal Interact. 8, (4), 308 (2008).
  30. Cooke, M. E., et al. Structured three-dimensional co-culture of mesenchymal stem cells with chondrocytes promotes chondrogenic differentiation without hypertrophy. Osteoarthritis and Cartilage. 19, (10), 1210-1218 (2011).
  31. Fischer, J., Dickhut, A., Rickert, M., Richter, W. Human articular chondrocytes secrete parathyroid hormone-related protein and inhibit hypertrophy of mesenchymal stem cells in coculture during chondrogenesis. Arthritis and Rheumatism. 62, (9), 2696-2706 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics