चुंबकीय-सक्रिय सेल छंटाई रणनीतियों को अलग करने और शुद्ध श्लेष द्रव-व्युत्पंन Mesenchymal एक खरगोश मॉडल से स्टेम कोशिकाओं

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

यह लेख सीधा अलगाव और ंयूजीलैंड सफेद खरगोश श्लेष द्रव से mesenchymal स्टेम कोशिकाओं के शोधन के लिए एक सरल और आर्थिक प्रोटोकॉल प्रस्तुत करता है ।

Cite this Article

Copy Citation | Download Citations

Jia, Z., Liang, Y., Li, X., Xu, X., Xiong, J., Wang, D., Duan, L. Magnetic-Activated Cell Sorting Strategies to Isolate and Purify Synovial Fluid-Derived Mesenchymal Stem Cells from a Rabbit Model. J. Vis. Exp. (138), e57466, doi:10.3791/57466 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Mesenchymal स्टेम सेल (MSCs) कोशिका आधारित चिकित्सा के लिए मुख्य सेल स्रोत हैं । जोड़दार गुहा श्लेष द्रव से MSCs संभवतः उपास्थि ऊतक इंजीनियरिंग के लिए इस्तेमाल किया जा सकता है । श्लेष द्रव (एस एफ-MSCs) से MSCs जोड़दार उत्थान के लिए होनहार उंमीदवार माना गया है, और उनके संभावित चिकित्सीय लाभ उंहें देर से एक महत्वपूर्ण शोध का विषय बना दिया है । एस एफ-ंयूजीलैंड के घुटने गुहा से MSCs सफेद खरगोश मानव अपक्षयी दवा का आकलन करने के लिए एक अनुकूलित शोधों मॉडल के रूप में नियोजित किया जा सकता है । CD90 आधारित चुंबकीय सक्रिय सेल छँटाई (एमएसीएस) प्रौद्योगिकियों के माध्यम से, इस प्रोटोकॉल सफलतापूर्वक खरगोश एस एफ-MSCs (rbSF-MSCs) इस खरगोश मॉडल से प्राप्त करता है और आगे पूरी तरह से उन्हें अंतर करने के लिए उत्प्रेरण द्वारा इन कोशिकाओं के एमएससी phenotype को दर्शाता है osteoblasts, adipocytes, और chondrocytes । इसलिए, इस दृष्टिकोण सेल जीवविज्ञान अनुसंधान और ऊतक इंजीनियरिंग में सरल उपकरण और प्रक्रियाओं का उपयोग कर लागू किया जा सकता है ।

Introduction

MSCs, विशेष रूप से उपास्थि घावों के लिए, अपक्षयी दवा के लिए एक मूल्यवान स्रोत के रूप में सुझाव दिया गया है । chondrocytes, osteoblasts, adipocytes, कंकाल myocytes, और आंत stromal कोशिकाओं सहित MSCs, मोटे तौर पर अपने उच्च विस्तार दर और बहु वंश विभेद संभावित1के कारण स्टेम सेल प्रत्यारोपण के लिए क्षेत्रों का विस्तार । MSCs कंकाल की मांसपेशी, synovium, अस्थि मज्जा, और वसा ऊतक2,3,4से अलग किया जा सकता है । निष्कर्ष भी श्लेष द्रव में MSCs की उपस्थिति confirmed है, और पिछले अनुसंधान श्लेष द्रव-व्युत्पंन MSCs (एस एफ-MSCs) जोड़दार पुनर्जनन5,6के लिए होनहार उंमीदवारों के रूप में पहचान की है ।

हालांकि, मानव नमूनों पर अनुसंधान और नैदानिक प्रयोग कई नैतिक मुद्दों के अधीन हैं । इसके बजाय, खरगोशों गया है और सबसे अधिक इस्तेमाल किया जानवर प्रजातियों के लिए MSCs के प्रत्यारोपण का प्रदर्शन उपास्थि क्षति की मरंमत कर सकते है प्रदर्शित होने के लिए जारी है । हाल के वर्षों में, शोधकर्ताओं की एक बढ़ती हुई संख्या खरगोश mesenchymal स्टेम सेल (rbMSCs) दोनों विट्रो में और vivo मेंअध्ययन किया है, के रूप में इन कोशिकाओं को अपने सेलुलर जीव विज्ञान और ऊतक फिजियोलॉजी में मानव MSCs के समान हैं. इसी तरह, rbMSCs प्लास्टिक सतहों का पालन करने में सक्षम हैं, धुरी-fibroblast मानव MSCs के रूप में आकृति विज्ञान प्रदर्शित । इसके अलावा, खरगोश mesenchymal नमूने सरल और7प्राप्त करने के लिए आसान कर रहे हैं । इसके अतिरिक्त, सबसे महत्वपूर्ण बिंदु है कि rbMSCs एक्सप्रेस ऐसी CD44, CD90 के रूप में सतह मार्करों, और CD105, और है कि बहु वंश भिंनता क्षमता संरक्षित है, जो एमएससी आबादी की पहचान के लिए मानदंड के साथ समझौते में है सेलुलर थेरेपी के लिए इंटरनेशनल सोसायटी द्वारा परिभाषित8,9. विशेष रूप से, श्लेष द्रव chondroprogenitors गैर में सक्षम है hypertrophic chondrogenesis जब TGF द्वारा प्रेरित-β1, इस प्रकार उंहें phenotypically जोड़दार उपास्थि पुनर्जनन10,11के लिए उपयुक्त सेल सूत्रों बनाने, 12.

हालांकि, एस एफ के अलगाव-MSCs गर्भनाल, वसा ऊतक, परिधीय रक्त, और अस्थि मज्जा सहित अंय ऊतकों से बहुत अलग है । वर्तमान में, शुद्धि और एस एफ-MSCs की छंटाई के लिए सबसे आम दृष्टिकोण प्रवाह cytometry और immunomagnetic मनका-छंटाई आधारित हैं, हालांकि प्रवाह cytometry विधि एक विशिष्ट वातावरण और बहुत महंगा उपकरणों13की आवश्यकता है ।

यह लेख ंयूजीलैंड सफेद खरगोशों से श्लेष द्रव के नमूनों की सरल और ंयूनतम इनवेसिव संग्रह के लिए एक प्रक्रिया प्रस्तुत करता है । प्रक्रिया के दौरान, rbSF-MSCs इन विट्रो में विस्तार कर रहे है और फिर CD90 सकारात्मक चुंबकीय मनका आधारित प्रक्रियाओं के साथ अलग । अंत में, प्रोटोकॉल से पता चलता है कि एक उच्च शुद्धता और व्यवहार्यता के साथ MSCs प्राप्त करने के लिए काटा सेल सूत्रों ।

इस प्रोटोकॉल में, अलग rbSF-MSCs उनकी आकृति विज्ञान, विशिष्ट मार्करों की अभिव्यक्ति, और स्टेम सेल के लिए pluripotency के आधार पर विशेषता है । प्रवाह cytometry आधारित immunophenotyping CD44 और CD105 की एक महत्वपूर्ण सकारात्मक अभिव्यक्ति का पता चलता है, जबकि CD45 और CD34 की अभिव्यक्ति नकारात्मक है । अंत में, एक इन विट्रो rbSF के लिए परख-MSCs osteogenic, adipogenic, और इन कोशिकाओं के chondrogenic भेदभाव दर्शाता है ।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

सभी पशु प्रयोगों क्षेत्रीय नैतिकता समिति के निर्देशों के अनुसार आयोजित किए गए थे, और सभी पशु प्रक्रियाओं शेन्ज़ेन दूसरा पीपुल्स अस्पताल, शेन्ज़ेन विश्वविद्यालय के संस्थागत पशु देखभाल और उपयोग समिति द्वारा अनुमोदित किया गया ।

1. अलग और संस्कृति rbSF-MSCs

  1. पशु प्रक्रिया के लिए तैयारियां
    1. rbSF-MSCs के संग्रह के लिए कंकाली परिपक्व महिला ंयूजीलैंड सफेद खरगोश तैयार करते हैं । एक दिन संज्ञाहरण और arthrocentesis प्रक्रिया से पहले खरगोशों के एक नैदानिक परीक्षा प्रदर्शन ।
      नोट: शारीरिक परीक्षाओं वजन (२.०-२.५ किग्रा), लिंग (महिला), और शरीर का तापमान, श्वसन दर, और दिल की दर शामिल होना चाहिए । नैदानिक स्वस्थ खरगोशों के लिए पैरामीटर अंतराल श्वसन दर के लिए 30-50 मिनट, हृदय गति के लिए २२०-२८० मिनट, और ३८-३९ डिग्री सेल्सियस शरीर के तापमान के लिए कर रहे हैं ।
    2. संज्ञाहरण से पहले 6 घंटे के लिए जानवरों फास्ट ।
  2. तैयारी और पशु संज्ञाहरण के लिए प्रक्रिया
    1. एक पिंजरे के साथ खरगोश को नियंत्रित ( सामग्री की तालिकादेखें), और फिर सामान्य संज्ञाहरण के लिए 1 मिलीलीटर/किलो की एक खुराक पर सीमांत कान नस में 3% pentobarbital सोडियम इंजेक्षन ।
    2. एक आरामदायक पृष्ठीय-लेटा हुआ स्थिति में खरगोश प्लेस ।
    3. श्वसन दर, हृदय की दर, और संज्ञाहरण के दौरान खरगोश के शरीर के तापमान की निगरानी ।
    4. संज्ञाहरण के दौरान सूखापन को रोकने के लिए अपनी आंखों पर ophthalmologic मरहम का प्रयोग करें ।
    5. Guedel के वर्गीकरण के बाद संज्ञाहरण की गहराई का आकलन14.
  3. MSCs अलगाव और खेती के लिए तैयारी
    1. rbSF-MSCs खेती करने के लिए, वाणिज्यिक संस्कृति मध्यम के ५०० मिलीलीटर तैयार ( सामग्री की तालिकादेखें) 10% वाणिज्यिक पूरक के साथ पूरक ( सामग्री की तालिकादेखें), 10% भ्रूण गोजातीय सीरम (FBS), और 1% पेनिसिलिन-Streptomycin.
    2. एक पानी के स्नान में ३७ डिग्री सेल्सियस पर संस्कृति माध्यम की मशीन ।
    3. सेल अलगाव और सेल धोने के लिए फॉस्फेट बफर खारा (पंजाब) के ५०० मिलीलीटर तैयार करें ।
    4. तैयार isotonic खारा समाधान के १०० मिलीलीटर घुटने गुहा arthrocentesis प्रक्रिया के लिए ।
  4. खरगोश के घुटने से जोड़दार श्लेष fl यूआईडी का संग्रह
    1. एक क्षेत्र के बारे में 5 x 5 सेमी आकार में घुटने के आसपास का चयन करें और इस क्षेत्र से खरगोश बाल दाढ़ी एक सुरक्षा इलेक्ट्रिक शेविंग का उपयोग कर ।
    2. वैकल्पिक रूप से, povidone आयोडीन समाधान और ७५% इथेनॉल के साथ प्रक्रिया 3x साइट को संक्रमित । फिर, बाँझ पर्दे लागू करने के बाद क्षेत्र अच्छी तरह से सूख गया है.
    3. isotonic खारा समाधान के 1-2 मिलीलीटर सुई, एक बाँझ hypodermic सिरिंज (2 मिलीलीटर) का उपयोग, पार्श्व जोड़दार अंतरिक्ष से घुटने संयुक्त गुहा में, घुटने 3-4x ले जाएँ, और फिर कमरे के तापमान पर सभी श्लेष द्रव बाहर चूसना.
    4. 4 एच के भीतर किसी भी मलबे को हटाने के लिए एक ४० µm नायलॉन सेल छलनी के माध्यम से श्लेष fluid फिल्टर ।
  5. rbSF-MSCs की संस्कृति
    1. ५० मिलीलीटर केंद्रापसारक ट्यूबों में फ़िल्टर्ड fluid लीजिए और १,५०० rpm पर कमरे के तापमान पर 10 मिनट के लिए केंद्रापसारक ।
    2. छोड़ने के बाद supernatant, पंजाबियों के साथ गोली धो, पूरा संस्कृति माध्यम के साथ गोली resuspend, और फिर १०० mm व्यंजन में मध्यम थाली ।
    3. 5% सह2युक्त एक humidified वातावरण में ३७ ° c पर व्यंजन मशीन ।
    4. ४८ ज के बाद, किसी भी गैर अनुयाई कोशिकाओं को दूर करने के लिए ताजा माध्यम के साथ बर्तन की भरपाई । मार्ग 0 (P0) के रूप में 2 सप्ताह के लिए एक सप्ताह में दो बार बदलें ।
      नोट: के बारे में होना चाहिए 1 x 104 अनुयाई कोशिकाओं. एस एफ में व्यवहार्य कोशिकाओं/एमएल के बारे में 2 x 102/mL. है
    5. प्रारंभिक चढ़ाना के बाद 14 दिनों के बाद, कई कालोनियों संस्कृति व्यंजन में गठन किया जाना चाहिए । व्यास में 2 मिमी से बड़ी कालोनियों का चयन करें । मार्क जहां चयनित कालोनियों डिश नीचे पर उनकी परिधि अनुरेखण द्वारा स्थित हैं ।
    6. कक्ष स्क्रैपर का उपयोग करके, कोलन को < 2 mm चौड़ा छोड़ें । ०.२५% trypsin के लगभग 5 µ l के साथ चयनित कालोनियों को डाइजेस्ट करें, एक क्लोनिंग सिलिंडर का उपयोग करके, और कालोनियों को एक नई डिश के लिए गद्यांश 1 (P1) के रूप में स्थानांतरित करें ।
  6. पोस्ट ऑपरेटिव पशु देखभाल
    1. बाद ऑपरेटिव निगरानी और संज्ञाहरण से वसूली के लिए मानक संस्थागत संचालन प्रक्रियाओं का पालन करें ।
    2. खरगोश के महत्वपूर्ण संकेत हर 10 मिनट की निगरानी जब तक यह चेतना फिर से आ गया है । अंत में, पिंजरे में चेतन पशु हस्तांतरण । एक खरगोश है कि अंय जानवरों की कंपनी के लिए सर्जरी आया है जब तक यह पूरी तरह से बरामद किया है वापस मत करो ।
    3. ऑपरेशन के बाद, ०.१% povidone आयोडीन, 2x 3 दिनों के लिए एक दिन के साथ साइट को संक्रमित ।

2. CD90-rbSF-MSCs और प्राथमिक संस्कृति के सकारात्मक चुंबकीय सक्रिय सेल छँटाई (एमएसीएस)

  1. नमूना तैयारी
    1. जब कोशिकाएं लगभग ८०% तक पहुंचती हैं, तो मध् यम को महाप्राण, और फिर प्रत् येक डिश में ०.२५% Trypsin-EDTA की 1-2 mL डालें ।
    2. 2-3 मिनट के लिए व्यंजन मशीन सेल टुकड़ी की अनुमति के लिए ।
    3. एक बार कोशिकाओं अलग कर रहे हैं, trypsin को निष्क्रिय करने के लिए संस्कृति माध्यम के एक बराबर राशि जोड़ें ।
    4. एक ४० µm सेल छलनी के माध्यम से सेल निलंबन पास, एक 15 मिलीलीटर ट्यूब में निस्पंदन इकट्ठा, और फिर कमरे के तापमान पर 10 मिनट के लिए ६०० × जी पर कोशिकाओं नीचे स्पिन ।
    5. एमएसीएस चल बफर (पंजाब, पीएच ७.२, ०.५% गोजातीय सीरम एल्ब्युमिन, और 2 मिमी EDTA) में सेल गोली resuspend और फिर सेल संख्या गिनती ।
  2. चुंबकीय लेबलिंग
    नोट: स्तंभ, एक स्टैंड, और विभाजक युक्त एक चुंबकीय सक्रिय कक्ष छंटाई किट के साथ rbSF-MSCs सॉर्ट ( सामग्री की तालिकादेखें) ।
    1. एक hemocytometer का उपयोग कर कक्ष संख्या निर्धारित करें ।
    2. 4 डिग्री सेल्सियस पर 10 मिनट के लिए ३०० × जी में सेल निलंबन केंद्रापसारक । supernatant को पूरी तरह से महाप्राण ।
    3. 107 कुल कोशिकाओं प्रति resuspension बफर के ८० µ एल जोड़ें ।
    4. 107 कुल कोशिकाओं के लिए, एक मोनोक्लोनल विरोधी खरगोश CD90 एंटीबॉडी के साथ microbeads संयुग्मित के 20 µ एल जोड़ें ।
    5. ट्यूबों में समान रूप से चुंबकीय मोती और कोशिकाओं को मिलाएं, फिर अंधेरे में 15 मिनट के लिए उन्हें 4 डिग्री सेल्सियस पर गर्मी ।
    6. ट्यूब करने के लिए 107 कोशिकाओं प्रति बफर की 1 मिलीलीटर जोड़ें, और फिर यह ३०० × जी पर 10 मिनट के लिए 4 डिग्री सेल्सियस से अधिक कोशिकाओं को धोने के लिए केंद्रापसारक । केंद्रापसारक के बाद supernatant त्यागें ।
    7. 107 कोशिकाओं प्रति बफर के ५०० µ एल में गोली resuspend ।
  3. चुंबकीय जुदाई
    1. स्तंभ को स्तंभ पंखों के साथ सामने की चुंबकीय विभाजक के चुंबकीय क्षेत्र में रखें ।
    2. 107 कोशिकाओं के प्रति बफर के ५०० µ एल के साथ चुंबकीय विभाजक (एमएस) स्तंभ कुल्ला ।
    3. एकल कक्ष निलंबन को स्तंभ में स्थानांतरित । इन अनलेबल्ड कक्षों को छोड़ने के लिए नकारात्मक कक्षों को चुंबकीय फ़ील्ड से पास होने दें ।
    4. 107 कोशिकाओं प्रति बफर के ५०० µ एल के साथ कॉलम 1-2x धो और प्रवाह के माध्यम से त्यागें ।
    5. एक केंद्रापसारक ट्यूब (15 मिलीलीटर) में कॉलम स्थानांतरण ।
    6. स्तंभ के लिए 107 कक्षों प्रति बफ़र की 1 मिलीलीटर जोड़ें, और उसके बाद तुरंत गोताख़ोर के लिए स्तंभ में पुश चुंबकीय लेबल वाले कक्षों को फ्लश करने के लिए ।
    7. CD90+ कोशिकाओं की शुद्धता बढ़ाने के लिए एक दूसरे एमएस कॉलम के साथ aforementioned प्रक्रिया को दोहराएँ, जो eluted अंश को समृद्ध कर सकते हैं.
    8. 10 मिनट के लिए ३०० × जी में सेल निलंबन केंद्रापसारक, महाप्राण supernatant, और यह संस्कृति माध्यम के साथ resuspend ।
  4. CD90 की संस्कृति+ rbSF-MSCs
    1. चुंबकीय सक्रिय सेल छंटाई के बाद १०० mm व्यंजन में कोशिकाओं Inoculate ।
    2. 5% CO2के साथ एक humidified सेल मशीन में ३७ ° c पर व्यंजन की मशीन ।
    3. जब ८०-९०% प्राथमिक संस्कृति का संगम, के बारे में 7-10 दिन में हासिल की है ०.२५% Trypsin-EDTA के साथ अनुयाई कोशिकाओं को पचाने और उंहें एक 1:2 कमजोर पड़ने पर मार्ग 2 (P2) बनाने के लिए ।
    4. एक ही विधि का प्रयोग करें कोशिकाओं को पारित करने के लिए 3 (पी 2), जो इन विट्रो परख के लिए इस्तेमाल किया जा सकता है ।
      नोट: उप संस्कृति और शुद्धि के बाद, लगभग 1 x 107 rbSF-MSCs प्राप्त कर रहे हैं ।

3. rbSF-MSCs की पहचान

  1. प्रवाह cytometry द्वारा rbSF-MSCs की सतह मार्कर पुष्टि
    1. जब MSCs ८०-९०% पी 3 में धाराप्रवाह हैं, पंजाबियों के साथ कोशिकाओं को धोने और उंहें ०.२५% Trypsin-EDTA के 1 मिलीलीटर के साथ व्यवहार करते हैं । फिर, ३७ ° c पर MSCs मशीन 2-3 मिनट के लिए जब तक कोशिकाओं अलग कर रहे हैं ।
    2. फसल पंजाब के 10 मिलीलीटर का उपयोग कर कोशिकाओं, उंहें एक शंकु ट्यूब (15 मिलीलीटर) में स्थानांतरण, और उंहें ३०० × जी में कमरे के तापमान पर 5 मिनट के लिए केंद्रापसारक ।
    3. supernatants को त्यागें । पंजाब के ५०० µ एल में सेल गोली resuspend और एक १.५ मिलीलीटर ट्यूब में स्थानांतरण ।
    4. 4 डिग्री सेल्सियस पर अंधेरे में 1 एच के लिए FITC-संयुग्मित और पीई-संयुग्मित एंटीबॉडी (isotype, FITC-CD34/पीई-CD45, FITC-CD105/पीई-CD44) के 1:100 कमजोर पड़ने की मशीन ।
    5. कमरे के तापमान पर 5 मिनट के लिए ३०० × जी में इस मिश्रण केंद्रापसारक और 5 मिनट के लिए हर बार ३०० × जी में केंद्रापसारक द्वारा पंजाबियों के साथ दो बार कोशिकाओं धो लो । supernatants को त्यागें ।
    6. पंजाब के ५०० µ एल में कोशिकाओं resuspend, एक गोल नीचे ट्यूब (5 मिलीलीटर) में सेल निलंबन हस्तांतरण और एक प्रवाह cytometer का उपयोग कर इसका विश्लेषण.
      नोट: दो प्रतिदीप्ति चैनल से सुसज्जित cytometer पर डेटा प्राप्त करें: 533/30 और 585/40. प्रत्येक isotype प्रतिदीप्ति के लिए, उचित लेजर वोल्टेज को समायोजित करने के लिए isotype नियंत्रण का उपयोग करें, और एक प्रतिदीप्ति हिस्टोग्राम है कि चोटी के दोनों बाएँ और दाएँ किनारों को प्रदर्शित करता है प्राप्त करने के लिए आवश्यक न्यूनतम तीव्रता सेट. सांख्यिकीय विश्लेषण के लिए १०,००० घटनाओं की एक ंयूनतम ले लीजिए ।
  2. Multidifferentiation के rbSF-MSCs
    नोट: का प्रयोग करें p rbSF-MSCs के लिए इन विट्रो multidifferentiation परख ।
    1. Osteogenic विभेद
      1. osteogenic प्रेरण मध्यम तैयार करें: DMEM बुनियादी (1x) युक्त एल के ५० मिमी-ascorbic एसिड-2-फॉस्फेट, 10 मिमी α-glycerophosphate, और डेक्समेतएसॉनी के १०० एनएम ।
      2. बीज एक 6-अच्छी तरह से ऊतक संस्कृति की थाली में 103 कोशिकाओं/सेमी2 पर कोशिकाओं और उंहें osteogenic प्रेरण माध्यम में संस्कृति ।
      3. प्रेरण मध्यम हर 3 दिनों के लिए 3 सप्ताह के लिए बदल जाते हैं ।
      4. कमरे के तापमान पर 30 मिनट के लिए 4% formaldehyde के साथ कोशिकाओं को ठीक करने के बाद भेदभाव पूरा हो गया है, 5 मिनट के लिए 1% Alizarin लाल के साथ कोशिकाओं दाग, और फिर उंहें15पंजाबियों के साथ 3x धो लो ।
    2. Adipogenic विभेद
      1. adipogenic प्रेरण मध्यम तैयार: DMEM बुनियादी (1x) indomethacin के १०० मिमी से मिलकर, रिकॉमबिनेंट मानव इंसुलिन की 10 मिलीग्राम/एमएल, डेक्समेतएसॉनी के 1 मिमी, और 3-isobutyl-1-methylxanthine के ०.५ मिमी ।
      2. adipogenic प्रेरण माध्यम में 3 सप्ताह के लिए p rbSF-MSCs समझो ।
      3. 3 सप्ताह के बाद, तटस्थ लिपिड दाग तेल लाल का उपयोग कर रिक्तिकाएं adipogenic विभेद की पुष्टि करने के लिए हे । कमरे के तापमान पर 30 मिनट के लिए एक 4% formaldehyde समाधान में कोशिकाओं को ठीक करें, और फिर उंहें16पंजाबियों के साथ 3x धो लो ।
    3. Chondrogenic विभेद
      1. chondrogenic प्रेरण माध्यम तैयार करें: DMEM बेसिक (1x) से मिलकर 10 TGFβ1 के एनजी/एमएल, 1% इसके पूरक, एल के ०.३५ मिमी की रेखा, डेक्समेतएसॉनी के एनएम १००, ५० मिमी के एल-ascorbic एसिड-2-फॉस्फेट, और सोडियम पाइरूवेट के 1 मिमी ।
      2. chondrogenic प्रेरण के लिए गोली संवर्धन का प्रयोग करें । 5 × 105 पी 3 पी rbSF-१५०० rpm में 10 मिनट के लिए एक MSCs ट्यूब (15 मिलीलीटर) में एक गोली फार्म के लिए ।
      3. संस्कृति chondrogenic प्रेरण माध्यम के साथ 3 सप्ताह के लिए छर्रों ।
      4. 3 सप्ताह के लिए मध्यम हर 3 दिन बदलें ।
      5. 3 सप्ताह प्रेरण के बाद, तेल के साथ सेल गोली एंबेड, यह 4 मिमी स्लाइस में अनुभाग, और दाग उंहें ०.१% Toluidine नीला का उपयोग कर 30 मिनट के लिए कमरे के तापमान17पर ।
  3. कुल आरएनए निष्कर्षण और मात्रात्मक वास्तविक समय पोलीमरेज़ चेन रिएक्शन (qRT-पीसीआर) द्वारा विश्लेषण
    1. वाणिज्यिक आरएनए निष्कर्षण किट (देखें सामग्री की तालिका) का उपयोग कर 3 सप्ताह के विभेद प्रेरण के बाद कोशिकाओं की कुल आरएनए को अलग ।
      1. कल्चरल डिश में कल्चरल मीडियम निकालें और फिर 1 एमएल का आइसोलेशन रिएजेंट जोड़ें ।
      2. समाधान सजातीय होने तक दोहराया pipetting द्वारा कोशिकाओं लाइसे । यह 3 मिनट के लिए कमरे के तापमान पर मशीन ।
      3. एक १.५ मिलीलीटर microcentrifuge ट्यूब में सेल lysate स्थानांतरण ।
      4. जोड़ें १०० µ क्लोरोफॉर्म के एल, हाथ 15x से हिला, और 3 मिनट के लिए कमरे के तापमान पर मिश्रण गर्मी ।
      5. 4 डिग्री सेल्सियस पर 15 मिनट के लिए १२,००० × g पर ट्यूब केंद्रापसारक । एक नया १.५ मिलीलीटर microcentrifuge ट्यूब में supernatants स्थानांतरण ।
      6. isopropanol के ५०० µ एल जोड़ें और कमरे के तापमान पर 10 मिनट के लिए शाही सेना हाला ।
      7. 10 minat 4 डिग्री सेल्सियस के लिए १२,००० × जी पर केंद्रापसारक । आरएनए गोली ट्यूब के तल पर दिखाई जानी चाहिए ।
      8. निकालें supernatant और फिर जोड़ें ५०० µ एल के ७५% इथेनॉल । संक्षेप में आरएनए गोली धोने के लिए कई सेकंड के लिए ट्यूब स्पिन । 5 मिनट के लिए 4 डिग्री सेल्सियस पर ७,५०० × जी में यह केंद्रापसारक ।
      9. अवशिष्ट इथेनॉल निकालें ।
      10. DEPC पानी की 10 µ एल में आरएनए गोली भंग और बर्फ पर ट्यूबों जगह है ।
    2. रिवर्स कुल आरएनए एक डीएनए संश्लेषण किट के साथ सीडीएनए में टाइप ( सामग्री की तालिकादेखें).
      नोट: बर्फ पर सभी निम्न प्रक्रियाएँ निष्पादित करें.
      1. रिवर्स प्रतिलेखन मास्टर मिक्स तैयार करते हैं ।
      2. DNase-इलाज आरएनए के 25 µ एल जोड़ें 1 आरएनए के µ जी के साथ प्रत्येक ट्यूब के लिए ।
      3. एक पीसीआर थर्मल साइकिल चालक का उपयोग कर निंनलिखित तापमान पर मिश्रण मशीन: 10 मिनट के लिए 26 ° c (ऐनी करने के लिए यादृच्छिक hexamers अनुमति देने के लिए), ४५ मिनट के लिए ४२ ° c (रिवर्स प्रतिलेखन) और 10 मिनट के लिए ७५ ° c (रिवर्स transcriptase को निष्क्रिय करने के लिए).
      4. तुरंत मात्रात्मक वास्तविक समय पीसीआर द्वारा परिणामी सीडीएनए का विश्लेषण, या यह-20 डिग्री सेल्सियस पर दुकान ।
    3. एक मात्रात्मक वास्तविक समय पीसीआर प्रणाली के साथ जीन अभिव्यक्ति विश्लेषण करते हैं ।
      1. पीसीआर का प्रदर्शन करने के लिए qRT-पीसीआर मास्टर मिक्स ( सामग्री की तालिकादेखें) का उपयोग करें । GAPDH, Runx2, Agg, और PPARγ के लिए पीसीआर प्राइमरों तालिका 1में सूचीबद्ध हैं ।
      2. 2ΔΔCT विधि का उपयोग करके जीन एक्सप्रेशन की गणना करें ।
      3. आचरण एक सांख्यिकीय मानक सांख्यिकीय सॉफ्टवेयर का उपयोग कर विश्लेषण । समूह के अर्थ की तुलना करने के लिए एक स्वतंत्र नमूना t-परीक्षण का उपयोग करें ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

अलगाव, शुद्धि, और rbSF की संस्कृति-MSCs:
इस प्रोटोकॉल rbSF-MSCs, MSC सतह मार्कर CD90 की अभिव्यक्ति पर आधारित अलग करने के लिए एमएसीएस का उपयोग करता है । rbSF के एक प्रक्रिया प्रवाह आरेख-MSCs ' अलगाव, शुद्धि, और लक्षण वर्णन और इन विट्रो में संस्कृति प्रोटोकॉल चित्रा 1में दिखाया गया है ।

CD90 के साथ चुंबकीय सक्रिय सेल छँटाई (एमएसीएस) के बाद कक्ष आकृति विज्ञान:
सबसे पहले, एमएसीएस के लिए, CD90 चुंबकीय मोतियों के साथ immunolabel MSCs । केंद्रापसारक के बाद, एक शानदार छंटाई बफर के ८० µ एल में 107 कोशिकाओं की एक अधिकतम resuspend, और फिर CD90 चुंबकीय मोती के 20 µ एल जोड़ने के लिए, भंवर और 4 डिग्री सेल्सियस पर 15 मिनट के लिए मशीन द्वारा पीछा किया । उसके बाद, छंटाई बफर के 1 मिलीलीटर के साथ कोशिकाओं को धोने और उंहें छंटाई बफर के ५०० µ एल में resuspend । चुंबकीय छंटाई के साथ आगे बढ़ने से पहले, धुलाई कदम दोहराएं । यह महत्वपूर्ण कार्यविधि चित्रा 2में दिखाया गया है ।

छंटाई से पहले, अनुयाई खरगोश श्लेष द्रव कोशिका आबादी विषम आकृति विज्ञान प्रदर्शित, विविध सेल प्रकार और आकार (आंकड़ा 3ए सी) युक्त । एमएसीएस के बाद, सेल की आबादी समरूप आकृति विज्ञान का प्रदर्शन किया । उप-संस्कृति (चित्रा 3डी-एफ) के साथ सेल संख्या बढ़ाई गई थी ।

एमएसीएस-समृद्ध rbSF-MSCs की सतह विशेषताओं:
प्रतिदीप्ति-सक्रिय सेल छँटाई (FACS) CD90 के साथ एमएसीएस द्वारा rbSF-MSCs के संवर्धन का विश्लेषण करने के लिए प्रदर्शन किया गया था. एमएसीएस से पहले, सेल जनसंख्या लगभग ४०% MSCs (चित्रा 4c, डी; चित्रा 4a,बीमें isotype नियंत्रण) शामिल हैं । एमएसीएस के बाद, समृद्ध जनसंख्या लगभग समाहित > ९९% MSCs (चित्रा 4E,एफ) । टेम वंश सेल मार्करों CD34 और CD45 थे, पर ०.३१८%, दोनों शायद ही कभी एमएसीएस, जो २५.९% से कम अपने प्रारंभिक अभिव्यक्ति से एक गिरावट है के बाद व्यक्त की । चयन से पहले, लगभग 28% CD90+ सेल (फिगर 4g) थे; शुद्धि के बाद, लगभग ९८% CD90+ कोशिकाओं को प्राप्त किया गया (चित्रा 4H).

rbSF-MSCs की Multilineage विभेदक क्षमता:
करने के लिए rbSF की क्षमता-MSCs जैसे osteogenic, adipogenic, और chondrogenic कोशिकाओं के रूप में विभिंन वंश में अंतर करने के लिए, एमएसीएस से समृद्ध rbSF-MSCs एक साथ एक विशिष्ट विभेदक मध्यम में संस्कृति और एक में थे cytokine बिना भेदभाव मध्यम नियंत्रण के रूप में सेवा करने के लिए । जब प्रेरण पूरा हो गया था, वंश-विशिष्ट मार्करों धुंधला और आरटी-पीसीआर द्वारा विश्लेषण किया गया । Alizarin लाल दाग कैल्शियम यौगिकों का प्रदर्शन किया है कि खनिज पिंड osteogenic प्रेरण शर्तों (चित्रा 5) के तहत 3 सप्ताह के बाद rbSF-MSCs में गठन किया था । adipogenic प्रेरण के 3 सप्ताह के बाद, लिपिड अमीर रिक्तिकाएं के एक संचय intracellular तेल लाल ओ धुंधला (चित्रा 5B) द्वारा पता लगाया जा सकता है । chondrogenic प्रेरण के 21 दिनों के लिए, सेल गोली toluidine नीले दाग के साथ परख histologically था । धुंधला करने के लिए सकारात्मक कोशिकाओं (proteoglycan करने के लिए) chondrocyte कोशिकाओं की तरह माना जाता था (चित्रा 5C) । इस परिणाम के समान, विभेदक क्षमता के जीन अभिव्यक्ति का एक मात्रात्मक विश्लेषण भी इन कोशिकाओं की भिंनता क्षमता साबित हुई । Agg की अभिव्यक्ति का स्तर (एक chondrocyte मार्कर), PPARγ (एक adipogenic मार्कर), और Runx2 (एक osteoblast मार्कर) प्रेरित शर्तों के तहत विनियमित थे. इन आंकड़ों ने trilineages (चित्रा 5d) में rbSF-MSCs की multipotent विभेदक क्षमता को साबित किया ।

Figure 1
चित्रा 1: अलगाव, शुद्धि के पूर्ण योजनाबद्ध, और एस एफ-ंयूजीलैंड सफेद खरगोश के MSCs के लक्षण वर्णन । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्रा 2: CD90 के साथ चुंबकीय सक्रिय सेल छँटाई (एमएसीएस) के लिए प्रोटोकॉल. कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 3
चित्रा 3: monolayer के आकृति विज्ञान rbSF-MSCs से पहले और बाद एमएसीएस के रूप में साधारण औंधा माइक्रोस्कोपी के तहत जांच की । A-C) छंटाई से पहले, अनुयाई खरगोश श्लेष द्रव कोशिका आबादी प्रदर्शन विविधता । वे विविध कोशिका प्रकार और आकार, जैसे अंडाकार, लंबी धुरी, लघु धुरी, और तारामय आकृति विज्ञान होते हैं । p2 और P6 के मुख्य आकृति विज्ञान एक धुरी आकृति विज्ञान है (एक: p2, बी: पी पी, सी: P6). डी एफ) CD90 के साथ एमएसीएस के बाद, कोशिका आबादी एक समरूप आकृति विज्ञान का प्रदर्शन । एक उप संस्कृति के साथ, सेल संख्या बढ़ जाती है (डी: P2, : पी पी, एफ: P6) । स्केल बार = १०० µm. कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें

Figure 4
चित्रा 4: rbSF-MSC सतह मार्करों की पहचान । प्रवाह cytometry विश्लेषण का उपयोग करना, rbSF-MSCs MSC मार्करों CD44 और CD105 के लिए सकारात्मक हैं, जबकि endothelial सेल मार्कर CD34 और टेम सेल मार्कर CD45 के लिए नकारात्मक । एमएसीएस से पहले, इन कोशिकाओं CD44 और CD105 के लिए सकारात्मकता की एक कम दर है । हालांकि, एमएसीएस के बाद, धनात्मकता की दर अधिक थी । ए, बी) इन शीर्ष दो छवियों isotype नियंत्रण डेटा दिखाते हैं । सी, डी) इन परिणामों से पता चलता है कि एमएसीएस rbSF-एमएससी जनसंख्या से पहले लगभग ४०% एमएससी कोशिकाओं से बना है । ई, एफ) एमएसीएस के बाद, समृद्ध जनसंख्या > ९९% एमएससी कोशिकाओं शामिल हैं । छ, ज) इन छवियों CD90+ मार्कर के प्रवाह cytometry विश्लेषण दिखाने के लिए, (जी) से पहले और (एच) एमएसीएस छंटाई के बाद । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 5
चित्रा 5: दाग और आरटी-पीसीआर द्वारा वंश-विशिष्ट मार्कर का विश्लेषण । क) Alizarin लाल दाग दर्शाता है कि खनिज पिंड फार्म 3 सप्ताह के लिए osteogenic प्रेरण के तहत । ख) adipogenic प्रेरण के 3 सप्ताह के बाद, लिपिड अमीर रिक्तिकाएं के संचय intracellular तेल लाल ओ धुंधला द्वारा पता चला है । ग) chondrogenic प्रेरण के 3 सप्ताह के लिए, सेल गोली toluidine नीले दाग के साथ परख histologically था । धुंधला (proteoglycan) के लिए सकारात्मक कोशिकाओं chondrocyte की तरह कोशिकाओं के रूप में माना जाता था । स्केल बार = १०० µm. D) 3 सप्ताह के लिए संवर्धन के बाद, osteoblast मार्करों (Runx2), adipogenic मार्करों (PPARγ), और chondrogenic मार्करों (Agg) के सापेक्ष mRNA अभिव्यक्ति का पता लगाया है सभी विश्लेषणों के लिए, p मान < ०.०१ को Kruskal-वालिस परीक्षण (* * के रूप में दिखाए गए) का उपयोग करके सांख्यिकीय रूप से महत्वपूर्ण अंतर माना गया । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

जीन फॉरवर्ड प्राइमर (5 '-3 ') रिवर्स प्राइमर (5 ' – 3 ')
Runx2 TATGAAAAACCAAGTAGCAAGGTTC GTAATCTGACTCTGTCCTTGTGGAT
AGG GCTACACCCTAAAGCCACTGCT CGTAGTGCTCCTCATGGTCATC
PPARγ2 GCAAACCCCTATTCCATGCTG CACGGAGCTGATCCCAAAGT
GAPDH GGAGAAAGCTGCTAA ACGACCTGGTCCTCGGTGTA

तालिका 1: की सूची जीन और प्राइमरी मात्रात्मक वास्तविक समय पीसीआर के लिए इस अध्ययन में इस्तेमाल किया ।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

श्लेष द्रव में MSCs का अस्तित्व कोशिका-आधारित चिकित्सा के लिए एक विकल्प प्रदान करता है । पिछले अध्ययनों से पता चला है कि चोट साइटों को अपने श्लेष द्रव में mesenchymal स्टेम कोशिकाओं की उच्च मात्रा में होते हैं, जो सकारात्मक रूप से पोस्ट चोट अवधि5के साथ संबद्ध किया जा सकता है । श्लेष द्रव में MSCs एक चोट के बाद सहज चिकित्सा को बढ़ाने के लिए ऊतक के लिए फायदेमंद हो सकता है18,19. एस एफ-MSCs के नैदानिक आवेदन शायद ही कभी साहित्य में शामिल किया गया है, मुख्य रूप से, क्योंकि एस एफ के तंत्र-जोड़ों में MSCs20अपरिभाषित रहते हैं । जोंस एट अल. 21 ने बताया कि घुटने के जोड़ों में hSF-एमएससी की संख्या में काफी वृद्धि 7-पुराने ऑस्टियोआर्थराइटिस (OA) के प्रारंभिक दौर के दौरान गुना । उंहोंने सोचा था कि वृद्धि एस एफ-MSCs जोड़ों के शारीरिक homeostasis को बनाए रखने के लिए योगदान कर सकते हैं ।

एक आदर्श पशु मॉडल regenerative और शोधों चिकित्सा का उपयोग चिकित्सकीय के विकास में एक अपरिहार्य उपकरण है । हालांकि स्पष्ट मतभेद मनुष्यों और खरगोशों के बीच मौजूद है, खरगोश बड़े पैमाने पर ऊतक पुनर्जनन7के अध्ययन के लिए एक पशु मॉडल के रूप में प्रयोग किया जाता है, इस प्रकार हमें यह एस एफ-MSCs के हमारे अध्ययन के लिए मॉडल के रूप में चुनने के लिए संकेत । इस प्रयास में और अधिक कठिन बाधाओं में से एक है कि एस एफ के अलगाव-MSCs अक्सर विभिंन सफलता दरों और कम कॉलोनी आवृत्तियों में परिणाम, के रूप में पिछले अनुसंधान5में रिपोर्ट । इसलिए, कई शोधकर्ताओं ने सफलता दरों और एस एफ से MSCs के अलगाव के अनुकूलन पर ध्यान केंद्रित किया है ।

इस studyeffectively उच्च छंटाई शुद्धता और CD90 की व्यवहार्यता के लिए एक एमएसीएस प्रक्रिया का इस्तेमाल किया+ खरगोश श्लेष द्रव22से एमएसीएसs । इस एमएसीएस प्रणाली अत्यधिक विशिष्ट एक विशेष सेल सतह प्रतिजन करने के लिए युग्मित एंटीबॉडी के लिए चुंबकीय microbeads संयुग्मित का उपयोग करता है, इस मामले में CD90, और विशेष रूप से लक्ष्य सेल प्रकार, अर्थात् CD90 व्यक्त कोशिकाओं के चयन के लिए अनुमति देता है । CD90 microbeads के साथ शुद्धि से पहले, हम आमतौर पर 14 दिनों के लिए प्राथमिक rbSF-MSCs संस्कृति । इस अवधि के दौरान कई कॉलोनियों में कल्चरल डिश बनाई जाती हैं । इस प्रोटोकॉल के व्यास में 2 मिमी से बड़ी कालोनियों का चयन करने का सुझाव है । जब कॉलोनी चयन के लिए क्लोनिंग सिलेंडर का उपयोग कर, हम ध्यान से यह माइक्रोस्कोप के नीचे निरीक्षण । एकल कॉलोनी में शुद्धिकरण के लिए आगे प्रचार किया जाता है ।

पृथक्करण और शुद्धिकरण की प्रक्रिया के दौरान, CD90 एक्सप्रेस कोशिकाओं है कि चुंबकीय लेबल थे स्तंभ में विभाजक के चुंबकीय क्षेत्र द्वारा आकर्षित कर रहे हैं, जबकि unlabel्ड कोशिकाओं के माध्यम से प्रवाह । वाशिंग प्रक्रिया के बाद, स्तंभ विभाजक के चुंबकीय क्षेत्र से हटा दिया जाता है, और लक्ष्य कक्ष स्तंभ से eluted हैं. यह विशिष्ट एमएसीएस microbead दृष्टिकोण rbSF-MSCs के अलगाव की अनुमति देता है कि विशेष रूप से स्टेम सेल सतह मार्करों CD44 और CD105 व्यक्त की, प्रदर्शन है कि इन अलग कोशिकाओं mesenchymal कोशिकाओं के बजाय टेम स्टेम कोशिकाओं रहे हैं23. ये शुद्ध rbSF-MSCs इन विट्रो में रूपात्मक सुविधाओं और मार्कर अभिव्यक्ति के किसी भी महत्वपूर्ण परिवर्तन के बिना एक लंबे समय से अधिक प्रसंस्कृत किया जा सकता है । इसके अलावा, rbSF-MSCs एमएसीएस प्रदर्शन से समृद्ध बहु वंश कोशिकाओं में एक multipotent भेदभाव की क्षमता, chondrogenic, adipogenic, और osteogenic कोशिकाओं में शामिल है ।

एमएसीएस का संचालन एक आसान करने के लिए प्रोटोकॉल प्रदर्शन है और पीठ23पर किया जा सकता है । इसके अतिरिक्त, अमेरिका के खाद्य और औषधि प्रशासन (एफडीए) एमएसीएस microbead-आधारित प्रौद्योगिकी को मंजूरी दे दी है, और इस तरह यह नैदानिक अनुप्रयोगों24के लिए प्रदर्शन करने के लिए आसान है । CD90 mesenchymal स्टेम सेल की एक सतह मार्कर है, और शोधकर्ताओं ने पता चला है कि CD90 सकारात्मक MSCs एक बेहतर chondrogenic भेदभाव की क्षमता है25,26। MSCs के pluripotency आकृति विज्ञान और स्टेम कोशिकाओं के लिए विशिष्ट मार्करों की अभिव्यक्ति के आधार पर विशेषता किया गया है27.

इस अध्ययन में कई सीमाएं होती हैं । इस प्रोटोकॉल की पहली कमी सतह मार्करों हम जांच से संबंधित है । इंटरनेशनल सोसायटी फॉर सेल्युलर थेरेपी (ISCT) द्वारा एक वक्तव्य के आधार पर, multipotent MSCs को परिभाषित करने के लिए न्यूनतम मानदंड CD90, CD105, CD44, और CD73 के लिए सकारात्मक है, और CD11b, CD14, CD34 या CD45 के लिए नकारात्मक, और CD79a या एचएलए-28डॉ. प्रयास और पूरे पैनल परीक्षण की आवश्यकता खर्च को कम करने के लक्ष्य के साथ, इस अध्ययन में शोधकर्ताओं ने ध्यान से नकारात्मक मार्करों के दो और सकारात्मक मार्करों की सिफारिश की दो चयनित । दूसरा, कालोनियों को बनाने में काफी समय लगता है जिनका चयन आगे की पढ़ाई के लिए किया जाएगा । इसके अलावा, अतिवृद्धि इन विट्रो मेंएस एफ-MSCs के chondrogenic प्रेरण के दौरान एक बड़ी समस्या है । बाद के चरण में, hypertrophic chondrocytes हमेशा व्यक्त प्रकार X कोलेजन (COLX), मैट्रिक्स metalloproteinase 13 (MMP13), क्षारीय फॉस्फेट (ALP), और runt-संबंधित प्रतिलेखन कारक 2 (Runx2)29. अनुसंधान से पता चलता है कि तीन आयामी (3 डी) गोली संस्कृति, गतिशील संस्कृति प्रणालियों, और chondrocytes के साथ coculture के लिए लाभ कर रहे है एमएससी छुरा chondrogenic भेदभाव30,31। इस अध्ययन में, एक गोली संस्कृति प्रणाली अतिवृद्धि से बचने के लिए एमएससी के chondrogenic प्रेरण के लिए इस्तेमाल किया गया था ।

अंत में, हम अलगाव और जोड़दार गुहा तरल पदार्थ निस्तब्धता से MSCs के शुद्धिकरण के लिए एक सरल विधि की स्थापना की है और उसमें प्राप्त MSCs की विशेषता । इस प्रोटोकॉल की खोज और जोड़दार श्लेष द्रव की जांच के लिए एक मंच प्रदान की है MSCs ' उपंयास संयुक्त पुनर्जनन रणनीतियों में संभावित उपयोगिता व्युत्पंन ।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों की घोषणा है कि वे कोई प्रतिस्पर्धा वित्तीय हितों की है ।

Acknowledgments

इस अध्ययन के आर्थिक रूप से निंनलिखित अनुदान द्वारा समर्थित था: चीन के प्राकृतिक विज्ञान फाउंडेशन (No. ८१५७२१९८; No. ८१७७२३९४); शेन्ज़ेन विश्वविद्यालय के उच्च स्तरीय चिकित्सा अनुशासन निर्माण के लिए निधि (No. २०१६०३१६३८); गुआंग्डोंग प्रांत के मेडिकल रिसर्च फाउंडेशन, चीन (सं. A2016314); और शेन्ज़ेन विज्ञान और प्रौद्योगिकी परियोजनाएं (सं. JCYJ20170306092215436; नहीं. JCYJ20170412150609690; नहीं. JCYJ20170413161800287; नहीं. SGLH20161209105517753; नहीं. JCYJ20160301111338144) ।

Materials

Name Company Catalog Number Comments
Reagents
MesenGro StemRD MGro-500 1703 Warm in 37 °C water bath before use
MesenGro Supplement StemRD MGro-500 M1512 Component of MSCs culture medium
DMEM basic Gibco Inc. C11995500BT MSCs differentiation medium
Isotonic saline solution Litai, China 5217080305 Cavity arthrocentesis procedure reagent
Phosphate-Buffered Saline (PBS) HyClone Inc. SH30256.01B PBS, free of Ca2+/Mg2+
Fetal Bovine Serum (FBS) Gibco Inc. 10099-141 Component of MSCs culture medium
Povidone iodine solution Guangdong, China 150605 Sterilization agent
75% ethanol Lircon, china 170917 Sterilization agent
0.25% Trypsin/EDTA Gibco Inc. 25200-056 Cell dissociation reagent
1% Penicillin-Streptomycin Gibco Inc. 15140-122 Component of MSCs medium
MACS Running Buffer MiltenyiBiotec 5160112089 Containing phosphate-buffered saline (PBS), 0.5% bovine serum albumin(BSA), and 2 mMEDTA
CD90 antibody conjugated MicroBeads MiltenyiBiotec 5160801456 For magnetic activated cell sorting
Sodium pyruvate Sigma-Aldrich P2256 Component of MSCs chondrogenic differentiation
Dexamethasone Sigma-Aldrich D1756 Component of MSCs osteogenic differentiation
ITS BD 354352 1%, Component of MSCs chondrogenic differentiation
L-proline Sigma-Aldrich P5607 0.35 mM, Component of MSCs chondrogenic differentiation
L-ascorbic acid-2-phosphate Sigma-Aldrich A8960 50 mM, Component of MSCs chondrogenic differentiation
3-isobutyl-1-methylxanthine Sigma-Aldrich I5879 0.5 mM, Component of adipogenic differentiation
Indomethacin Sigma-Aldrich I7378 100 mM, Component of adipogenic differentiation
TGFβ1 Peprotech 100-21 10 ng/mL, Component of MSCs chondrogenic differentiation
α-glycerophsphate Sigma-Aldrich G6751 Component of MSCs osteogenic differentiation
CD34 Polyclonal Antibody, FITC Conjugated Bioss bs-0646R-FITC Hematopoietic stem cells marker
Mouse antirabbit CD44 Bio-Rad MCA806GA Thy-1 membrane glycoprotein (MSCs marker)
CD45 (Monoclonal Antibody) Bio-Rad MCA808GA Hematopoietic stem cells marker
CD105 antibody Genetex GTX11415 MSCs marker
Isopropyl alcohol Sigma-Aldrich I9030 Precipitates RNA extraction organic phases
Trichloromethane Wenge, China 61553 Extract total RNA
Trizol Invitrogen 15596-018 Isolate total RNA
SYBR green master mix Takara Bio, Japan RR420A PCR test
cDNA synthesis kit Takara Bio, Japan RR047A Reverse-transcribed to complementary DNA
Alizarin Red Sigma-Aldrich A5533 Staining of calcium compounds
Toluidine Blue Sigma-Aldrich 89640 Staining of cartilaginous tissue
Oil Red O solution Sigma-Aldrich O1391L Lipid vacuole staining
Equipment
MiniMACS Separator MiltenyiBiotec 130-042-102 For magnetic activated cell sorting
MultiStand MiltenyiBiotec 130-042-303 For magnetic activated cell sorting
MS Columns MiltenyiBiotec 130-042-201 For magnetic activated cell sorting
Cell Strainer FALCON Inc. 352340 40 μm nylon
Hemocytometer ISOLAB Inc. 075.03.001 Cell counting
Falcon 100 mm dish Corning 353003 Cell culture dish
Microcentrifuge tube Axygen MCT-150-C RNA Extraction and PCR
Centrifuge Tubes Sigma-Aldrich 91050 Gamma-sterilized
High-speed centrifuge Eppendorf 5804R Centrifuge cells
Carbon dioxide cell incubator Thermo scientific 3111 Cell culture
Real-Time PCR Instrument Life Tech QuantStudio Real-Time quantitative polymerase chain reaction
Flow cytometer BD Biosciences 342975 Cell analyzer
Pipettor Eppendorf O25456F Transfer the liquid
Cloning cylinder Sigma-Aldrich C3983-50EA Isolate and pick individual cell colonies
Sterile hypodermic syringe Double-Dove, China 131010 Arthrocentesis procedure
Rabbit cage Zhike, China ZC-TGD Restrain the rabbit

DOWNLOAD MATERIALS LIST

References

  1. Oreffo, R. O., Cooper, C., Mason, C., Clements, M. Mesenchymal stem cells: lineage, plasticity, and skeletal therapeutic potential. Stem Cell Reviews. 1, (2), 169-178 (2005).
  2. Asakura, A., Rudnicki, M. A., Komaki, M. Muscle satellite cells are multipotential stem cells that exhibit myogenic, osteogenic, and adipogenic differentiation. Differentiation. 68, (4-5), 245-253 (2001).
  3. De, B. C., Dell'Accio, F., Tylzanowski, P., Luyten, F. P. Multipotent mesenchymal stem cells from adult human synovial membrane. Arthritis Rheumatology. 44, (8), 1928-1942 (2001).
  4. Zuk, P. A., et al. Human adipose tissue is a source of multipotent stem cells. Molecular Biology of the Cell. 13, (12), 4279-4295 (2002).
  5. McGonagle, D., Jones, E., English, A., Emery, P. Enumeration and phenotypic characterization of synovial fluid multipotential mesenchymal progenitor cells in inflammatory and degenerative arthritis. Arthritis & Rheumatism. 50, (3), 817-827 (2004).
  6. Jia, Z., et al. Isolation and characterisation of human mesenchymal stem cells derived from synovial fluid by magnetic activated cell sorting (MACS). Cell Biology International. (2017).
  7. Bashir, M., et al. Isolation, culture and characterization of New Zealand white rabbit mesenchymal stem cells derived from bone marrow. Asian Journal of Animal & Veterinary Advances. 10, (8), 13-30 (2015).
  8. Song, X., et al. Differentiation potential of rabbit CD90-positive cells sorted from adipose-derived stem cells in vitro. In Vitro Cellular & Developmental Biology - Animal. 53, (1), 1-6 (2016).
  9. Lee, T. C., et al. Comparison of surface markers between human and rabbit mesenchymal stem cells. PLOS One. 9, (11), e111390 (2014).
  10. Stewart, M. C., Chen, Y., Bianchessi, M., Pondenis, H. Phenotypic characterization of equine synovial fluid-derived chondroprogenitor cells. Stem Cell Biology and Research. 3, (1), (2016).
  11. Prado, A. A. F., et al. Characterization of mesenchymal stem cells derived from the equine synovial fluid and membrane. BioMed Central Veterinary Research. 11, (1), 281 (2015).
  12. Yoshimura, H., et al. Comparison of rat mesenchymal stem cells derived from bone marrow, synovium, periosteum, adipose tissue, and muscle. Cell and Tissue Research. 327, (3), 449-462 (2007).
  13. Wu, C. C., et al. Intra-articular injection of platelet-rich fibrin releasates in combination with bone marrow-derived mesenchymal stem cells in the treatment of articular cartilage defects: an in vivo study in rabbits. Journal of Biomedical Materials Research Part B: Applied Biomaterials. 105, (6), 1536-1543 (2017).
  14. John, T., Lerche, P. Anesthesia and Analgesia for Veterinary Technicians. Mosby Elsevier. St. Louis, Missouri. (2011).
  15. Koyama, N., et al. Pluripotency of mesenchymal cells derived from synovial fluid in patients with temporomandibular joint disorder. Life Sciences. 89, (19-20), 741-747 (2011).
  16. Kim, Y. S., et al. Isolation and characterization of human mesenchymal stem cells derived from synovial fluid in patients with osteochondral lesion of the talus. American Journal of Sports Medicine. 43, (2), 399-406 (2015).
  17. Vereb, Z., et al. Immunological properties of synovial fluid-derived mesenchymal stem cell-like cells in rheumatoid arthritis. Annals of the Rheumatic Diseases. 74, (Suppl 1), A64-A65 (2015).
  18. Matsukura, Y., Muneta, T., Tsuji, K., Koga, H., Sekija, I. Mesenchymal stem cells in synovial fluid increase after meniscus injury. Clinical Orthopaedics & Related Research. 472, (5), 1357-1364 (2014).
  19. Morito, T., et al. Synovial fluid-derived mesenchymal stem cells increase after intra-articular ligament injury in humans. Rheumatology. 47, (8), 1137-1143 (2008).
  20. Hegewald, A. A., et al. Hyaluronic acid and autologous synovial fluid induce chondrogenic differentiation of equine mesenchymal stem cells: a preliminary study. Tissue & Cell. 36, (6), 431-438 (2004).
  21. Jones, E. A., et al. Synovial fluid mesenchymal stem cells in health and early osteoarthritis: detection and functional evaluation at the single cell level. Arthritis & Rheumatism. 58, (6), 1731-1740 (2008).
  22. Makker, K., Agarwal, A., Sharma, R. K. Magnetic activated cell sorting (MACS): utility in assisted reproduction. Indian Journal of Experimental Biology. 46, (7), 491-497 (2008).
  23. Schmitz, B., et al. Magnetic activated cell sorting (MACS) — a new immunomagnetic method for megakaryocytic cell isolation: comparison of different separation techniques. European Journal of Haematology. 52, (5), 267-275 (1994).
  24. Reinhardt, M., Bader, A., Giri, S. Devices for stem cell isolation and delivery: current need for drug discovery and cell therapy. Expert Review of Medical Devices. 12, (3), 353-364 (2015).
  25. Gronthos, S., Zannettino, A. C. W. A method to isolate and purify human bone marrow stromal stem cells. Mesenchymal Stem Cells. Prockop, D. J., Bunnell, B. A., Phinney, D. G. Vol. 449 of Methods in Molecular Biology 45-57 (2008).
  26. Krawetz, R. J., et al. Synovial fluid progenitors expressing CD90+ from normal but not osteoarthritic joints undergo chondrogenic differentiation without micro-mass culture. PLOS One. 7, (8), e43616 (2012).
  27. Ogata, Y., et al. Purified human synovium mesenchymal stem cells as a good resource for cartilage regeneration. PLOS One. 10, (6), e0129096 (2015).
  28. Dominici, M., et al. Minimal criteria for defining multipotent mesenchymal stromal cells: the International Society for Cellular Therapy position statement. Cytotherapy. 8, (4), 315-317 (2006).
  29. Gauci, S. J., et al. Modulating chondrocyte hypertrophy in growth plate and osteoarthritic cartilage. Journal of Musculoskeletal & Neuronal Interact. 8, (4), 308 (2008).
  30. Cooke, M. E., et al. Structured three-dimensional co-culture of mesenchymal stem cells with chondrocytes promotes chondrogenic differentiation without hypertrophy. Osteoarthritis and Cartilage. 19, (10), 1210-1218 (2011).
  31. Fischer, J., Dickhut, A., Rickert, M., Richter, W. Human articular chondrocytes secrete parathyroid hormone-related protein and inhibit hypertrophy of mesenchymal stem cells in coculture during chondrogenesis. Arthritis and Rheumatism. 62, (9), 2696-2706 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics