Cellule magnétique activé tri des stratégies visant à isoler et purifier Synovial fluide mésenchymateuses cellules souches dérivées d’un modèle de lapin

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Cet article présente un protocole simple et économique pour la simple isolation et la purification de cellules souches mésenchymateuses du liquide synovial de Nouvelle-Zélande lapin blanc.

Cite this Article

Copy Citation | Download Citations

Jia, Z., Liang, Y., Li, X., Xu, X., Xiong, J., Wang, D., Duan, L. Magnetic-Activated Cell Sorting Strategies to Isolate and Purify Synovial Fluid-Derived Mesenchymal Stem Cells from a Rabbit Model. J. Vis. Exp. (138), e57466, doi:10.3791/57466 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Cellules souches mésenchymateuses (CSM) sont la source principale de cellule pour la thérapie cellulaire. MSCs du fluide synovial de la cavité articulaire susceptibles de servir pour l’ingénierie tissulaire du cartilage. MSCs de liquide synovial (SF-MSCs) ont été considérés comme des candidats prometteurs pour la régénération articulaire, et leur bénéfice thérapeutique potentiel a fait d’eux un sujet de recherche importants de la fin. SF-MSCs de la cavité du genou les lapins blancs de Nouvelle-Zélande peuvent être utilisés comme un modèle optimisé translationnel afin d’évaluer la médecine régénérative humaine. Au moyen de base CD90 cell activé magnétique tri technologies (MACS), ce protocole avec succès obtient lapin SF-MSCs (rbSF-MSCs) de ce modèle de lapin et plus pleinement montre le phénotype de la maîtrise de ces cellules par incitant à faire la différence à ostéoblastes, les adipocytes et les chondrocytes. Par conséquent, cette approche peut être appliquée dans la recherche en biologie cellulaire et ingénierie tissulaire en utilisant des procédures et des équipements simples.

Introduction

MSCs ont été proposées comme une source précieuse pour la médecine régénérative, surtout pour les lésions du cartilage. MSCs, y compris les chondrocytes, ostéoblastes, adipocytes, myocytes squelettiques et viscérales cellules stromales, étendre largement les zones destinés à la transplantation de cellules souches en raison de leur forte expansion taux et lignées multiples différenciation possibles1. MSCs peuvent être isolés dans le squelette musculaire, membrane synoviale, la moelle osseuse et le tissu adipeux2,3,4. Résultats ont confirmé aussi la présence de MSCs dans le liquide synovial, et des recherches antérieures a identifié MSCs de dérivés de liquide synoviales (SF-MSCs) comme candidats prometteurs pour régénération articulaire5,6.

Cependant, recherche et expérimentation préclinique sur échantillons humains sont soumis à nombreuses questions éthiques. Au lieu de cela, les lapins ont été et continuent d’être le plus couramment utilisé des espèces animales pour démontrer que la transplantation de MSCs peut réparer les lésions du cartilage. Ces dernières années, un nombre croissant de chercheurs ont étudié les cellules souches mésenchymateuses de lapin (rbMSCs) les deux in vitro et in vivo, que ces cellules sont semblables aux humains MSCs dans leur physiologie cellulaire de la biologie et de tissus. De même, les rbMSCs sont capables d’adhérer aux surfaces plastiques, affichant la morphologie de la broche-fibroblaste comme dans MSCs humaines. En outre, les échantillons mésenchymateuses lapin sont simples et faciles à obtenir7. En outre, les points cruciaux sont que rbMSCs expriment des marqueurs de surface, telles que CD44 CD90 et CD105, et que la différenciation des lignées multiples potentielle est préservée, ce qui est en accord avec les critères d’identification des populations de MSC comme défini par la société internationale de thérapie cellulaire8,9. En particulier, chondroprogenitors fluides synoviales sont capables de non-hypertrophique chondrogenèse lorsque induite par le TGF-β1, rendant les sources cellulaire appropriée pour le cartilage articulaire phénotypiquement régénération10,11, 12.

Toutefois, l’isolement de SF-MSCs est très différent des autres tissus, y compris le cordon ombilical, le tissu adipeux, sang périphérique et la moelle osseuse. Actuellement, les approches courantes pour la purification et le tri des SF-MSCs sont cytométrie en flux et immunomagnetic axée sur la perle tri, bien que la méthode de cytométrie de flux nécessite un environnement spécifique et très coûteux instruments13.

Cet article présente une procédure simple et peu invasive recueillir des échantillons de liquide synovial de Nouvelle Zélande lapins blancs. Au cours de la procédure, les rbSF-MSCs sont solidement développé in vitro et ensuite isolement avec CD90 positives procédures fondées sur les perles magnétiques. Enfin, le protocole montre comment obtenir les MSCs avec une grande pureté et de la viabilité dans les sources de cellules récoltées.

Dans le présent protocole, les rbSF-CSM isolées sont caractérisés basé sur leur morphologie, l’expression de marqueurs spécifiques et la pluripotence des cellules souches. Immunophénotypage axée sur la cytométrie de flux révèle une expression positive significative du CD44 et CD105, tandis que l’expression de CD45 et CD34 est négative. Enfin, un essai in vitro avec de rbSF-MSCs montre la différenciation ostéogénique, adipocytaire et chondrogéniques de ces cellules.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Toutes les expériences sur des animaux ont été menées selon les directives d’éthique Comité régionales, et toutes les procédures d’animaux ont été approuvées par l’animalier institutionnel et utilisation Comité Shenzhen deuxième populaire de l’hôpital, Université de Shenzhen.

1. isoler et Culture les rbSF-CSM

  1. Préparatifs de la procédure de l’animale
    1. Préparer le squelette-mature femme Nouvelle Zélande lapins blancs pour la collecte de rbSF-MSCs. effectuer un examen clinique des lapins un jour avant la procédure anesthésie et arthrocentèse.
      Remarque : les examens physiques devrait inclure poids (2,0 à 2,5 kg), sexe (féminin) et température corporelle, rythme respiratoire et cardiaque. Intervalles de paramètre pour les lapins cliniquement sains sont 30 à 50 min pour le taux de respiration, 220-280 min pour la fréquence cardiaque et 38-39 ° C pour la température du corps.
    2. Rapidement les animaux pendant 6 h avant l’anesthésie.
  2. Préparations et procédure pour l’anesthésie des animaux
    1. Retenir le lapin avec une cage (voir Table des matières) et ensuite injecter 3 % pentobarbital sodique dans la veine marginale oreille à une dose de 1 mL/kg pour l’anesthésie générale.
    2. Placer le lapin dans une position dorsale-position allongée confortable.
    3. Surveiller la fréquence respiratoire, fréquence cardiaque et la température corporelle du lapin pendant l’anesthésie.
    4. La pommade ophtalmologique sur ses yeux pour prévenir le dessèchement pendant l’anesthésie.
    5. Évaluer la profondeur de l’anesthésie après classification14 de Guedel.
  3. Préparation pour MSCs isolement et culture
    1. Pour cultiver rbSF-MSCs, préparer 500 mL de milieu de culture commercial (voir Table des matières) additionné de 10 % commercial supplément (voir Table des matières), 10 % sérum fœtal (SVF) et 1 % la pénicilline-streptomycine.
    2. Incuber le milieu de culture à 37 ° C dans un bain d’eau.
    3. Préparer 500 mL d’une solution saline du tampon phosphate (PBS) pour l’isolation de cellules et le lavage de la cellule.
    4. Préparer 100 mL d’une solution saline isotonique pour la procédure d’arthrocentèse cavité du genou.
  4. Collection d’uid fl synovial articulaire du genou du lapin
    1. Sélectionnez une zone de 5 x 5 cm environ en taille autour du genou et se raser les poils de lapin de ce domaine à l’aide d’un rasoir électrique de sécurité.
    2. Vous pouvez également désinfecter le site de la procédure 3 x avec la povidone iode solution et 75 % d’éthanol. Après que la zone est complètement sèche, appliquer stérile drape.
    3. Injecter 1 à 2 mL de solution saline isotonique, à l’aide d’une seringue hypodermique stérile à (2 mL), dans la cavité articulaire du genou de l’espace articulaire latérale, déplacer le genou 3-4 x et puis aspirer tout le liquide synovial à température ambiante.
    4. Le liquide synovial filtrer sur un filtre de cellule en nylon à 40 µm pour enlever tous les débris dans les 4 h.
  5. Culture des rbSF-MSCs
    1. Recueillir le liquide filtré dans des tubes à centrifuger 50 mL et centrifuger à 1 500 tr/min pendant 10 min à température ambiante.
    2. Jeter le surnageant après la centrifugation, laver le culot avec du PBS, resuspendre le culot avec le milieu de culture complet et la plaque puis le milieu en boîtes de 100 mm.
    3. Incuber les boîtes à 37 ° C en atmosphère humidifiée contenant 5 % de CO2.
    4. Après 48 h, reconstituer les plats avec un milieu frais pour enlever toutes les cellules non adhérentes. Remplacer le milieu deux fois par semaine pendant 2 semaines comme passage 0 (P0).
      Remarque : Il devrait y avoir environ 1 x 104 cellules adhérentes. Cellules viables/ml en SF sont environ 2 x 102/ml.
    5. Après 14 jours après l’ensemencement initial, beaucoup de colonies si a formé dans les récipients de culture. Sélectionner les colonies plus de 2 mm de diamètre. Marquez l’endroit où se trouvent les colonies sélectionnées en traçant leur circonférence sur le fond du plat.
    6. Jeter les colonies < 2 mm de large, à l’aide de grattoirs à cellules. Digérer les colonies sélectionnés environ 5 µl de 0,25 % de trypsine, à l’aide d’un cylindre de clonage et transférer les colonies à un nouveau plat comme passage 1 (P1).
  6. Soins post-opératoires des animaux
    1. Conformément aux procédures standard institutionnel d’exploitation pour la surveillance post-opératoire et de l’anesthésie.
    2. Surveiller les signes vitaux du lapin toutes les 10 min jusqu'à ce qu’il a repris connaissance. Enfin, transférer l’animal conscient à la cage. Ne retournez pas un lapin qui a subi une chirurgie à la compagnie des autres animaux jusqu'à ce qu’elle a entièrement récupéré.
    3. Après l’opération, désinfecter le site avec 0,1 % polyvidone iodée, 2 fois par jour pendant 3 jours.

2. CD90 séropositifs magnétique activé cellule Tri (CMA) du rbSF-MSCs et Culture primaire

  1. Préparation des échantillons
    1. Lorsque les cellules atteignent près de 80 % confluence, aspirer le milieu et puis ajoutez 1 à 2 mL de 0,25 % trypsine-EDTA à chaque plat.
    2. Incuber les plats pendant 2-3 min afin de permettre le détachement de la cellule.
    3. Une fois que les cellules sont détachent, ajouter une quantité égale de milieu de culture pour inactiver la trypsine.
    4. Passer la suspension cellulaire à travers un tamis de cellule de 40 µm, recueillir le filtrat dans un tube de 15 mL et ensuite filer vers le bas les cellules à 600 × g pendant 10 min à température ambiante.
    5. Resuspendre le culot dans MACS tampon (PBS, pH 7,2, 0,5 % d’albumine sérique bovine et 2 mM EDTA) et ensuite compter le nombre de cellules.
  2. Marquage magnétique
    NOTE : Trier les rbSF-CSM avec une cellule magnétique activé tri trousse contenant des colonnes, un stand et les séparateurs (voir Table des matières).
    1. Déterminer le nombre de cellules à l’aide d’un hémocytomètre.
    2. Centrifuger la suspension de cellules à 300 × g pendant 10 min à 4 ° C. Totalement aspirer le surnageant.
    3. Ajouter 80 µL de tampon de resuspension par 10 cellules total7 .
    4. Pour 10 cellules total7 , ajouter 20 µL de microbilles conjugué avec un anticorps monoclonal de CD90 anti-lapin.
    5. Mélanger les billes magnétiques et les cellules uniformément dans les tubes, puis les incuber à 4 ° C pendant 15 minutes dans l’obscurité.
    6. Ajouter 1 mL de tampon par 107 cellules dans le tube et centrifuger à 300 × g pendant 10 min à 4 ° C pour laver les cellules. Jeter le surnageant après la centrifugation.
    7. Resuspendre le culot dans 500 µL de tampon par 107 cellules.
  3. Séparation magnétique
    1. Placer la colonne avec les ailes de la colonne vers l’avant dans le champ magnétique du séparateur magnétique.
    2. Rincer la colonne séparateur magnétique (MS) avec 500 µL de tampon par 107 cellules.
    3. Transférer la suspension de la cellule dans la colonne. Laisser les cellules négatives passent par le champ magnétique de se défaire de ces cellules sans étiquette.
    4. Laver la colonne x 1-2 avec 500 µL de tampon par 107 cellules et éliminer les intermédiaires.
    5. Transférer la colonne dans un tube à centrifuger (15 mL).
    6. Ajouter 1 mL de tampon par 107 cellules de la colonne et immédiatement pousser le piston dans la colonne afin d’éliminer les cellules magnétiquement étiquetées.
    7. Répétez la procédure ci-dessus avec un MS Column d’augmenter la pureté du CD90+ cellules, qui peuvent enrichir la fraction d’élution.
    8. Centrifuger la suspension de cellules à 300 × g pendant 10 min, aspirer le surnageant et remettre en suspension il au milieu de culture.
  4. Culture de la CD90+ rbSF-MSCs
    1. Ensemencer les cellules en boîtes de 100 mm après le tri des cellules activées magnétique.
    2. Incuber les boîtes à 37 ° C dans un incubateur à cellules humidifié avec 5 % de CO2.
    3. Lorsque la confluence de 80 à 90 % de la culture primaire est obtenue, à environ 7-10 jours, digérer les cellules adhérentes avec 0,25 % de trypsine-EDTA et passage à une dilution de 1 / 2 pour faire le passage 2 (P2).
    4. Utiliser la même méthode pour passer les cellules au passage 3 (P3), qui peuvent être utilisés pour les tests in vitro .
      Remarque : Après la sous-culture et la purification, on obtient environ 1 x 107 rbSF-MSCs.

3. identification des rbSF-MSCs

  1. Confirmation de marqueur de surface des rbSF-MSCs par cytométrie en flux
    1. Lorsque les MSCs sont confluents de 80 à 90 % à P3, laver les cellules avec du PBS et traitez-les avec 1 mL de 0,25 % trypsine-EDTA. Puis, incuber les MSCs à 37 ° C pendant 2-3 min jusqu'à ce que les cellules sont détachent.
    2. Récolter les cellules à l’aide de 10 mL de PBS, transférez-les dans un tube conique (15 mL) et les centrifuger à 300 x g pendant 5 min à température ambiante.
    3. Jeter le surnageant. Resuspendre le culot dans 500 µL de PBS et transférer dans un tube de 1,5 mL.
    4. Incuber une dilution au 1/100 de l’anticorps conjugué FITC et PE-conjugué (isotype, FITC-CD34/PE-CD45, FITC-CD105/PE-CD44) pendant 1 h dans l’obscurité à 4 ° C.
    5. Centrifuger ce mélange à 300 × g pendant 5 min à température ambiante et laver les cellules deux fois avec du PBS par centrifugation à 300 × g pendant 5 minutes chaque fois. Jeter le surnageant.
    6. Remettre en suspension les cellules de 500 µL de PBS, transférer la suspension de cellules dans un tube à fond rond (5 mL) et l’analyser à l’aide d’un cytomètre en flux.
      NOTE : Acquisition de données sur un cytomètre doté de deux canaux de fluorescence : 533/30 et 585/40. Pour chaque isotype de fluorescence, utilisez le contrôle de l’isotype d’ajuster la tension laser approprié et définir l’intensité minimale requise pour obtenir un histogramme de fluorescence qui affiche les bords gauche et droite du pic. Recueillir un minimum de 10 000 événements pour les analyses statistiques.
  2. Multidifferentiation des rbSF-MSCs
    Remarque : Utilisation P3 rbSF-MSCs pour les dosages multidifferentiation in vitro .
    1. Différenciation ostéogénique
      1. Préparer le milieu ostéogénique induction : DMEM basic (1 x) contenant de 50 mM de phosphate-2-acide L-ascorbique, 10 mM de le α-glycérophosphate et 100 nM de dexaméthasone.
      2. Les cellules à 103 cellules/cm2 dans une plaque de culture de tissu de 6 puits de semences et leur culture dans le milieu de l’induction ostéogénique.
      3. Changer le milieu inducteur tous les 3 jours pendant 3 semaines.
      4. Fixer les cellules avec 4 % de formaldéhyde pendant 30 min à température ambiante après la différenciation est terminée, en détachant les cellules avec le rouge d’alizarine 1 % pendant 5 min et puis lavez les 3 x avec PBS15.
    2. Différenciation adipocytaire
      1. Préparer le milieu d’induction adipocytaire : DMEM basic (1 x), composé de 100 mM de l’indométhacine, 10 mg/mL de l’insuline humaine recombinante, 1 mM de la dexaméthasone et 0,5 mM de la 3-isobutyl-1-méthylxanthine.
      2. Traiter les P3 rbSF-CSM pendant trois semaines dans le milieu d’induction adipocytaire.
      3. Après 3 semaines, tacher les vacuoles de lipides neutres à l’aide de l’huile rouge O pour confirmer la différenciation adipocytaire. Fixer les cellules dans une solution de formaldéhyde de 4 % pendant 30 min à température ambiante et puis lavez-les 3 x avec PBS16.
    3. Différenciation chondrogéniques
      1. Préparer le milieu d’induction chondrogéniques : DMEM basic (1 x) composé de 10 ng/mL de TGFβ1, 1 % de son supplément, 0,35 mM de L-proline, 100 nM de dexaméthasone, 50 mM de L-ascorbique acide-2-phosphate et 1 mM de pyruvate de sodium.
      2. Utiliser le pellet mise en culture pour l’induction chondrogéniques. Centrifuger 5 × 105 P3 rbSF-MSCs à 1500 tr/min pendant 10 min dans un tube en polypropylène (15 mL) pour former une boulette.
      3. Culture des granulés pendant 3 semaines avec le milieu d’induction chondrogéniques.
      4. Changer le support tous les 3 jours pendant 3 semaines.
      5. Après l’induction de 3 semaines, incorporer le culot cellulaire avec de la paraffine, section, il en tranches de 4 mm et détachant à l’aide de 0,1 % bleu de Toluidine pendant 30 min à température ambiante17.
  3. Extraction de l’ARN totale et analyse quantitative PCR en temps réel (qRT-PCR)
    1. Isoler l’ARN total des cellules après l’induction de la différenciation de 3 semaines en utilisant l’extraction de l’ARN commerciale nécessaire (voir la Table des matières).
      1. Enlever le milieu de culture dans la boîte de Petri et puis ajouter 1 mL de réactif de l’isolement.
      2. Lyse des cellules par pipetage répétées jusqu'à ce que la solution soit homogène. Il incuber à température ambiante pendant 3 min.
      3. Transvaser le lysat cellulaire dans un tube de microtubes de 1,5 mL.
      4. Ajouter 100 µL de chloroforme, secouez-le par main 15 x et incuber le mélange à température ambiante pendant 3 min.
      5. Centrifuger le tube à 12 000 x g pendant 15 min à 4 ° C. Transvaser le surnageant dans un nouveau tube de microtubes de 1,5 mL.
      6. Ajouter 500 µL d’isopropanol et précipiter l’ARN pendant 10 min à température ambiante.
      7. Centrifuger à 12 000 × g minat 10 4 ° C. Le culot de RNA devrait être visible au fond du tube.
      8. Retirez le surnageant et puis ajouter 500 µL d’éthanol 75 %. Brièvement, faites tourner le tube pendant plusieurs secondes pour laver le culot de RNA. Il centrifuger à 7 500 × g pendant 5 min à 4 ° C.
      9. Supprimer l’éthanol résiduel.
      10. Dissoudre le culot de RNA dans 10 µL d’eau DEPC et placer les tubes sur la glace.
    2. Marche arrière transcrire l’ARN total en ADNc avec une synthèse de l’ADN nécessaire (voir la Table des matières).
      Remarque : Effectuez toutes les procédures suivantes sur la glace.
      1. Préparer le mélange maître de la transcriptase inverse.
      2. Ajouter 25 µL d’ARN DNase traités dans chaque tube avec 1 µg d’ARN.
      3. Incuber le mélange aux températures suivantes à l’aide d’un thermocycleur PCR : 26 ° C pendant 10 min (pour permettre les hexamères aléatoire de recuire), 42 ° C pendant 45 min (transcriptase inverse) et à 75 ° C pendant 10 min (inactiver la transcriptase inverse).
      4. Immédiatement analyser l’ADNc obtenu par quantitative PCR en temps réel, ou conserver à-20 ° C.
    3. Effectuer l’analyse d’expression de gène avec un système de PCR quantitatif en temps réel.
      1. Utilisez qRT-PCR Master Mix (voir Table des matières) pour effectuer des PCR. Les amorces PCR pour GAPDH, Runx2, Agg et PPARγ sont énumérés au tableau 1.
      2. Calculer l’expression des gènes à l’aide de la méthodeΔΔCT 2.
      3. Procéder à une analyse statistique en utilisant un logiciel de statistique standard. Un échantillon indépendant t-test permet de comparer les moyens du groupe.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Isolement, Purification et la Culture des rbSF-MSCs :
Ce protocole utilise des MACS d’isoler rbSF-MSCs, basés sur l’expression du marqueur de surface MSC CD90. Un diagramme de flux de processus d’isolement des rbSF-MSCs, purification et la caractérisation et le protocole de culture in vitro est illustré à la Figure 1.

Morphologie des cellules après des cellules activées magnétique tri (MACS) avec CD90 :
Tout d’abord, pour les MACS, marquer MSCs avec CD90 billes magnétiques. Après centrifugation, remettre un maximum de 10 cellules de7 à 80 µL d’un tampon de tri rafraîchie et puis ajouter 20 µL de billes magnétiques CD90, suivie de vortex et une incubation à 4 ° C pendant 15 minutes. Après cela, laver les cellules avec 1 mL de tampon tri et les remettre en suspension dans 500 µL de tampon tri. Avant de procéder avec le tri magnétique, répétez l’étape de lavage. Cette procédure critique est illustrée à la Figure 2.

Avant le tri, les populations de cellules fluide synovial lapin adhérentes affichent morphologie hétérogène, contenant la cellule divers types et tailles (Figure 3 a-C). Après les MACS, les populations de cellules exposé morphologie homogène. Le nombre de cellules a augmenté avec la sous-culture (Figure 3D-F).

Surface rbSF-MSCs enrichie en caractéristiques de MACS :
Tri des cellules activés par fluorescence (FACS) a été réalisée afin d’analyser l’enrichissement de rbSF-MSCs par MACS avec CD90. Avant les Mac, la population cellulaire comptait environ 40 % de MSCs (Figure 4D; isotype contrôles dans Figure 4 a,B). Suite de MACS, la population enrichie contenait environ > 99 % MSCs (Figure 4E,F). Les marqueurs de cellules de la lignée hématopoïétique CD34 et CD45 ont été, à 0,318 %, les deux rarement exprimées après Mac, qui est une diminution de leur expression initiale à 25,9 %. Avant la sélection, il y avait environ 28 % CD90+ cellules (Figure 4) ; après purification, environ 98 % CD90+ cellules ont été obtenus (Figure 4 H).

Différenciation multilignée potentiels de rbSF-MSCs :
Pour caractériser la capacité des rbSF-MSCs pour différencier dans les lignées différentes telles qu’ostéogénique, adipocytaire et chondrogéniques cellules, les rbSF-MSCs enrichies par MACS ont été simultanément cultivées dans un milieu de différenciation spécifique et en un moyen de différenciation sans cytokine pour servir de témoins. Lorsque l’induction a été achevée, marqueurs spécifiques lignée ont été analysés par la coloration et la RT-PCR. Alizarine coloration de composés de calcium a démontré que nodules minéralisés avaient formé dans les rbSF-MSCs après 3 semaines dans les conditions d’induction ostéogénique (Figure 5 a). Après 3 semaines d’induction adipocytaire, une accumulation de lipides riches en vacuoles pouvait être détectée par intracellulaire Oil Red O coloration (Figure 5 b). Pendant 21 jours d’induction chondrogéniques, le culot cellulaire a été histologiquement analysé avec une coloration bleu de toluidine. Les cellules positives pour la coloration (de protéoglycane) étaient considérés comme des cellules chondrocytes semblables (Figure 5). Semblable à ce résultat, une analyse quantitative de l’expression des gènes de différenciation potentielle a aussi démontré la capacité de différenciation de ces cellules. Les niveaux d’expression de Agg (un marqueur de chondrocytes), PPARγ (un marqueur adipocytaire) et Runx2 (un marqueur de l’ostéoblaste) étaient surexprimés dans des conditions induites. Ces données s’est avérée la capacité de différenciation multipotentes de rbSF-MSCs dans trilineages (Figure 5).

Figure 1
Figure 1 : schéma complet d’isolement, purification et caractérisation des SF-MSCs de lapins néo-zélandais blancs. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 2
Figure 2 : Protocole pour cellule activée magnétique, tri (MACS) avec CD90. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 3
Figure 3 : morphologie de la monocouche cultivées rbSF-MSCs avant et après Mac comme examinées dans le cadre ordinaire inversé microscopie. A-C) Avant le tri, les populations de cellules fluide synovial lapin adhérentes affichent hétérogénéité. Ils contiennent des types cellulaires différents et des tailles, ovale, long-broche, broche de court et la morphologie stellaire. La morphologie principale de P2 et P6 est une morphologie de broche (A: P2, B: P3, C: P6). D-F) Suite de MACS avec CD90, les populations de cellules présentent une morphologie homogène. Avec une sous-culture, augmente le nombre de cellules (D: P2, E: P3, F: P6). Echelle = 100 µm. s’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 4
Figure 4 : Identification des marqueurs de surface rbSF-MSC. Par analyse en cytométrie en flux, les rbSF-MSCs sont positifs pour les marqueurs MSC CD44 et CD105, tandis que des résultats négatifs pour le marqueur de cellules endothéliales CD34 et le marqueur de cellules hématopoïétiques CD45. Avant les Mac, ces cellules ont un faible taux de positivité pour CD44 et CD105. Cependant, après Mac, le taux de positivité était élevé. A, B) Ces deux albums images montrent les données de contrôle d’isotype. C, D) Ces résultats montre qu’avant MACS la population rbSF-MSC est composée d’environ 40 % des cellules MSC. E, F) Après Mac, la population enrichie contient > 99 % des cellules CSM. G, H) Ces images montrent l’analyse de cytométrie en flux de la CD90+ marqueur, (G) avant et (H) après Mac tri. S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Figure 5
Figure 5 : analyse des marqueurs de la lignée spécifiques par coloration et RT-PCR. A) alizarine coloration rouge montre que forment des nodules minéralisés sous l’induction ostéogénique pendant 3 semaines. B) après 3 semaines d’induction adipocytaire, l’accumulation des vacuoles riches en lipides est détectée par la souillure d’huile rouge O intracellulaire. C) 3 semaines de chondrogéniques induction, le culot cellulaire a été histologiquement dosé avec une coloration bleu de toluidine. Les cellules positives pour la coloration (de protéoglycane) étaient considérés comme des cellules chondrocytes. Echelle = 100 µm. D) après la mise en culture pendant 3 semaines, l’ARNm relative expression de marqueurs ostéoblastes (Runx2), marqueurs adipocytaire (PPARγ) et marqueurs de chondrogéniques (Agg) est détecté. Pour toutes les analyses, les valeurs de p < 0,01 étaient considérés comme statistiquement des différences significatives, en utilisant le test de Kruskal-Wallis (indiqué comme **). S’il vous plaît cliquez ici pour visionner une version agrandie de cette figure.

Gènes Avant l’amorce (5'-3') Inverser l’apprêt (5'-3')
Runx2 TATGAAAAACCAAGTAGCAAGGTTC GTAATCTGACTCTGTCCTTGTGGAT
TOT. GCTACACCCTAAAGCCACTGCT CGTAGTGCTCCTCATGGTCATC
PPARΓ2 GCAAACCCCTATTCCATGCTG CACGGAGCTGATCCCAAAGT
GAPDH GGAGAAAGCTGCTAA ACGACCTGGTCCTCGGTGTA

Tableau 1 : Liste des gènes et amorces utilisées dans cette étude quantitative PCR en temps réel.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

L’existence de MSCs dans le liquide synovial offre une alternative pour la thérapie cellulaire. Des études antérieures ont montré que les blessures sites contiennent des quantités plus élevées de cellules souches mésenchymateuses dans leur liquide synovial, qui peuvent être positivement corrélée avec la période post-traumatique5. Les MSCs dans le liquide synovial peuvent être bénéfiques au tissu pour améliorer la cicatrisation spontanée après une blessure18,19. L’application clinique des SF-MSCs a rarement été reprise dans la littérature, principalement parce que les mécanismes des SF-MSCs dans les articulations restent indéfinis20. Jones et al. 21 a signalé que les numéros de hSF-MSC dans l’articulation du genou considérablement augmentent 7 fois durant les premiers stades de l’arthrose (OA). Ils pensaient que les SF-MSCs accrues pourraient contribuer au maintien de l’homéostasie physiologique des articulations.

Un modèle animal idéal est un outil indispensable dans le développement d’agents thérapeutiques utilisant la médecine régénérative et translationnelle. Bien qu’il existe des différences évidentes entre les humains et les lapins, le lapin est largement utilisé comme modèle animal pour l’étude des tissus régénération7, donc nous incitant à le choisir comme modèle pour notre étude de SF-MSCs. Un des obstacles plus redoutables dans cet effort est que l’isolement de SF-MSCs souvent traduit par des taux de succès variés et fréquences colonie faible, comme indiqué dans le précédent recherche5. Par conséquent, plusieurs chercheurs ont mis l’accent sur le taux de réussite et l’optimisation de l’isolement de MSCs de SF.

Cette studyeffectively a utilisé une procédure de MACS pour le tri de grande pureté et de la viabilité du CD90+ MACSs du fluide synovial de lapin22. Ce système Mac utilise des microbilles magnétiques conjugués à hautement spécifiques anticorps couplés à un antigène de surface de cellules particulières, CD90 dans ce cas et permet pour sélectionner le type de cellule cible particulière, à savoir des cellules exprimant CD90. Avant la purification avec CD90 microbilles, nous culture généralement les primaires rbSF-CSM pendant 14 jours. Durant cette période, beaucoup de colonies se forment dans les récipients de culture. Ce protocole suggère en sélectionnant les colonies plus de 2 mm de diamètre. Lorsque vous utilisez la bouteille de clonage pour la sélection de la colonie, nous l’observons attentivement sous le microscope. La seule colonie se propage plus loin pour la purification.

Au cours du processus de séparation et de purification, les cellules exprimant CD90 qui ont été marqués par magnétisme sont attirés par le champ magnétique du séparateur dans la colonne, tandis que les cellules non marquées s’écoule. Après le processus de lavage, la colonne est supprimée à partir du champ magnétique du séparateur, et les cellules cibles sont éluées de la colonne. Cette approche spécifique de faisant des MACS permet l’isolement des rbSF-MSCs qui exprime spécifiquement les cellules souches surface marqueurs CD44 et CD105, démontrant que ces cellules isolées sont des cellules souches mésenchymateuses plutôt que des cellules hématopoïétiques23. Ces rbSF-MSCs purifiés peuvent être cultivées in vitro sur une longue période sans aucune modification significative des caractéristiques morphologiques et l’expression du marqueur. En outre, les rbSF-MSCs enrichies par MACS présentent une capacité de différenciation multipotentes en cellules de lignées multiples, y compris en chondrogéniques, adipocytaire et cellules ostéogéniques.

L’opération de Mac est un protocole facile à réaliser et peut se faire sur le banc23. En outre, la Food and Drug Administration (FDA) a approuvé la technologie faisant MACS, et ainsi il est facile d’exécuter des applications cliniques,24. CD90 est un marqueur de surface de cellules souches mésenchymateuses et chercheurs ont montré que CD90 MSCs positifs ont une meilleure chondrogéniques différenciation capacité25,26. La pluripotence des MSCs a été caractérisée, basée sur la morphologie et l’expression des marqueurs spécifiques des cellules souches27.

Cette étude a plusieurs limitations. La première lacune du présent protocole est liée à des marqueurs de surface que nous avons examiné. Basée sur une instruction par la société internationale pour la thérapie cellulaire (ISCT), les critères minimes pour définir multipotentes MSCs est positive pour CD90 CD105, CD44 et CD73 et négative pour CD11b, CD14, CD34 ou CD45, CD79a et/ou HLA-DR28. Dans le but d’atténuer l’effort et les dépenses nécessaires pour tester l’ensemble du panneau, chercheurs dans cette étude soigneusement sélectionné deux des marqueurs négatifs et deux des marqueurs positifs recommandés. Deuxièmement, il prend beaucoup de temps pour former les colonies qui seront sélectionnés pour une étude plus approfondie. En outre, l’hypertrophie est un problème majeur durant l’induction chondrogéniques de SF-MSCs in vitro. À l’étape ultérieure, le collagène de type toujours express X de chondrocytes hypertrophiques (COLX), métalloprotéinase matricielle 13 (MMP13), phosphatase alcaline (ALP) et avorton axés sur le facteur de transcription 2 (Runx2)29. Recherche suggère que la culture en trois dimensions (3D) pellet, systèmes de culture dynamique et la co-culture avec des chondrocytes sont avantage pour MSC stablement chondrogéniques différenciation30,31. Dans cette étude, un système de culture de pellet a été utilisé pour l’induction de la chondrogéniques du SMC afin d’éviter l’hypertrophie.

En conclusion, nous avons mis en place une méthode simple pour l’isolation et la purification de MSCs dans le liquide de rinçage de cavité articulaire et caractérisé les MSCs obtenus qui y sont. Ce protocole a fourni une plate-forme pour l’exploration et l’enquête d’utilité potentielle des articulaire synovial liquide dérivé MSCs dans les stratégies de régénération mixte roman.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs déclarent qu’ils n’ont aucun intérêt financier concurrentes.

Acknowledgments

Cette étude a été financée par les subventions suivantes : la Fondation des sciences naturelles de Chine (no 81572198 ; No. 81772394) ; le Fonds pour la Construction de haute niveau Discipline médicale de l’Université de Shenzhen (n° 2016031638) ; la Fondation de recherche médicale de la Province de Guangdong, Chine (no. A2016314) ; et Shenzhen projets Science et technologie (no. JCYJ20170306092215436 ; Lol JCYJ20170412150609690 ; Lol JCYJ20170413161800287 ; Lol SGLH20161209105517753 ; Lol JCYJ20160301111338144).

Materials

Name Company Catalog Number Comments
Reagents
MesenGro StemRD MGro-500 1703 Warm in 37 °C water bath before use
MesenGro Supplement StemRD MGro-500 M1512 Component of MSCs culture medium
DMEM basic Gibco Inc. C11995500BT MSCs differentiation medium
Isotonic saline solution Litai, China 5217080305 Cavity arthrocentesis procedure reagent
Phosphate-Buffered Saline (PBS) HyClone Inc. SH30256.01B PBS, free of Ca2+/Mg2+
Fetal Bovine Serum (FBS) Gibco Inc. 10099-141 Component of MSCs culture medium
Povidone iodine solution Guangdong, China 150605 Sterilization agent
75% ethanol Lircon, china 170917 Sterilization agent
0.25% Trypsin/EDTA Gibco Inc. 25200-056 Cell dissociation reagent
1% Penicillin-Streptomycin Gibco Inc. 15140-122 Component of MSCs medium
MACS Running Buffer MiltenyiBiotec 5160112089 Containing phosphate-buffered saline (PBS), 0.5% bovine serum albumin(BSA), and 2 mMEDTA
CD90 antibody conjugated MicroBeads MiltenyiBiotec 5160801456 For magnetic activated cell sorting
Sodium pyruvate Sigma-Aldrich P2256 Component of MSCs chondrogenic differentiation
Dexamethasone Sigma-Aldrich D1756 Component of MSCs osteogenic differentiation
ITS BD 354352 1%, Component of MSCs chondrogenic differentiation
L-proline Sigma-Aldrich P5607 0.35 mM, Component of MSCs chondrogenic differentiation
L-ascorbic acid-2-phosphate Sigma-Aldrich A8960 50 mM, Component of MSCs chondrogenic differentiation
3-isobutyl-1-methylxanthine Sigma-Aldrich I5879 0.5 mM, Component of adipogenic differentiation
Indomethacin Sigma-Aldrich I7378 100 mM, Component of adipogenic differentiation
TGFβ1 Peprotech 100-21 10 ng/mL, Component of MSCs chondrogenic differentiation
α-glycerophsphate Sigma-Aldrich G6751 Component of MSCs osteogenic differentiation
CD34 Polyclonal Antibody, FITC Conjugated Bioss bs-0646R-FITC Hematopoietic stem cells marker
Mouse antirabbit CD44 Bio-Rad MCA806GA Thy-1 membrane glycoprotein (MSCs marker)
CD45 (Monoclonal Antibody) Bio-Rad MCA808GA Hematopoietic stem cells marker
CD105 antibody Genetex GTX11415 MSCs marker
Isopropyl alcohol Sigma-Aldrich I9030 Precipitates RNA extraction organic phases
Trichloromethane Wenge, China 61553 Extract total RNA
Trizol Invitrogen 15596-018 Isolate total RNA
SYBR green master mix Takara Bio, Japan RR420A PCR test
cDNA synthesis kit Takara Bio, Japan RR047A Reverse-transcribed to complementary DNA
Alizarin Red Sigma-Aldrich A5533 Staining of calcium compounds
Toluidine Blue Sigma-Aldrich 89640 Staining of cartilaginous tissue
Oil Red O solution Sigma-Aldrich O1391L Lipid vacuole staining
Equipment
MiniMACS Separator MiltenyiBiotec 130-042-102 For magnetic activated cell sorting
MultiStand MiltenyiBiotec 130-042-303 For magnetic activated cell sorting
MS Columns MiltenyiBiotec 130-042-201 For magnetic activated cell sorting
Cell Strainer FALCON Inc. 352340 40 μm nylon
Hemocytometer ISOLAB Inc. 075.03.001 Cell counting
Falcon 100 mm dish Corning 353003 Cell culture dish
Microcentrifuge tube Axygen MCT-150-C RNA Extraction and PCR
Centrifuge Tubes Sigma-Aldrich 91050 Gamma-sterilized
High-speed centrifuge Eppendorf 5804R Centrifuge cells
Carbon dioxide cell incubator Thermo scientific 3111 Cell culture
Real-Time PCR Instrument Life Tech QuantStudio Real-Time quantitative polymerase chain reaction
Flow cytometer BD Biosciences 342975 Cell analyzer
Pipettor Eppendorf O25456F Transfer the liquid
Cloning cylinder Sigma-Aldrich C3983-50EA Isolate and pick individual cell colonies
Sterile hypodermic syringe Double-Dove, China 131010 Arthrocentesis procedure
Rabbit cage Zhike, China ZC-TGD Restrain the rabbit

DOWNLOAD MATERIALS LIST

References

  1. Oreffo, R. O., Cooper, C., Mason, C., Clements, M. Mesenchymal stem cells: lineage, plasticity, and skeletal therapeutic potential. Stem Cell Reviews. 1, (2), 169-178 (2005).
  2. Asakura, A., Rudnicki, M. A., Komaki, M. Muscle satellite cells are multipotential stem cells that exhibit myogenic, osteogenic, and adipogenic differentiation. Differentiation. 68, (4-5), 245-253 (2001).
  3. De, B. C., Dell'Accio, F., Tylzanowski, P., Luyten, F. P. Multipotent mesenchymal stem cells from adult human synovial membrane. Arthritis Rheumatology. 44, (8), 1928-1942 (2001).
  4. Zuk, P. A., et al. Human adipose tissue is a source of multipotent stem cells. Molecular Biology of the Cell. 13, (12), 4279-4295 (2002).
  5. McGonagle, D., Jones, E., English, A., Emery, P. Enumeration and phenotypic characterization of synovial fluid multipotential mesenchymal progenitor cells in inflammatory and degenerative arthritis. Arthritis & Rheumatism. 50, (3), 817-827 (2004).
  6. Jia, Z., et al. Isolation and characterisation of human mesenchymal stem cells derived from synovial fluid by magnetic activated cell sorting (MACS). Cell Biology International. (2017).
  7. Bashir, M., et al. Isolation, culture and characterization of New Zealand white rabbit mesenchymal stem cells derived from bone marrow. Asian Journal of Animal & Veterinary Advances. 10, (8), 13-30 (2015).
  8. Song, X., et al. Differentiation potential of rabbit CD90-positive cells sorted from adipose-derived stem cells in vitro. In Vitro Cellular & Developmental Biology - Animal. 53, (1), 1-6 (2016).
  9. Lee, T. C., et al. Comparison of surface markers between human and rabbit mesenchymal stem cells. PLOS One. 9, (11), e111390 (2014).
  10. Stewart, M. C., Chen, Y., Bianchessi, M., Pondenis, H. Phenotypic characterization of equine synovial fluid-derived chondroprogenitor cells. Stem Cell Biology and Research. 3, (1), (2016).
  11. Prado, A. A. F., et al. Characterization of mesenchymal stem cells derived from the equine synovial fluid and membrane. BioMed Central Veterinary Research. 11, (1), 281 (2015).
  12. Yoshimura, H., et al. Comparison of rat mesenchymal stem cells derived from bone marrow, synovium, periosteum, adipose tissue, and muscle. Cell and Tissue Research. 327, (3), 449-462 (2007).
  13. Wu, C. C., et al. Intra-articular injection of platelet-rich fibrin releasates in combination with bone marrow-derived mesenchymal stem cells in the treatment of articular cartilage defects: an in vivo study in rabbits. Journal of Biomedical Materials Research Part B: Applied Biomaterials. 105, (6), 1536-1543 (2017).
  14. John, T., Lerche, P. Anesthesia and Analgesia for Veterinary Technicians. Mosby Elsevier. St. Louis, Missouri. (2011).
  15. Koyama, N., et al. Pluripotency of mesenchymal cells derived from synovial fluid in patients with temporomandibular joint disorder. Life Sciences. 89, (19-20), 741-747 (2011).
  16. Kim, Y. S., et al. Isolation and characterization of human mesenchymal stem cells derived from synovial fluid in patients with osteochondral lesion of the talus. American Journal of Sports Medicine. 43, (2), 399-406 (2015).
  17. Vereb, Z., et al. Immunological properties of synovial fluid-derived mesenchymal stem cell-like cells in rheumatoid arthritis. Annals of the Rheumatic Diseases. 74, (Suppl 1), A64-A65 (2015).
  18. Matsukura, Y., Muneta, T., Tsuji, K., Koga, H., Sekija, I. Mesenchymal stem cells in synovial fluid increase after meniscus injury. Clinical Orthopaedics & Related Research. 472, (5), 1357-1364 (2014).
  19. Morito, T., et al. Synovial fluid-derived mesenchymal stem cells increase after intra-articular ligament injury in humans. Rheumatology. 47, (8), 1137-1143 (2008).
  20. Hegewald, A. A., et al. Hyaluronic acid and autologous synovial fluid induce chondrogenic differentiation of equine mesenchymal stem cells: a preliminary study. Tissue & Cell. 36, (6), 431-438 (2004).
  21. Jones, E. A., et al. Synovial fluid mesenchymal stem cells in health and early osteoarthritis: detection and functional evaluation at the single cell level. Arthritis & Rheumatism. 58, (6), 1731-1740 (2008).
  22. Makker, K., Agarwal, A., Sharma, R. K. Magnetic activated cell sorting (MACS): utility in assisted reproduction. Indian Journal of Experimental Biology. 46, (7), 491-497 (2008).
  23. Schmitz, B., et al. Magnetic activated cell sorting (MACS) — a new immunomagnetic method for megakaryocytic cell isolation: comparison of different separation techniques. European Journal of Haematology. 52, (5), 267-275 (1994).
  24. Reinhardt, M., Bader, A., Giri, S. Devices for stem cell isolation and delivery: current need for drug discovery and cell therapy. Expert Review of Medical Devices. 12, (3), 353-364 (2015).
  25. Gronthos, S., Zannettino, A. C. W. A method to isolate and purify human bone marrow stromal stem cells. Mesenchymal Stem Cells. Prockop, D. J., Bunnell, B. A., Phinney, D. G. Vol. 449 of Methods in Molecular Biology 45-57 (2008).
  26. Krawetz, R. J., et al. Synovial fluid progenitors expressing CD90+ from normal but not osteoarthritic joints undergo chondrogenic differentiation without micro-mass culture. PLOS One. 7, (8), e43616 (2012).
  27. Ogata, Y., et al. Purified human synovium mesenchymal stem cells as a good resource for cartilage regeneration. PLOS One. 10, (6), e0129096 (2015).
  28. Dominici, M., et al. Minimal criteria for defining multipotent mesenchymal stromal cells: the International Society for Cellular Therapy position statement. Cytotherapy. 8, (4), 315-317 (2006).
  29. Gauci, S. J., et al. Modulating chondrocyte hypertrophy in growth plate and osteoarthritic cartilage. Journal of Musculoskeletal & Neuronal Interact. 8, (4), 308 (2008).
  30. Cooke, M. E., et al. Structured three-dimensional co-culture of mesenchymal stem cells with chondrocytes promotes chondrogenic differentiation without hypertrophy. Osteoarthritis and Cartilage. 19, (10), 1210-1218 (2011).
  31. Fischer, J., Dickhut, A., Rickert, M., Richter, W. Human articular chondrocytes secrete parathyroid hormone-related protein and inhibit hypertrophy of mesenchymal stem cells in coculture during chondrogenesis. Arthritis and Rheumatism. 62, (9), 2696-2706 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics