Magnetisk aktiveret celle sortering strategier for at isolere og rense Synovial væske-afledte mesenkymale stamceller fra en kanin Model

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Denne artikel præsenterer en enkel og økonomiske protokol til ligetil isolering og oprensning af mesenkymale stamceller fra New Zealand hvid kanin synovial væske.

Cite this Article

Copy Citation | Download Citations

Jia, Z., Liang, Y., Li, X., Xu, X., Xiong, J., Wang, D., Duan, L. Magnetic-Activated Cell Sorting Strategies to Isolate and Purify Synovial Fluid-Derived Mesenchymal Stem Cells from a Rabbit Model. J. Vis. Exp. (138), e57466, doi:10.3791/57466 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Mesenchymale stamceller (msc) er den vigtigste celle for celle-baseret terapi. MSC'er fra artikulær hulrummet synovial væske kunne potentielt anvendes til brusk vævsmanipulering. MSC'er fra synovial væske (SF-MSCs) har været betragtet som lovende kandidater til artikulære regenerering, og deres potentiel terapeutisk fordel har gjort dem en vigtig forskningsemne for sent. SF-MSCs fra knæet hulrummet af New Zealand hvid kanin kan være ansat som en optimeret translationel model til vurdering af menneskers regenerativ medicin. Ved hjælp af CD90-baserede magnetisk aktiveret celle sortering (MLA) teknologi, denne protokol med held opnår kanin SF-MSCs (rbSF-MSCs) fra denne kanin model og yderligere viser fuldt MSC Fænotypen af disse celler ved at tilskynde dem til at differentiere til osteoblaster, adipocytter og chondrocytter. Denne tilgang kan derfor anvendes i celle biologi forskning og vævsmanipulering ved hjælp af simple udstyr og procedurer.

Introduction

MSC'er er blevet foreslået som en værdifuld kilde for regenerativ medicin, især for brusk læsioner. MSC'er, herunder chondrocytter, osteoblaster, adipocytter, skelet myocytes og visceralt stromale celler, bredt udvide områder for stamcelletransplantation på grund af deres høje ekspansion sats og multi lineage differentiering potentielle1. MSC'er kan isoleres fra det skelet muskler, synovium, knoglemarv og fedtvæv2,3,4. Resultaterne har også confirmed tilstedeværelsen af MSCs i synovial væske, og tidligere forskning har identificeret synovial væske-afledte MSCs (SF-MSCs) som lovende kandidater til artikulære regenerering5,6.

Men forskning og prækliniske forsøg med menneskelige prøver er underlagt mange etiske spørgsmål. I stedet, kaniner har været og fortsat vil være mest almindeligt anvendte dyrearter for at demonstrere, at transplantation af MSCs kan reparere bruskskader. I de senere år et stigende antal forskere har studeret kanin mesenkymale stamceller (rbMSCs) begge i in vitro og i vivo, som disse celler er ligner menneskelige MSCs i deres cellulær biologi og væv fysiologi. Ligeledes, rbMSCs er i stand til at overholde plast overflader, viser spindel-fibroblast morfologi i menneskelige MSCs. Derudover er kanin mesenchymale prøver enkel og let at opnå7. Derudover er de mest afgørende punkter at rbMSCs udtrykker overflade markører, såsom CD44, CD90 og CD105, og at flere lineage differentiering potentielle er bevaret, som er i overensstemmelse med kriterierne for identifikation af MSC befolkninger som defineret af International Society for cellulære terapi8,9. Især er synovial væske chondroprogenitors i stand til at ikke-hypertrofisk chondrogenesis når induceret af TGF-B1, hvilket gør dem egnet celle kilder for fænotype ledbrusken regenerering10,11, 12.

Isolering af SF-MSCs er imidlertid meget forskellig fra andre væv, herunder navlestrengen, fedtvæv, perifert blod og knoglemarv. I øjeblikket, er de mest almindelige metoder til rensning og sortering af SF-MSCs flowcytometri og immunomagnetic perle-baseret sortering, selv om metoden flow flowcytometri kræver et bestemt miljø og meget dyre instrumenter13.

Denne artikel præsenterer en procedure for simpel og minimalt invasiv indsamling af prøver af synovialvæsken fra New Zealand hvide kaniner. Under proceduren, rbSF-MSCs er stabilt udvidet in vitro- og derefter isoleret med CD90 positiv magnetisk bead-baserede procedurer. Endelig viser protokollen, hvordan du anskaffer MSCs med høj renhed og levedygtighed fra høstede celle kilder.

I denne protokol, er de isolerede rbSF-MSCs karakteriseret, baseret på deres morfologi, udtryk for specifikke markører og pluripotency stamceller. Flow flowcytometri-baserede Immunofænotypning afslører en betydelig positiv udtryk af CD44 og CD105, udtryk for CD45 og CD34 er negativ. Endelig viser en in vitro- analyse for rbSF-MSC'er, osteogenic, adipogenic og chondrogenic differentieringen af disse celler.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle dyreforsøg blev gennemført i overensstemmelse med retningslinjerne for regionalstøtte etiske komité, og alle dyr procedurer blev godkendt af institutionelle Animal Care og brug Udvalget af Shenzhen anden People's Hospital, Shenzhen Universitet.

1. Isolér og kultur rbSF-MSCs

  1. Forberedelserne til en dyr procedure
    1. Forberede skeletalt modne kvinde New Zealand hvide kaniner til samling af rbSF-MSCs. Udfør en klinisk undersøgelse af kaniner én dag før anæstesi og arthrocentesis proceduren.
      Bemærk: fysiske undersøgelser bør omfatte vægt (2,0-2,5 kg), køn (kvinde), og kropstemperatur, respirationsfrekvens og puls. Parameter intervaller for klinisk raske kaniner er 30-50 min. til åndedræt sats, 220-280 min puls og 38-39 ° C til kropstemperatur.
    2. Hurtigt dyr i 6 timer før anæstesi.
  2. Præparater og procedure for de animalske anæstesi
    1. Dy kanin med bur (Se Tabel af materialer), og derefter indsprøjtes 3% pentobarbital natrium i marginale øre vene i en dosis på 1 mL/kg for generel anæstesi.
    2. Placer kanin i en behagelig dorsal-liggende stilling.
    3. Overvåge respirationsfrekvens, puls og kropstemperatur kanin under anæstesi.
    4. Bruge oftalmologisk salve på dens øjne til at forhindre tørhed under anæstesi.
    5. Vurdere dybde af anæstesi efter Guedels klassificering14.
  3. Forberedelse til MSCs isolering og dyrkning
    1. For at dyrke rbSF-MSC'er, forberede 500 mL kommerciel næringssubstratet (Se Tabel af materialer) suppleret med 10% kommercielle supplement (Se Tabel af materialer), 10% føtal bovint serum (FBS), og 1% Penicillin-Streptomycin.
    2. Inkuber dyrkningsmediet ved 37 ° C i et vandbad.
    3. Forberede 500 mL af fosfat buffer saltvand (PBS) til celle isolation og celle vask.
    4. Forberede knæ hulrum arthrocentesis procedure 100 mL isotonisk saltopløsning.
  4. Samling af artikulær synovial fl uid fra knæet kanin
    1. Vælg et område omkring 5 x 5 cm i størrelse omkring knæet og barbere kanin hår fra området ved hjælp af en sikkerhed elektrisk shaver.
    2. Skiftevis, desinficere webstedet procedure 3 x med povidon jod løsning og 75% ethanol. Derefter, anvende sterilt gardiner efter området har grundigt tørret.
    3. Injicér 1-2 mL isotonisk saltopløsning, ved hjælp af en sterile injektionssprøjte (2 mL), i knæ fælles hulrum fra den artikulære sideplads, flytte knæet 3-4 x, og derefter suge ud alle synovialvæsken ved stuetemperatur.
    4. Filtrere den synovial detektionsvæske gennem en 40 µm nylon celle si at fjerne eventuelle rester i 4 h.
  5. Kultur af rbSF-MSCs
    1. Indsamle de filtrerede detektionsvæske i 50 mL centrifugeglas, og der centrifugeres ved 1.500 rpm i 10 min ved stuetemperatur.
    2. Supernatanten efter centrifugeringen, vaske pellet med PBS, resuspenderes med komplet næringssubstratet og derefter plade medium i 100 mm retter.
    3. Der inkuberes ved 37 ° C i en fugtig atmosfære indeholdende 5% CO2retter.
    4. Efter 48 h, genopbygge retter med frisk medium til at fjerne enhver ikke-tilhænger celler. Udskift mediet to gange om ugen i 2 uger som passage 0 (P0).
      Bemærk: Der bør være omkring 1 x 104 vedhængende celler. Levedygtige celler/ml i SF er omkring 2 x 102/mL.
    5. Efter 14 dage efter den oprindelige plating, bør have dannet mange kolonier i kultur retter. Vælg de kolonier, der er større end 2 mm i diameter. Mark, hvor de valgte kolonier er placeret ved at spore deres omkreds på parabol bunden.
    6. Kassér kolonier < 2 mm bred, ved hjælp af celle skrabere. Fordøje de valgte kolonier med ca. 5 µL af 0,25% trypsin, ved hjælp af en kloning cylinder, og overføre kolonierne til en ny parabol som passage 1 (P1).
  6. Postoperativ dyrs pleje
    1. Følg standard institutionelle driftsprocedurer for postoperativ overvågning og nyttiggørelse fra anæstesi.
    2. Overvåge de vitale tegn af kanin hver 10 min, indtil den har genvundet bevidstheden. Endelig, overføre det bevidste dyr til buret. Returnere ikke en kanin, der har gennemgået kirurgi til selskab med andre dyr, indtil det er fuldt tilbagebetalt.
    3. Efter operationen, desinficere site med 0,1% povidon jod, 2 x om dagen i 3 dage.

2. CD90-positiv magnetisk aktiveret celle sortering (MLA) af rbSF-MSCs og primære kultur

  1. Forberedelse af prøver
    1. Når cellerne kommer til omkring 80% confluency, Aspirér medium, og Tilføj derefter 1-2 mL 0,25% Trypsin-EDTA til hvert fad.
    2. Inkuber retter i 2-3 min. at tillader celle detachement.
    3. Når cellerne er frakoblet, tilføje en lige stor del af dyrkningsmediet til at inaktivere trypsin.
    4. Passere en 40 µm celle si cellesuspension, Saml filtratet i en 15 mL tube, og derefter dreje ned celler ved 600 × g i 10 min. ved stuetemperatur.
    5. Resuspenderes celle i MACS kører buffer (PBS, pH 7,2, 0,5% bovint serumalbumin og 2 mM EDTA) og derefter tælle celle nummer.
  2. Magnetiske mærkning
    Bemærk: Sortere rbSF-MSCs med en magnetisk aktiveret celle sortering kit, der indeholder kolonner, en stander og separatorer (Se Tabel af materialer).
    1. Bestemme den celle nummer ved hjælp af en hemocytometer.
    2. Centrifugeres cellesuspension ved 300 × g i 10 min. ved 4 ° C. Helt Aspirér supernatanten.
    3. Tilsættes 80 µL af resuspension buffer pr. 107 samlede celler.
    4. 107 samlede celler, tilføje 20 µL af microbeads konjugeret med et monoklonalt anti-kanin CD90 antistof.
    5. Bland den magnetiske perler og celler jævnt i rør, derefter inkuberes dem ved 4 ° C i 15 min. i mørke.
    6. Der tilsættes 1 mL af buffer pr. 107 celler til røret, og derefter centrifugeres det ved 300 × g i 10 min. ved 4 ° C til at vaske cellerne. Supernatanten efter centrifugeringen.
    7. Resuspenderes i 500 µL af buffer pr. 107 celler.
  3. Magnetisk separation
    1. Sted kolonnen med kolonnen vinger foran ind i magnetfelt af en magnetisk separator.
    2. Skylles kolonnen magnetisk separator (MS) med 500 µL af bufferen pr. 107 celler.
    3. Overføre enkelt cellesuspension til kolonnen. Lad de negative celler passere gennem magnetfelt til at skille sig af med disse umærkede celler.
    4. Kolonnen udvaskes 1-2 x med 500 µL af bufferen pr. 107 celler og kassér gennemstrømnings.
    5. Overfør kolonnen til et centrifugeglas (15 mL).
    6. Der tilsættes 1 mL af buffer pr. 107 celler i kolonnen, og derefter straks skubbe stemplet i kolonnen for at skylle de magnetisk mærket celler.
    7. Gentag den ovennævnte fremgangsmåde med en anden MS Column at øge renheden af CD90+ celler, som kan berige den eluted fraktion.
    8. Centrifugeres cellesuspension ved 300 × g i 10 min. og Opsug supernatanten resuspend det med substratet.
  4. Kultur af CD90+ rbSF-MSCs
    1. Podes celler i 100 mm retter efter magnetisk aktiveret celle sortering.
    2. Der inkuberes ved 37 ° C i en fugtig celle kuvøse med 5% CO2retter.
    3. Når 80-90% sammenløbet af den primære kultur opnås på omkring 7-10 dage, fordøje de vedhængende celler med 0,25% Trypsin-EDTA og passage dem på en 1:2 fortynding at gøre passage 2 (P2).
    4. Brug den samme metode til at passere celler til passage 3 (P3), som kan anvendes til in vitro- assays.
      Bemærk: Efter den sub-kultur og rensning, omkring 1 x 107 rbSF-MSCs er opnået.

3. identifikation af rbSF-MSCs

  1. Overflade markør bekræftelse af rbSF-MSCs ved flowcytometri
    1. Når MSCs er 80-90% sammenflydende på P3, cellerne vaskes med PBS og behandler dem med 1 mL 0,25% Trypsin-EDTA. Derefter, Ruger MSCs ved 37 ° C i 2-3 min, indtil cellerne er frakoblet.
    2. Høste de celler ved hjælp af 10 mL PBS, overføre dem til en konisk slange (15 mL) og centrifugeres dem ved 300 × g i 5 min ved stuetemperatur.
    3. Kassér analysere. Resuspenderes celle i 500 µL af PBS og overføre det til en 1,5 mL tube.
    4. Inkubér 1: 100 fortynding af FITC-konjugeret og PE-konjugerede antistoffer (isotype, FITC-CD34/PE-CD45, FITC-CD105/PE-CD44) for 1 h i mørke ved 4 ° C.
    5. Centrifugeres blandingen på 300 × g i 5 min ved stuetemperatur og cellerne vaskes to gange med PBS ved centrifugering ved 300 × g i 5 min hver gang. Kassér analysere.
    6. Resuspend celler i 500 µL af PBS, overføre cellesuspension ind i en runde-nederste rør (5 mL) og analysere det ved hjælp af en flow Flowcytometret.
      Bemærk: Erhverve data på en Flowcytometret udstyret med to kanaler, fluorescens: 533/30 og 585/40. For hver isotype fluorescens, bruge kontrolelementet isotype til at justere den passende laser spænding og indstille minimumslysstyrke at opnå et fluorescens histogram, der viser både venstre og højre kanter på toppen. Indsamle mindst 10.000 begivenheder for de statistiske analyser.
  2. Multidifferentiation af rbSF-MSCs
    Bemærk: Brug P3 rbSF-MSC'er til in vitro- multidifferentiation assays.
    1. Osteogenic differentiering
      1. Forberede osteogenic induktion medium: DMEM basic (1 x) indeholdende 50 mM af L-ascorbinsyre syre-2-fosfat, 10 mM af α-glycerophosphate og 100 nM af dexamethason.
      2. Seed celler på 103 celler/cm2 i en 6-godt vævskultur plade og kultur dem i osteogenic induktion medium.
      3. Ændre induktion medium hver 3 dage til 3 uger.
      4. Fix cellerne med 4% formaldehyd i 30 min. ved stuetemperatur efter differentieringen er afsluttet, pletten cellerne med 1% Alizarin rød for 5 min, og derefter vaske dem 3 x med PBS15.
    2. Adipogenic differentiering
      1. Forberede adipogenic induktion medium: DMEM basic (1 x) består af 100 mM af indomethacin, 10 mg/mL af rekombinant humant insulin, 1 mM af dexamethason og 0,5 mM af 3-isobutylmethacrylat-1-Methylxanthin.
      2. Behandle P3 rbSF-MSCs i 3 uger i adipogenic induktion medium.
      3. Efter 3 uger, bejdse de neutrale lipid vacuoles bruger olie røde O for at bekræfte adipogenic differentiering. Fix celler i en 4% formaldehyd løsning i 30 min. ved stuetemperatur, og derefter vaske dem 3 x med PBS16.
    3. Chondrogenic differentiering
      1. Forberede chondrogenic induktion medium: DMEM basic (1 x) bestående af 10 ng/mL TGFβ1, 1% sit supplement, 0,35 mM af L-prolin, 100 nM af dexamethason, 50 mM af L-ascorbinsyre syre-2-fosfat, og 1 mM af natrium pyruvat.
      2. Bruge pellet dyrkning for chondrogenic induktion. Der centrifugeres 5 × 105 P3 rbSF-MSCs ved 1500 rpm i 10 min i en polypropylen tube (15 mL) til at danne en pellet.
      3. Kultur pellets i 3 uger med chondrogenic induktion medium.
      4. Ændre medium hver 3 dage til 3 uger.
      5. Efter 3 uger induktion, integrere celle pellet med paraffin, del den i 4 mm skiver og bejdse dem ved hjælp af 0,1% toluidin blå for 30 min. ved stuetemperatur17.
  3. Total RNA udvinding og analyse af kvantitative real-time polymerase kæde reaktion (qRT-PCR)
    1. Isolere den samlede RNA celler efter 3 uger differentiering induktion ved hjælp af kommercielle RNA udvinding kit (Se Tabel af materialer).
      1. Fjerne næringssubstratet i kultur parabol og derefter tilsættes 1 mL af isolation reagens.
      2. Lyse celler af gentagne pipettering indtil løsningen er homogen. Der inkuberes ved stuetemperatur i 3 min.
      3. Overføre cellen lysate ind i en 1,5 mL microcentrifuge rør.
      4. Tilsæt 100 µL chloroform, ryste det af hånd 15 x, og Inkuber blanding ved stuetemperatur i 3 min.
      5. Centrifugeres tube på 12.000 × g i 15 min. ved 4 ° C. Overføre supernatanter ind i en ny 1,5 mL microcentrifuge rør.
      6. Tilsættes 500 µL af isopropanol og bundfald RNA i 10 min ved stuetemperatur.
      7. Der centrifugeres ved 12.000 × g i 10 minat 4 ° C. RNA pellet skal være synlig i bunden af røret.
      8. Fjern supernatanten og derefter tilsættes 500 µL af 75% ethanol. Kort spin rør i flere sekunder at vaske RNA pellet. Det der centrifugeres ved 7.500 × g i 5 min. ved 4 ° C.
      9. Fjern de resterende ethanol.
      10. Opløse RNA toerstoffet i 10 µL af DEPC vand og Placer rør på is.
    2. Omvendt transskribere total RNA i cDNA med en DNA syntese kit (Se Tabel af materialer).
      Bemærk: Udføre alle de følgende procedurer på is.
      1. Forberede reverse transkription master mix.
      2. Tilføje 25 µL af DNase-behandlede RNA til hvert rør med 1 µg af RNA.
      3. Inkuber blanding på de følgende temperaturer ved hjælp af en PCR termisk cycler: 26 ° C i 10 min (til at tillade den tilfældige hexamers til at anneal), 42 ° C i 45 min (reverse transkription) og 75 ° C i 10 min (til at inaktivere reverse transkriptase).
      4. Straks analysere de resulterende cDNA ved kvantitative real-time PCR, eller Opbevar den ved-20 ° C.
    3. Udføre gen expression analyse med en kvantitativ real-time PCR system.
      1. Bruge qRT-PCR Master Mix (Se Tabel af materialer) til at udføre PCR. PCR-primere for GAPDH, Runx2, Agg og PPARγ er angivet i tabel 1.
      2. Beregne genekspression ved hjælp af metoden 2ΔΔCT .
      3. Foretage en statistisk analyse ved hjælp af statistiske standardsoftwaren. Brug en uafhængig prøve t-testen til at sammenligne gruppen betyder.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Isolering, rensning og kultur i rbSF-MSCs:
Denne protokol bruger Mac-computere til at isolere rbSF-MSC'er, baseret på udtryk for MSC overflade markør CD90. En proces flow diagram over rbSF-MSCs' isolering, rensning, og karakterisering og in vitro- kultur protokollen er vist i figur 1.

Celle morfologi efter magnetisk aktiveret celle sortering (MLA) med CD90:
For det første, til Mac, immunolabel MSCs med CD90 magnetiske perler. Efter centrifugering, resuspend højst 107 celler i 80 µL af en forkølede sortering buffer og derefter tilføje 20 µL af CD90 magnetiske perler, efterfulgt af vortexing og inkubation ved 4 ° C i 15 min. Efter at cellerne vaskes med 1 mL af den sortering buffer og resuspend dem i 500 µL af den sortering buffer. Før du fortsætter med magnetisk sortering, Gentag trinnet vask. Denne kritiske proceduren er vist i figur 2.

Før sorteringen vises de vedhængende kanin synovial væske cellepopulationer heterogene morfologi, som indeholder forskellige celletyper og størrelser (figur 3A-C). Efter MACS udstillet cellepopulationer homogen morfologi. Cell antal forøgedes med sub-kultur (figur 3D-F).

Overflade karakteristika af MLA-beriget rbSF-MSCs:
Fluorescens-aktiveret celle sortering (FACS) blev udført for at analysere berigelsen af rbSF-MSCs af MACS med CD90. Før MACS bestod celle befolkning af ca 40% MSCs (figur 4 cD, isotype kontrolelementer i figur 4A,B). Efter MACS indeholdt beriget befolkningen ca > 99% MSCs (figur 4E,F). Hæmatopoietisk afstamning celle markører CD34 og CD45 var, på 0.318%, begge sjældent til udtryk efter MACS, hvilket er en tilbagegang fra deres oprindelige udtryk på 25,9%. Før den markering, der var omkring 28% CD90+ celler (figur 4 g); efter rensning, ca 98% CD90+ celler blev indhentet (figur 4 H).

Multilineage differentiering potentielle af rbSF-MSCs:
For at karakterisere rbSF-MSCs evne til at differentiere i de forskellige slægter som osteogenic, adipogenic og chondrogenic celler, rbSF-MSCs beriget af MAC'ER var samtidig kulturperler i en specifik differentiering medium og i en differentiering medium uden cytokin til at tjene som kontrol. Da induktion blev afsluttet, slægt-specifikke markører blev analyseret ved farvning og RT-PCR. Alizarin rød farvning af calcium forbindelser demonstreret at mineraliseret knuder havde dannet i rbSF-MSCs efter 3 uger på osteogenic induktion betingelserne (figur 5A). Efter 3 ugers adipogenic induktion, kunne være opdaget en ophobning af lipid-rige vacuoles intracellulære olie røde O farvning (figur 5B). For 21 dage efter chondrogenic induktion, var celle pellet histologisk analyseres med toluidin blå farvning. Celler positive for farvning (til proteoglycan) blev betragtet som Chondrocyt-lignende celler (figur 5 c). Svarende til dette resultat, en kvantitativ analyse af genekspression af differentiering potentielle også bevist mulighed for differentiering af disse celler. Udtrykket niveauer af Agg (en Chondrocyt markør), PPARγ (en adipogenic markør) og Runx2 (en osteoblastdannelse markør) var upregulated induceret betingelser. Disse data viste den Multipotente differentiering evne til rbSF-MSCs i trilineages (fig. 5 d).

Figure 1
Figur 1: fuld skematisk af isolering, oprensning og karakterisering af SF-MSCs af New Zealand hvide kaniner. Venligst klik her for at se en større version af dette tal.

Figure 2
Figur 2: protokol for magnetisk aktiveret celle sortering (MLA) med CD90. Venligst klik her for at se en større version af dette tal.

Figure 3
Figur 3: morfologi af éncellelag kulturperler rbSF-MSCs før og efter MACS som undersøges under almindelige inverteret mikroskopi. A-C) Før sorteringen vise vedhængende kanin synovial væske cellepopulationer heterogenitet. De indeholder forskellige celletyper og størrelser, såsom oval, lang-spindel, kort-spindel og Stjernehus morfologi. De vigtigste morfologi af P2 og P6 er en spindel morfologi (A: P2, B: P3, C: P6). D-F) Efter MACS med CD90 udviser cellepopulationer en homogen morfologi. Med en sub-kultur, øger celle nummer (D: P2, E: P3, F: P6). Skalalinjen = 100 µm. venligst klik her for at se en større version af dette tal.

Figure 4
Figur 4: identifikation af rbSF-MSC celleoverflademarkører. Brug flow flowcytometri analyse, er rbSF-MSCs positive for MSC markører CD44 og CD105, mens negative for i endothelial celle markør CD34 og hæmatopoietisk celle markør CD45. Før MACS har disse celler en lav grad af positivitet for CD44 og CD105. Men efter MACS, satsen for positivitet var høj. A, B) Disse top to billeder viser isotype kontroldata. C, D) Disse resultater viser, at befolkningens rbSF-MSC før MACS er sammensat af ca 40% MSC celler. E, F) Efter MACS indeholder beriget befolkningen > 99% MSC celler. G, H) Disse billeder viser flow flowcytometri analyse af CD90+ markør, (G) før og (H) efter MACS sortering. Venligst klik her for at se en større version af dette tal.

Figure 5
Figur 5: analyse af afstamning-specifikke markører ved farvning og RT-PCR. A) Alizarin rød farvning viser at mineraliseret knuder danne under osteogenic induktion i 3 uger. B) efter 3 ugers adipogenic induktion, ophobning af lipid-rige vacuoles er opdaget af intracellulære olie røde O farvning. C) For 3 ugers chondrogenic induktion, celle pellet var histologisk analyseres med toluidin blå farvning. Celler positive for farvning (til proteoglycan) blev betragtet som Chondrocyt-lignende celler. Skalalinjen = 100 µm. D) efter dyrkning i 3 uger, den relative mRNA udtryk af osteoblastdannelse markører (Runx2), adipogenic markører (PPARγ) og chondrogenic markører (Agg) er opdaget. For alle analyser, p værdier < 0,01 blev anset for statistisk signifikante forskelle ved hjælp af Kruskal-Wallis test (vist som **). Venligst klik her for at se en større version af dette tal.

Gener Videresende primer (5'-3') Vende primer (5'-3')
Runx2 TATGAAAAACCAAGTAGCAAGGTTC GTAATCTGACTCTGTCCTTGTGGAT
AGG GCTACACCCTAAAGCCACTGCT CGTAGTGCTCCTCATGGTCATC
PPARΓ2 GCAAACCCCTATTCCATGCTG CACGGAGCTGATCCCAAAGT
GAPDH GGAGAAAGCTGCTAA ACGACCTGGTCCTCGGTGTA

Tabel 1: Liste over gener og anvendes i denne undersøgelse for kvantitative real-time PCR-primere.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Eksistensen af MSCs i synovial væske giver et alternativ til celle-baseret terapi. Tidligere undersøgelser har vist, at skade websteder indeholder større mængder af mesenkymale stamceller i deres synovialvæsken, som kan være positivt korreleret med efter skade perioden5. MSC'er i synovial væske kan være gavnligt for væv til styrkelse af den spontane healing efter en skade18,19. Den kliniske anvendelse af SF-MSCs er sjældent blevet dækket i litteraturen, hovedsagelig fordi mekanismerne af SF-MSCs i leddene forblive udefineret20. Jones mfl. 21 rapporterede, at hSF-MSC numre i knæleddene betydeligt øge 7-fold i de tidlige stadier af slidgigt (OA). De troede, at de øgede SF-MSCs kunne bidrage til at fastholde de fysiologiske homeostase af leddene.

En ideel dyremodel er et uundværligt redskab i udviklingen af therapeutics udnytte regenerativ og translationel medicin. Selv om åbenlyse forskelle mellem mennesker og kaniner, kanin er flittigt brugt som en dyremodel for studiet af væv revitalisering7, således at spørge os til at vælge det som model for vores undersøgelse af SF-MSCs. En af de mere skræmmende hindringer i denne bestræbelse er at isolationen af SF-MSCs ofte resulterer i varieret succesrate og lav koloni frekvenser, som rapporteret i tidligere forskning5. Derfor, mange forskere har fokuseret på succesrate og optimering af isolation af MSC fra SF.

Denne studyeffectively anvendes en MACS procedure for høj sortering renhed og levedygtighed af CD90+ MACSs fra kanin synovial væske22. Denne MACS system udnytter magnetiske microbeads konjugeret med meget specifikke antistoffer koblet til en bestemt celle overflade antigen, CD90 i dette tilfælde, og giver mulighed for valg af særligt mål celletype, nemlig CD90 udtrykker celler. Før rensning med CD90 microbeads kultur vi normalt de primære rbSF-MSCs i 14 dage. I denne periode dannes mange kolonier i kultur retter. Denne protokol tyder på, at vælge de kolonier, der er større end 2 mm i diameter. Når du bruger kloning cylinderen for kolonien udvælgelse, observerer vi nøje det under mikroskop. Den eneste koloni er yderligere opformeret til rensning.

Under processen med adskillelse og rensning, er CD90 udtrykker celler, der var magnetisk mærket tiltrukket af det magnetiske felt af separator i kolonnen, boer de umærkede celler flow gennem. Efter vaskeprocessen, kolonnen er fjernet fra det magnetiske felt for separatoren, og target-cellerne er elueret fra kolonnen. Denne specifikke MACS microbead tilgang tillader dyrkning af rbSF-MSC'er, der specifikt udtryk de stamcelle celleoverflademarkører CD44 og CD105, viser, at disse isolerede celler mesenkymale stamceller snarere end hæmatopoietisk celler23. Disse renset rbSF-MSCs kan være kultiveret in vitro- over en lang tid uden nogen væsentlig ændring af morfologiske træk og markør udtryk. Desuden udviser rbSF-MSCs beriget af MACS en Multipotente differentiering evne til multi slægt celler, herunder chondrogenic, adipogenic og osteogenic celler.

Driften af MACS er en protokol, der er let at udføre og kan gøres på bænken23. Derudover US Food and Drug Administration (FDA) har godkendt MACS microbead-baseret teknologi, og derfor er det let at udføre for kliniske applikationer24. CD90 er en overflade markør af mesenkymale stamceller, og forskere har vist, at CD90 positive MSCs har en bedre chondrogenic differentiering evne25,26. Pluripotency af MSCs har været karakteriseret baseret på morfologi og udtryk for specifikke markører for stamceller27.

Denne undersøgelse har flere begrænsninger. Den første mangel ved denne protokol er relateret til de overflade markører vi undersøgt. Baseret på en opgørelse af International Society for cellulære terapi (ISCT), de minimale kriterier for at definere Multipotente MSCs er positive for CD90, CD105, CD44 og CD73, og negativ for CD11b, CD14, CD34 eller CD45, og CD79a eller HLA-DR28. Med mål at afbøde indsats og expense skal teste hele panelet, udvalgt forskere i denne undersøgelse nøje to af de negative markører og to af de positive markører anbefales. For det andet, det tager lang tid at danne kolonier, der vil blive udvalgt til yderligere undersøgelse. Hypertrofi er derudover et stort problem under chondrogenic induktion af SF-MSCs i vitro. I den senere fase, hypertrofisk chondrocytter altid udtrykkelige type X kollagen (COLX), matrix metalloproteinase 13 (MMP13) faktor alkalisk fosfatase (ALP) og runt-relaterede transskription 2 (Runx2)29. Forskning tyder på, at den tre-dimensionelle (3D) pellet kultur, dynamisk kultur systemer og coculture med chondrocytter, gevinst for MSC stabilt chondrogenic differentiering30,31. I denne undersøgelse, blev en pellet kultur system brugt til chondrogenic induktion af MSC for at undgå hypertrofi.

Afslutningsvis har vi etableret en simpel metode til isolering og oprensning af MSCs fra artikulær hulrummet rødmen væske og karakteriseret MSCs opnået deri. Denne protokol har givet en platform til efterforskning og undersøgelse af artikulær synovial væske-afledte MSCs' potentielle nytte i romanen fælles regenerering strategier.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne erklærer, at de har ingen konkurrerende finansielle interesser.

Acknowledgments

Denne undersøgelse blev støttet økonomisk af de følgende tilskud: Natural Science Foundation of China (nr. 81572198; No. 81772394); Fonden for højt niveau medicinsk disciplin opførelsen af Shenzhen Universitet (nr. 2016031638); Medical Research Foundation i Guangdong-provinsen, Kina (nr. A2016314); og Shenzhen videnskab og teknologiprojekter (nr. JCYJ20170306092215436; Lol JCYJ20170412150609690; Lol JCYJ20170413161800287; Lol SGLH20161209105517753; Lol JCYJ20160301111338144).

Materials

Name Company Catalog Number Comments
Reagents
MesenGro StemRD MGro-500 1703 Warm in 37 °C water bath before use
MesenGro Supplement StemRD MGro-500 M1512 Component of MSCs culture medium
DMEM basic Gibco Inc. C11995500BT MSCs differentiation medium
Isotonic saline solution Litai, China 5217080305 Cavity arthrocentesis procedure reagent
Phosphate-Buffered Saline (PBS) HyClone Inc. SH30256.01B PBS, free of Ca2+/Mg2+
Fetal Bovine Serum (FBS) Gibco Inc. 10099-141 Component of MSCs culture medium
Povidone iodine solution Guangdong, China 150605 Sterilization agent
75% ethanol Lircon, china 170917 Sterilization agent
0.25% Trypsin/EDTA Gibco Inc. 25200-056 Cell dissociation reagent
1% Penicillin-Streptomycin Gibco Inc. 15140-122 Component of MSCs medium
MACS Running Buffer MiltenyiBiotec 5160112089 Containing phosphate-buffered saline (PBS), 0.5% bovine serum albumin(BSA), and 2 mMEDTA
CD90 antibody conjugated MicroBeads MiltenyiBiotec 5160801456 For magnetic activated cell sorting
Sodium pyruvate Sigma-Aldrich P2256 Component of MSCs chondrogenic differentiation
Dexamethasone Sigma-Aldrich D1756 Component of MSCs osteogenic differentiation
ITS BD 354352 1%, Component of MSCs chondrogenic differentiation
L-proline Sigma-Aldrich P5607 0.35 mM, Component of MSCs chondrogenic differentiation
L-ascorbic acid-2-phosphate Sigma-Aldrich A8960 50 mM, Component of MSCs chondrogenic differentiation
3-isobutyl-1-methylxanthine Sigma-Aldrich I5879 0.5 mM, Component of adipogenic differentiation
Indomethacin Sigma-Aldrich I7378 100 mM, Component of adipogenic differentiation
TGFβ1 Peprotech 100-21 10 ng/mL, Component of MSCs chondrogenic differentiation
α-glycerophsphate Sigma-Aldrich G6751 Component of MSCs osteogenic differentiation
CD34 Polyclonal Antibody, FITC Conjugated Bioss bs-0646R-FITC Hematopoietic stem cells marker
Mouse antirabbit CD44 Bio-Rad MCA806GA Thy-1 membrane glycoprotein (MSCs marker)
CD45 (Monoclonal Antibody) Bio-Rad MCA808GA Hematopoietic stem cells marker
CD105 antibody Genetex GTX11415 MSCs marker
Isopropyl alcohol Sigma-Aldrich I9030 Precipitates RNA extraction organic phases
Trichloromethane Wenge, China 61553 Extract total RNA
Trizol Invitrogen 15596-018 Isolate total RNA
SYBR green master mix Takara Bio, Japan RR420A PCR test
cDNA synthesis kit Takara Bio, Japan RR047A Reverse-transcribed to complementary DNA
Alizarin Red Sigma-Aldrich A5533 Staining of calcium compounds
Toluidine Blue Sigma-Aldrich 89640 Staining of cartilaginous tissue
Oil Red O solution Sigma-Aldrich O1391L Lipid vacuole staining
Equipment
MiniMACS Separator MiltenyiBiotec 130-042-102 For magnetic activated cell sorting
MultiStand MiltenyiBiotec 130-042-303 For magnetic activated cell sorting
MS Columns MiltenyiBiotec 130-042-201 For magnetic activated cell sorting
Cell Strainer FALCON Inc. 352340 40 μm nylon
Hemocytometer ISOLAB Inc. 075.03.001 Cell counting
Falcon 100 mm dish Corning 353003 Cell culture dish
Microcentrifuge tube Axygen MCT-150-C RNA Extraction and PCR
Centrifuge Tubes Sigma-Aldrich 91050 Gamma-sterilized
High-speed centrifuge Eppendorf 5804R Centrifuge cells
Carbon dioxide cell incubator Thermo scientific 3111 Cell culture
Real-Time PCR Instrument Life Tech QuantStudio Real-Time quantitative polymerase chain reaction
Flow cytometer BD Biosciences 342975 Cell analyzer
Pipettor Eppendorf O25456F Transfer the liquid
Cloning cylinder Sigma-Aldrich C3983-50EA Isolate and pick individual cell colonies
Sterile hypodermic syringe Double-Dove, China 131010 Arthrocentesis procedure
Rabbit cage Zhike, China ZC-TGD Restrain the rabbit

DOWNLOAD MATERIALS LIST

References

  1. Oreffo, R. O., Cooper, C., Mason, C., Clements, M. Mesenchymal stem cells: lineage, plasticity, and skeletal therapeutic potential. Stem Cell Reviews. 1, (2), 169-178 (2005).
  2. Asakura, A., Rudnicki, M. A., Komaki, M. Muscle satellite cells are multipotential stem cells that exhibit myogenic, osteogenic, and adipogenic differentiation. Differentiation. 68, (4-5), 245-253 (2001).
  3. De, B. C., Dell'Accio, F., Tylzanowski, P., Luyten, F. P. Multipotent mesenchymal stem cells from adult human synovial membrane. Arthritis Rheumatology. 44, (8), 1928-1942 (2001).
  4. Zuk, P. A., et al. Human adipose tissue is a source of multipotent stem cells. Molecular Biology of the Cell. 13, (12), 4279-4295 (2002).
  5. McGonagle, D., Jones, E., English, A., Emery, P. Enumeration and phenotypic characterization of synovial fluid multipotential mesenchymal progenitor cells in inflammatory and degenerative arthritis. Arthritis & Rheumatism. 50, (3), 817-827 (2004).
  6. Jia, Z., et al. Isolation and characterisation of human mesenchymal stem cells derived from synovial fluid by magnetic activated cell sorting (MACS). Cell Biology International. (2017).
  7. Bashir, M., et al. Isolation, culture and characterization of New Zealand white rabbit mesenchymal stem cells derived from bone marrow. Asian Journal of Animal & Veterinary Advances. 10, (8), 13-30 (2015).
  8. Song, X., et al. Differentiation potential of rabbit CD90-positive cells sorted from adipose-derived stem cells in vitro. In Vitro Cellular & Developmental Biology - Animal. 53, (1), 1-6 (2016).
  9. Lee, T. C., et al. Comparison of surface markers between human and rabbit mesenchymal stem cells. PLOS One. 9, (11), e111390 (2014).
  10. Stewart, M. C., Chen, Y., Bianchessi, M., Pondenis, H. Phenotypic characterization of equine synovial fluid-derived chondroprogenitor cells. Stem Cell Biology and Research. 3, (1), (2016).
  11. Prado, A. A. F., et al. Characterization of mesenchymal stem cells derived from the equine synovial fluid and membrane. BioMed Central Veterinary Research. 11, (1), 281 (2015).
  12. Yoshimura, H., et al. Comparison of rat mesenchymal stem cells derived from bone marrow, synovium, periosteum, adipose tissue, and muscle. Cell and Tissue Research. 327, (3), 449-462 (2007).
  13. Wu, C. C., et al. Intra-articular injection of platelet-rich fibrin releasates in combination with bone marrow-derived mesenchymal stem cells in the treatment of articular cartilage defects: an in vivo study in rabbits. Journal of Biomedical Materials Research Part B: Applied Biomaterials. 105, (6), 1536-1543 (2017).
  14. John, T., Lerche, P. Anesthesia and Analgesia for Veterinary Technicians. Mosby Elsevier. St. Louis, Missouri. (2011).
  15. Koyama, N., et al. Pluripotency of mesenchymal cells derived from synovial fluid in patients with temporomandibular joint disorder. Life Sciences. 89, (19-20), 741-747 (2011).
  16. Kim, Y. S., et al. Isolation and characterization of human mesenchymal stem cells derived from synovial fluid in patients with osteochondral lesion of the talus. American Journal of Sports Medicine. 43, (2), 399-406 (2015).
  17. Vereb, Z., et al. Immunological properties of synovial fluid-derived mesenchymal stem cell-like cells in rheumatoid arthritis. Annals of the Rheumatic Diseases. 74, (Suppl 1), A64-A65 (2015).
  18. Matsukura, Y., Muneta, T., Tsuji, K., Koga, H., Sekija, I. Mesenchymal stem cells in synovial fluid increase after meniscus injury. Clinical Orthopaedics & Related Research. 472, (5), 1357-1364 (2014).
  19. Morito, T., et al. Synovial fluid-derived mesenchymal stem cells increase after intra-articular ligament injury in humans. Rheumatology. 47, (8), 1137-1143 (2008).
  20. Hegewald, A. A., et al. Hyaluronic acid and autologous synovial fluid induce chondrogenic differentiation of equine mesenchymal stem cells: a preliminary study. Tissue & Cell. 36, (6), 431-438 (2004).
  21. Jones, E. A., et al. Synovial fluid mesenchymal stem cells in health and early osteoarthritis: detection and functional evaluation at the single cell level. Arthritis & Rheumatism. 58, (6), 1731-1740 (2008).
  22. Makker, K., Agarwal, A., Sharma, R. K. Magnetic activated cell sorting (MACS): utility in assisted reproduction. Indian Journal of Experimental Biology. 46, (7), 491-497 (2008).
  23. Schmitz, B., et al. Magnetic activated cell sorting (MACS) — a new immunomagnetic method for megakaryocytic cell isolation: comparison of different separation techniques. European Journal of Haematology. 52, (5), 267-275 (1994).
  24. Reinhardt, M., Bader, A., Giri, S. Devices for stem cell isolation and delivery: current need for drug discovery and cell therapy. Expert Review of Medical Devices. 12, (3), 353-364 (2015).
  25. Gronthos, S., Zannettino, A. C. W. A method to isolate and purify human bone marrow stromal stem cells. Mesenchymal Stem Cells. Prockop, D. J., Bunnell, B. A., Phinney, D. G. Vol. 449 of Methods in Molecular Biology 45-57 (2008).
  26. Krawetz, R. J., et al. Synovial fluid progenitors expressing CD90+ from normal but not osteoarthritic joints undergo chondrogenic differentiation without micro-mass culture. PLOS One. 7, (8), e43616 (2012).
  27. Ogata, Y., et al. Purified human synovium mesenchymal stem cells as a good resource for cartilage regeneration. PLOS One. 10, (6), e0129096 (2015).
  28. Dominici, M., et al. Minimal criteria for defining multipotent mesenchymal stromal cells: the International Society for Cellular Therapy position statement. Cytotherapy. 8, (4), 315-317 (2006).
  29. Gauci, S. J., et al. Modulating chondrocyte hypertrophy in growth plate and osteoarthritic cartilage. Journal of Musculoskeletal & Neuronal Interact. 8, (4), 308 (2008).
  30. Cooke, M. E., et al. Structured three-dimensional co-culture of mesenchymal stem cells with chondrocytes promotes chondrogenic differentiation without hypertrophy. Osteoarthritis and Cartilage. 19, (10), 1210-1218 (2011).
  31. Fischer, J., Dickhut, A., Rickert, M., Richter, W. Human articular chondrocytes secrete parathyroid hormone-related protein and inhibit hypertrophy of mesenchymal stem cells in coculture during chondrogenesis. Arthritis and Rheumatism. 62, (9), 2696-2706 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics