Оценка жизнеспособности синтетических бактерий консорциума на интерфейсе в Vitro хост микробов кишечника

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Гут хост микробных взаимодействий были оценены с использованием новаторский подход, сочетая синтетических устные сообщества, в пробирке желудочно-кишечного пищеварения и модель эпителия тонкой кишки. Мы представляем метод, который может быть адаптирован для оценки клеток вторжение патогенов и многовидового биопленки, или даже для тестирования, живучести составов пробиотик.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Calatayud Arroyo, M., Van de Wiele, T., Hernandez-Sanabria, E. Assessing the Viability of a Synthetic Bacterial Consortium on the In Vitro Gut Host-microbe Interface. J. Vis. Exp. (137), e57699, doi:10.3791/57699 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Взаимодействие между принимающей и микробиоты давно признали и подробно описано. Рот похож на других разделах желудочно-кишечного тракта, как резидентов микробиоты происходит и предотвращает колонизация внешних бактериями. Действительно более чем 600 видов бактерий находятся в полости рта, и один человек может нести около 100 различных в любое время. Устные бактерии обладают способностью придерживаться различных ниш в устной экосистеме, таким образом став интегрированы в резидентов микробных сообществ и пользу роста и выживания. Однако поток бактерий в кишечнике во время глотания предложил нарушить равновесие кишка микробиоты. В самом деле пероральный P. амёба смещается бактериальный состав в подвздошной микрофлоры. Мы использовали синтетический сообщества как упрощенное представление природной Устные экосистемы, для выяснения выживания и жизнеспособности бактерий полости рта, в условиях имитации желудочно-кишечного транзита. Четырнадцать видов были отобраны, подвергается в vitro слюнных, желудочного и кишечного пищеварения процессы и представлены многосредовой ячеечная модель, содержащих Како-2 и HT29-MTX клетки для имитации эпителии слизистой кишки. Эта модель служил разгадать влияние проглатывания бактерий на клеток, участвующих в энтерогепатической циркуляции. Использование синтетических сообществ позволяет управляемость и воспроизводимость. Таким образом эта методология может быть адаптирована к оценке жизнеспособности возбудителя и последующие изменения связанных воспаление, колонизации потенциала пробиотик смесей, и в конечном счете, потенциальные бактериальных воздействия на пресистемной циркуляции.

Introduction

Люди сожительствовать с бактериями, которые присутствуют на столько же, сколько клеток человека1. Следовательно важно из важнейших для получения всестороннего понимания человеческого микрофлора. Полости представляет собой уникальную среду, в том, что оно разделено в несколько меньших обитания, таким образом, содержащего большое разнообразие бактерий и биопленки в этих разных местах. Будучи открытой экосистемы, некоторые виды во рту могут быть временные посетителей. Однако некоторые микроорганизмы колонизировать вскоре после рождения и формы организованной биоплёнки2. Они встречаются на поверхности зубов выше десневая щель, поддесневых щелевая, язык, слизистой поверхности и протезирования зубов и пломб3. Бактерии могут также присутствовать как хлопьев и планктонные клеток в просвет канала зуба, вперемешку с некротическими целлюлозы ткани или приостановлено в жидкой фазы.

Существует активная, непрерывной перекрестных помех между клетки хозяина и резидентов микробиоты4. Бактерии общаться внутри и между видами, и лишь небольшая часть природного колонизаторов может придерживаться тканей, в то время как другие бактерии придают этим основным колонизаторов. Например привязки ячеек между микроорганизмов является ключевым для интеграции вторичных колонизаторов в устной биопленки и сложных сетей взаимодействия микробной клетки4. Около 70% бактерий агрегатов в образец слюны формируются Porphyromonas sp., Streptococcus sp., процессы sp., Veillonella sp. и неизвестными Bacteroidetes. F. nucleatum является промежуточным колонизатором в поддесневой биопленки и агрегатов с конца колонизаторов P. амёба, т. denticola и Tannerella Форсития, которые замешаны в пародонтит5. Кроме того Streptococcus mitis занимает слизистых оболочек и стоматологическая местообитаний, а S. sanguinis и S. gordonii предпочитают колонизировать зубы3. Таким образом, S. sanguinis присутствует в нижних резцов и клыков, а Actinomyces naeslundii были обнаружены в верхнем вестибуларный6.

Кроме того коренные микрофлора играет роль в поддержании здоровья человека2. -Резидентов микробиоты участвует в иммунной системе образования и в предотвращении расширения патогена. Это сопротивление колонизация происходит потому что родной бактерии могут быть лучше адаптированы на прикрепление к поверхности и более эффективным в метаболизирующих доступные питательные вещества для роста. Хотя пробиотических штаммов выживают желудочно-кишечного тракта и остаются активными, сохранения автохтонных бактерий, проглотил из верхнего расположения желудочно-кишечного тракта не был полностью описан. Таким образом мы подвергнуты искусственный сообщества, представитель устные экосистемы, имитируемых желудочно-кишечного транзита условий. Жизнеспособность бактериальных клеток была оценена с помощью многосредовой модели, напоминающие эпителии кишечника. Текущий кишки тренажеры предлагают подходящие воспроизводимость результатов с точки зрения анализа Люминал микробной сообщества7. Однако бактериальной адгезии и хост Микроб взаимодействия отдельно рассматриваются, как сочетание клеточных линий с микробных сообществ является сложной задачей8. Напротив мы представляем основы, которая обеспечивает потенциальные механистическое объяснение событий успешной колонизации, сообщили о кишечнике интерфейс. Действительно эта модель может совместно использоваться с моделью статическое кишки для оценки воздействия микробных сообществ на хост поверхности сигнализации.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. штаммов и культура условия

Примечание: Синтетические устные сообщества была написана штаммы обычно присутствует в устной микрофлора3.

  1. Получить следующие штаммы из американской коллекции типа культуры (ЦУВД): Aggregatibacter actinomycetemcomitans (ATCC 43718), фузобактерии nucleatum (ATCC 10953), Porphyromonas амёба (ATCC 33277), процессы Интермедиа (ATCC 25611), Streptococcus mutans (ATCC 25175), Streptococcus sobrinus (ATCC 33478), Actinomyces naeslundii (ATCC 51655), Стрептококк гордони (ATCC 49818), актиномицеты viscosus (ATCC 15987) и Streptococcus mitis (ATCC 49456).
  2. Приобрести Veillonella parvula от Лейбниц Институт DSMZ-немецкий коллекции микроорганизмов и клеточных культур (DSM 2007), Streptococcus sanguinis из коллекции BCCM/LMG бактерий (LMG 14657) и использование Стрептококк salivarius штамм Туве-R9и Streptococcus oralis10.

2. Разработка многовидовыми сообщества представитель устные микрофлора

Примечание: Создание синтетических сообщества для имитации потенциал адгезии бактерий полости рта в эпителии кишечника в пробирке . Рост бактерий на плиты агара крови, дополнена 5 гемин мкг/мл, 1 мкг/мл менадиона и стерильный 5% дефибринированной крови лошади, как описано в Эрнандес-Санабриа и др. (2017) 11. Вкратце:

  1. Растворите 100 мг гемин в 2 мл 1 M NaOH, добавить 100 мл дистиллированной воды газобетона. Хранить в темных контейнере. Стерилизуйте через фильтр 0,22 мкм, перед добавлением в среде.
  2. Растворите 100 мг менадиона в 20 мл 96% этанола. Стерилизуйте через фильтр 0,22 мкм, перед добавлением в среде.
  3. Подготовка 1 Л крови агар среды (см. Таблицу материалы) согласно инструкциям изготовителя и автоклав. Пусть прохладно перед добавлением крови лошади и дополнений. Перемешать и залить пластины.
  4. Готовят настой изменение сердца мозга (BHI) отвар как сообщалось ранее12. Добавьте 5 мкг/мл гемин и 1 мкг/мл менадиона после автоклавирования.
  5. Отказаться от 9 мл среды в Хангейт трубы и закрыть с резиновой пробкой и алюминиевой крышкой. Очистка труб с N2/CO2 (90% / 10%).
  6. Получить 1 мл анаэробной среды с помощью шприца и поместите его в пробки microcentrifuge 1,5 мл. Выбрать один колоний каждого бактериального вида, Ресуспензируйте в средне- и передачи обратно в анаэробных модифицированных BHI. Проинкубируйте 48 ч при 37 ° C, за исключением S. salivarius, которое должны быть инкубирован за 24 ч.
  7. При необходимости подтвердите чистоты культур перед сборкой синтетических сообщества. Вкратце:
    1. Извлечь ДНК из жидкого культур как Эрнандес-Санабриа и др. (2010) 13 и усилить гена 16S рРНК, используя праймеры 27F (AGAGTTTGATYMTGGCTCAG) и 1492R (TACGGYTACCTTGTTACGACT) и Следующая программа: 5 минут при 95 ° C, 30 циклов за 1 мин., 95 ° c 55 ° C за 1 мин и 72 ° C для 1,5 мин, после чего окончательное расширение шаг 5 мин при 72 ° C.
    2. Очистить продукт PCR с коммерческим комплект (см. Таблицу материалы), следуя инструкциям производителя.
    3. Выполните последовательность реакции очищенной продукции в общем объеме 10 мкл, содержащий 0,5 мкл красителя (см. Таблицу материалы), 3.2 пмоль M13f грунт (CGCCAGGGTTTTCCCAGTCACGAC), 2.0 мкл 5 x последовательности буфер, и 20 ng шаблона, используя коммерческие последовательности системы с kit (см. Таблицу материалы).
      Примечание: Мы имели эта процедура выполняется коммерчески.
    4. Выполните поиск взрыв на всех последовательностей (http://blast.ncbi.nlm.nih.gov/Blast.cgi) чтобы определить ближайший известный Таксон и сравнить с последовательностью исходный штамм, используя RDP классификатор онлайн инструмент (http://rdp.cme.msu.edu/) и Сина Выравнивание службы (https://www.arb-silva.de/aligner/).
  8. Мера количества клеток в конце инкубации, используя проточной цитометрии и SYBR зеленый/пропидий йодидом пятно, как описано в Эрнандес-Санабриа и др. (2017) 11. развести культур – 105 клеток мл-1, с использованием модифицированных BHI.
  9. Добавьте 1 mL S. mitis 75 мл анаэробных BHI и температуре до стационарной фазы (6 ч). После, собирайте 0,75 мл каждого разреженных штамм и перемешать в анаэробных условиях.
  10. После всех культур были неоднозначными, взять 1 мл микромира и добавить в 75 мл BHI. Инкубировать синтетических сообщества под 10% CO2, 10% H2, 80% N2 для 48 ч при 37 ° C и 200 об/мин (см. Таблицу материалы).
  11. Измерить плотность клеток как 2.8. перед тем как представить сообщество в ячейки модели. Состав сообщества можно оценить с количественного PCR реального времени, используя праймеры и отжига температура в таблице 1 Сломка и др. (2017) 10. Кроме того, используйте 16S рРНК гена ампликон виртуализации для предоставления информации о первоначальных членов нынешнего13,14. Для либо подтверждающий личность протокол используйте cDNA как шаблон для обозначения бактерий, активно переписывание белков и ДНК как шаблон выявить наличие/отсутствие штаммов.

3. Общая культура клеток практики

Примечание: Для общих аспектов культуры клеток, авторы ссылаются на мастер и Стейси (2007)15. Получения клеточных линий, используемых от Европейской коллекции о подлинности клеточных культур (Како-2 ECACC 86010202 и 12040401 ECACC HT29-MTX-E12, общественного здравоохранения Англии, Великобритания). Реагенты для культуры клеток могут быть приобретены (см. Таблицу материалы), если не указано иное.

  1. Техническое обслуживание и пассированый Како-2 и HT29-MTX клеточных линий
    Примечание: Како-2 и HT29-MTX клетки обычно выращивается в 25 см2 культуры ткани флаконы содержащие дополнениями DMEM среднего (Таблица 1). Клетки являются trypsinized по достижении 60-70% слияния.
    1. Удалите средство культуры клеток из колбы. Мыть дважды с 5 мл PBS без Ca++/Mg++.
    2. Добавьте 2 мл 0,5 мг/Л раствора трипсина и 0,22 г/Л этилена диамин tetraacetic кислоты (ЭДТА). Распределить раствор трипсина, нежно перемещая колбу. Удаление 1,5 мл раствора трипсина и инкубировать настой при 37 ° C за 10 мин.
    3. Проверить под микроскопом, если клетки отсоединяются от поверхности колбы. Инкубируйте дополнительные 5 мин, при необходимости.
    4. Добавьте 5 мл дополнениями клетки культуры средств массовой информации в колбу для инактивации трипсина. Накапайте вверх и вниз для получения однородной одноклеточного подвеска.
    5. Сразу же возьмите 50 мкл аликвота суспензию клеток и смешать с стерильных Трипановый синий 0,4% раствор в пропорции 1:1 (v/v) для клеток Caco-2 или 1:5 v/v для HT29-MTX. Смесь, закупорить и нагрузки в Счетной палате (см. Таблицу материалы).
    6. Количество жизнеспособных клеток (белая светлые клетки) под микроскопом (см. инструкции производителя).
    7. Семян в новой колбу на плотности 4 x 105 клеток/см2 и 1 х 104 клетки/см2, Како-2 и HT29-MTX, соответственно.
      Примечание: (1) ЦАС-2 клетки дифференцировать и образуют плотные соединения, после достижения confluency. Чрезвычайно важно избежать более confluency до trypsinization. Разрастание клеток в колбе может вызвать сбой в ячейке отряд после trypsinization или ячейки сгустки. (2) HT29-MTX клетки производит слизь клеток с высокой метаболической активности16. Эти функции может вызвать быстрое подкисление СМИ культуры клеток, особенно если клетки находятся в высокой плотности. Буфер HEPES могут быть добавлены в среде культуры клеток (Таблица 1) для поддержания рН между 7 и 7.2. Если рН капель, носитель может быть обменялись когда confluency находится менее чем на 50%. Однако если confluency > 50%, культура клетки должны быть разделены.

4. Ассамблея многосредовой ячеечная модель, имитирующие интерфейс хост микробов кишечника

Примечание: Полное сотрудничество культуры в двойной камеры скважины (диаметр 24 мм, поры размер 0,4 мкм; см. Таблицу материалы).

  1. Добавьте 1,5 мл полного клетки культуры средств массовой информации в апикальной отсека и 2 мл в базальной. Предварительно Инкубируйте на 20 – 30 минут, чтобы получить равномерное распределение суспензию клеток при посеве.
  2. Trypsinize культура клетки Caco-2 и HT29-MTX, как описано в разделе 3. Trypsinization должна быть точно процедура для достижения однородной распределения обоих клеточных линий, в одну ячейку подвеска, без сгустков.
  3. Количество жизнеспособных клеток, как описано в 3.1.8.
  4. Отрегулируйте плотность клеток до 6,5 x 104 клетки/см2 в соотношении 90/10 клеток Caco-2/HT29-MTX.
  5. Гомогенизации суспензии клеток и добавьте соответствующий объем клеток Caco-2 и HT29-MTX предварительно заполненные стерильный контейнер с дополнениями клетки культуры средств массовой информации. Удаление предварительно инкубирован СМИ из в апикальной части камеры путем аспирации.
  6. Аккуратно перемешать суспензию клеток, дозирование и передачи 1,5 мл апикальной отсека камеры вставок. Высева процедура требует постоянной гомогенизации суспензии клеток, как клетки, как правило, отложениях. В зависимости от опыта пользователя и скорость работы после подачи 1 – 3 скважины должны быть смешаны суспензию клеток.
  7. Перемещение плит осторожно взад и вперед и затем право слева направо (5 – 10 раз) получить даже распространение клеток в колодец. Трансфер в инкубаторе и повторите движение плит.
  8. Поддерживать сотрудничество культуры клеток Caco-2/HT29-MTX на 15 дней, освежающий апикальной и базальной отсеков каждые 2 дня с дополнениями DMEM. После этого времени средства массовой информации культуры клеток можно изменить на дополнениями DMEM без антибиотика/противогрибковое решения.
  9. Поддерживать систему до 20-21 дней после посева, обновляя носитель каждые 2 дня.
  10. Мера целостности эпителиальных барьер перед началом анализа, используя систему электрического сопротивления (см. таблицу материалы), следуя инструкциям производителя.
    1. Убедитесь, что оборудование ТЕЕР полностью заряжен (> 24 h) перед началом измерения.
    2. Отсоедините ТЕЕР оборудование от источника питания и крышка с мешком пластиковых автоклава. Сделайте отверстие в мешок, чтобы ввести электрода и подключите к порту ввода на метр. Спрей с 70% этанола/воды (v/v) до введения ТЕЕР оборудование в кабинет потока.
    3. Для дезинфекции электрода, погружают электрод советы в 70% (v/v) этанола/воды раствор для 15 мин разрешить воздух сухой за 15 с. промойте электрод в подогретым клетки культуры средств массовой информации.
    4. Возьмите клетки из инкубатора и позволяют клеткам прийти к комнатной температуры внутри шкафа потока.
    5. Убедитесь, что прибор отключен от зарядного устройства. Установите переключатель режимов в ом и поверните выключатель питания на.
    6. Измерьте сопротивление клетки, погружая электрод с короче кончиком в insert и больше кончик из колодца. Держите электрод под углом в 90° вставить пластину.

5. бактериальные выживания в Vitro условий желудочно-кишечного транзита

Примечание: Подготовьте имитируемых пищеварение жидкости после протокола Minekus и др. (2014) 17, с изменениями, описанные ниже. Подготовьте все разведения с ультрачистая вода. Фильтр стерилизовать всех решений через фильтр 0,22 мкм и выполнить процедуру пищеварение в стерильных условиях.

  1. Устные пищеварения:
    1. Место 3 мл бактериальной сообщества в 50 мл стерильной пробирке, смешать с 3 мл имитируемых слюной жидкости (ФСО), содержащую (в ммоль L-1): KCl, 15.1; KH2PO4, 3.7; NaHCO3, 6.8; MgCl2(H2O)6, 0.5, (NH4) CO3, 0,06; HCl, 1.1; CaCl2(H2O)2, 0,75. Добавьте 75 ед/мл α-амилазы из слюны человека тип IX-A и 2 г/Л муцина из свиного желудка типа II в ФСО.
    2. Инкубируйте смесь для 2 мин, при 37 ° C и 100 об/мин. Соберите образец 2 мл для экстракции ДНК и потока цитометрии количественной оценки (S1).
  2. Желудочного пищеварения:
    1. Добавить 4 мл имитируемых желудка жидкости (SGF), содержащую (в ммоль L-1): KCl, 6,9; KH2PO4, 0,9; NaHCO3, 25; NaCl, 47,2; MgCl2(H2O)6, 0.1, (NH4) CO3, 0,5; HCl, 15,6; CaCl2(H2O)2, 0,075. Кроме того SGF содержит 2 г/Л муцина от свиного желудка типа II.
    2. Измерение pH и приспособиться к рН 3 с 1 M HCl, если это необходимо. Инкубируйте при 37 ° C и 100 об/мин. Соберите образец 2 мл (S2).
  3. Пищеварение в тонком кишечнике:
    1. Добавить 4 мл имитируемых кишечной жидкости (SIF), содержащую (в ммоль L-1): KCl, 6.8; KH2PO4, 0,8; NaHCO3, 85; NaCl, 38,4; MgCl2(H2O)6, 0.33; HCl, 8.4; CaCl2(H2O)2, 0,3; на трубу пищеварение.
    2. Приспособиться к рН 7 с 1 M NaOH, если это необходимо. Инкубируйте при 37 ° C и 100 об/мин. Соберите образец 2 мл (S3).

6. бактериальной колонизации способности в Vitro условий желудочно-кишечного транзита

  1. Центрифуга 2 мл тонкой кишки пищеварения, за 10 мин при 2650 x g.
  2. Удалить супернатант и смешать бактериальных гранулы с 5 мл дополнениями DMEM без антибиотиков и противогрибковое.
  3. Выведение и количественно нетронутыми/поврежденных клеток с помощью проточный цитометр (см. Таблицу материалы), как описано в Эрнандес-Санабриа и др. (2017) 11.
  4. Отрегулируйте плотность клеток до 105 жизнеспособных клеток/мл разбавлением в дополнение DMEM без антибиотиков и противогрибковое.
  5. Удалите средство апикальной transwell системы и добавить 1,5 мл бактериальной подвески. Совместное культуры системы за 2 ч в условиях культуры общей ячейки (37 ° C, влажность 95%, 5% CO2).
    Примечание: Этот срок может быть продлен до 48 часов, в зависимости от экспериментального протокола. Совместное культуры может быть сохранен в другой инкубатор чем используется для обслуживания обычной клетки, чтобы избежать загрязнения.
  6. Измерьте ТЕЕР значения после инкубации, для оценки целостности эпителиальных барьер, как описано в 4.11.
  7. После завершения время инкубации, удалите апикальной СМИ и собирать 0,5 мл для дальнейшего анализа (S4). Подвыборки средства массовой информации могут использоваться для оценки жизнеспособности клеток пробирного Лактатдегидрогеназа (LDH) (см. Таблицу материалы), следуя инструкциям производителя.
  8. Добавьте 0,5 мл 10 мм N-ацетилцистеина в HBSS (NAC-буфер) чтобы солюбилизировать последнего слизи, производимые HT29 MTX и восстановить придерживался бактерий. Инкубировать пластин при 37 ° C за 1 ч, под агитации (135/мин, смотрите Таблицу материалы).
  9. Восстановить NAC-HBSS в пробки microcentrifuge (S5) и мыть дважды клетки с 1 мл DPBS.
  10. Добавить 0,5 мл 0,5% Тритон X-100 (w/v) поверх монослои, срывать клетки, дозирование, восстановить жидкости и вихревые за 1 мин скорость важна избежать повреждения бактериальной клетки с моющим средством.
  11. Центрифуга клетки для 5 мин при 2650 x gи отдельные супернатант (S6) и Пелле (S7).

7. выборочный анализ

Примечание: Анализ собранных образцов (S1-S7) для оценки жизнеспособности бактериальных и адгезии, потенциал для кишечных клетки, после имитации желудочно-кишечного пищеварения.

  1. Бактериальные жизнеспособности: передать образцы S1-S5 дважды через 0.45 мкм и количественно бактериальные клетки, с помощью окрашивания жить/мертвых клеток и проточная цитометрия, как указано в шаге 2.811.
  2. Адгезия потенциал: подготовить серийных разведений (-1 -8) для S1-S6 и полоса 10 мкл крови агар и изменение BHI пластины. Инкубируйте при 37 ° C в анаэробных условиях для 24-48 ч. плита такой же объем неразбавленном S7.
    1. Таксономическая идентификация придерживался бактерий:
      1. Выбрать отдельные колонии с петлей культуры и Ресуспензируйте каждый по 10 мкл воды, свободной от нуклеиназы. Собирать 4 мкл этой подвески и использовать его как шаблон для PCR амплификация гена 16S рРНК, используя праймеры и условий, описанных в 2.7.1.
      2. Выполнение последовательности после протокола в 2.7.3 и проверки последовательности, используя процедуры, включенные в 2.7.4.
  3. Делать дальше вниз по течению анализ общей экстракции ДНК, количественной оценке и/или 16S рРНК Ампликон ПЦР секвенирования, извлечение RNA и транскриптомики профилирования по желанию.
    Примечание: Поток цитометрии количественная оценка была проведена сразу же после выборки. Как элемент управления для permeabilized мембраны клеток использовался образец подвергается 70 ° C на 3 мин. Фоновый шум оценивалась путем измерения с проточной цитометрии пищеварение жидкости или образцы, полученные из клеток культуры модели без бактерий. Каждый образец измерялась в трех экземплярах.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Этот протокол приводит к генерации модели, пригодной для выяснения выживания и жизнеспособности бактерий полости рта, в условиях имитации желудочно-кишечного транзита. Количество нетронутым клеток от отдельных штаммов составляет приблизительно 108 клеток мл-1 предварительное создание синтетических сообщества, хотя многовидовыми микрокосм, содержащихся выше 90% жизнеспособных клеток во время создания сообщества ( Рисунок 1A и 1B). На основании количественной оценки Live/мертвые, бактериальных жизнеспособности уменьшается после каждого шага пищеварения (рис. 2). Это может быть результатом рН во время прохождения желудка и желчных солей, содержащихся в тонкой кишке пищеварение жидкости, как происходящее в физиологических условиях. Жизнеспособность во время транзита через желудочно-кишечного пищеварения в пробирке и в естественных условиях может зависеть от изменений в окружающей среде (например, кормили против постились условия), или даже на бактерии защиты процессов (споро формирование или кишечных покрытия).

Подходящие элементы управления, такие как жар убитые бактерий или фон образцов, для выполнения точных жизнеспособных клеток количественная оценка18необходимо сравнить потока гранулярных графов. Суровые условия желудка и тонкой кишки пищеварение можно переключиться жизнеспособным, но не culturable клеток, которые являются живых бактерий, которые не растут или разделить бактерий. По этой причине плиты счетчики отличаются от жизнеспособных клеток, полученные с проточной цитометрии. Например на рисунке 3, жизнеспособных клеток, оправился от слизистой интерфейса окрашены синим цветом на участке цитометрии потока. Однако рост не было отмечено, когда эти образцы слизи покрытием (результаты не показано).

Фракция, на котором бактерии показывают более высокие показатели жизнеспособности является сотовой мусора (S7), как свидетельствуют пластины подсчета (рис. 4). Количество колоний может быть переменной, но наличие метаболически активных бактерий встречается в менее разбавленных пробах.

Figure 1
Рисунок 1: Сотовый жизнеспособность бактерий, составляющих многовидовыми микробной сообщества в начале в vitro желудочно-кишечного пищеварения. (A) жизнеспособных клеток (журнал единиц) количественно жить/смерть окрашивания и потока цитометрии (среднее ± стандартное отклонение, n = 3). (B) представитель потока цитометрии участок многовидовыми микробной сообщества после 48 ч Сопредседатель культуры. Точки в зеленый, красный и черный представляют собой жизнеспособные, повреждены и фона или несекретной бактерий, соответственно. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 2
Рисунок 2: сотовый жизнеспособность бактерий после имитации желудочно-кишечного пищеварения. Бары представляют количество жизнеспособных клеток (журнал единиц) после устного, желудка и малых кишечного пищеварения шагов (среднее ± стандартное отклонение, n = 3). Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 3
Рисунок 3: представительный участок жизнеспособных бактериальных клеток в слизистой интерфазе. Красные точки представляют собой точки фона и синий жизнеспособных клеток. Проточная цитометрия, условия были созданы на основании реквизит и др. (2016) 19. слизистой образцы были разбавленных 1: 100 (v/v) и окрашивали Sybr Грин/пропидий йодидом 15 мин, и 100 мкл образец измерялась в значения параметров FL1: 533/30 Нм, FL2: 585/40 Нм, FL3: > 670 нм длинный пас и FL4: 675/25 Нм. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Figure 4
Рисунок 4: колонии, образуя единиц (CFU) выросло с сотовой мусора в изменение пластины BHI. Три биологических реплицирует были использованы для assay бактериальной адгезии и три технических реплицирует были выполнены для количественной оценки кое. Две пластины реплицировать, содержащие -1 для разведения-6 клеток мусора (S7) показано на рисунке. Пожалуйста, нажмите здесь, чтобы посмотреть большую версию этой фигуры.

Культура клеток Сторонник / подвеска Культивирование среднего Общие добавки Конкретные добавки Удвоение время Условия инкубации
Како-2 (ECACC 86010202) Сторонник Дульбекко средний орла изменения (DMEM) с глюкозой 4,5 г/Л Инактивированная плода бычьим сывороточным (10% v/v)
Пенициллин (100 ед/мл) *
Стрептомицин (0,1 мг/мл) *
Амфотерицин (0,0025 мг/мл) *
Glutamax (4 мм)
Номера основных аминокислот (1% v/v)
Пируват (1 мм)
65-72 h 95% влажности и 10% CO2
CO2 инкубатора (см. Таблицу материалы)
HT29-MTX (ECACC 12040401) Сторонник HEPES (1 мм) 20 – 24 h
* Антибиотики и противогрибковые препараты были удалены из СМИ культуры клетки 2 дня перед началом анализов.

Таблица 1: Описание клеток линии и СМИ состава для поддержания культуры клеток.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Устные микрофлора является ключевым элементом в здоровье человека, как недавно сообщили несколько авторов20,21. Предыдущие результаты показывают, что проглатывание слюны, содержащих большие нагрузки бактерий может повлиять на микробные экосистемы тонкой кишки, который является одним из основных мест для грунтования иммунную. Сочетание статического верхняя желудочно-кишечного пищеварения модель с хост-интерфейс, представленный клеток кишечного эпителия и секреции слизи, служил разгадать влияния микробного компонента на хосте.

В vitro модели являются основными инструментами для исследования, позволяющие механистический исследований и достижение фоновых знаний, предназначенных для уменьшения, сделать более эффективной и лучше целевой в vivo исследований. По этой причине крайне важно для обеспечения чистоты, жизнеспособности и оптимальный рост стерильных культурах до создания синтетических микробиологические сообщества. Мы рекомендуем, оценке жизнеспособности и состав бактериальных сообществ перед воздействием культур клеток, чтобы избежать предвзятости в анализе. Большое количество поврежденных бактерий могут препятствовать адгезии и дальнейшее воздействие на целостность клеток модели. Кроме того использование надежным источником клеточных линий позволит свести к минимуму, неверной строки ячейки, загрязнение и бедных аннотации, укрепление экспериментальной воспроизводимость22.

Включая слизь продуцирующих клеток позволяет сходство с тонкой кишки, слизи и муцин обеспечивают первую линию обороны желудочно-кишечного тракта23. Кроме того слизистая слой подходит для бактериальной колонизации, позволяя для характеристики двусторонние перевозки бактериальных метаболитов. Кроме того имитации желудочно-кишечного тракта условий увеличения способности адгезии штаммы Lactobacillus paracasei Како-2 и муцина24, поддерживая актуальность включения пищеварительные процессы в нашей модели.

Дальнейшие улучшения в модели могут быть введены для включения компонента иммунной узла, как ранее рассмотренных25. Однако нынешние системы совместного культуры клеток эпителия и иммунной не были использованы для хост Микроб взаимодействия приложений (например, оценки продовольственной биоактивных соединений или пробиотики), которые могут указывать, что эти системы могут не воспроизводимость25.

Предыдущие исследования с Како-2, HT29-MTX или совместного культур оценку адгезии пробиотик или патогенных штаммов mammalian клеток26,27. С помощью одного пятна или объединения нескольких микроорганизмов может предоставить ограниченный обзор на хост микробных взаимодействий, и это не представитель сложности желудочно-кишечного тракта человека. Хотя использование природных микробных сообществ может быть более представительным в естественных условиях сценария, они трудно охарактеризовать и учиться. В противоположность этому наша методология предоставляет возможность оценки нескольких хост микробных взаимодействий, используя сложный и представительным микрокосма. Использование определенных синтетических микробной сообщества позволяет для поколения системы с пониженной сложности28. Изменения в сообществе может быть результатом microenvironmental условий в контексте отдельных экспериментов. Таким образом микробного компонента этой модели может быть легко масштабируется вверх или вниз для деконструкции влияние среды как селективный силы. Наконец выборки доступность гарантирует дальнейшей характеризации функциональной деятельности клеток человека и сообществом связанного микробные.

В последние годы были разработаны новые модели в пробирке , основанные на технологии органоид. Organoids являются 3D клеточных культур, которые включают некоторые из ключевых особенностей представленных основной ткани. Хотя кишечных organoids вблизи физиологические системы для исследования взрослых стволовых клеток и тканей, такая модель также имеет некоторые ограничения. Кишечные organoids ограниченное использование в напоминающие воспалительные реакции на инфекции или наркотиков, поскольку они не имеют иммунные клетки. Кроме того organoids гетерогенными относительно жизнеспособности, размер и форму, препятствующие фенотип скрининг и рендеринга стандартизации комплекса. Несмотря на ограничение увековечен клеточных линий в vitro моделирования здоровых тканей использование хорошо изученных и стабильных клеточных линий также предлагает преимущества как повторяемость, воспроизводимость и низкой стоимости. Эти преимущества позволяют для одновременной проверки нескольких условий, но поступательного использования данных является спорным. Главные ячейки может быть более представительным в vivo физиологии; Однако, они имеют высокие межличностная изменчивость, характеризуются не полностью, неоднородны и имеют ограниченный промежуток времени. Эти факторы являются недостаток для включения нескольких условий или реплицируется в одну assay.

Как сочетание клеточных линий с сложных микробных сообществ может представлять вызов, мы сосредоточились на разработке воспроизводимость и повторяемые модели с высокой гибкостью и применимость в лабораториях с оборудованием основной ячейки, до более представительным модели стали доступны и хорошо характеризуют. Мы оценили функциональность различных бактериальных сообществ, используя эти многосредовой модели, например, для оценки поведения пробиотик в верхнем желудочно-кишечного тракта и для характеристики ксенобиотиков влияние на интерфейсе кишки. Таким образом мы предлагаем эту модель как основа для дальнейших анализов с широким разнообразием пробиотики, наркотиков или еда соединений, в пределах экосистемы актуальными и определенных в пробирке .

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторы не имеют ничего сообщать

Acknowledgments

Авторы с благодарностью признаем финансовую поддержку от Фонда исследований Фландрии Marta Calatayud Арройо (докторантура стипендий FWO-12N2815N). Эмма Эрнандес-Санабриа – Докторантура научный поддерживаемых Фландрии инноваций и предпринимательства (Agentschap voor Innovatie двери Wetenschap en Technologie, ВВТ).

Materials

Name Company Catalog Number Comments
STRAINS
Aggregatibacter actinomycetemcomitans American Type Culture Collection ATCC 43718
Fusobacterium nucleatum American Type Culture Collection ATCC 10953
Porphyromonas gingivalis American Type Culture Collection ATCC 33277
Prevotella intermedia American Type Culture Collection ATCC 25611
Streptococcus mutans American Type Culture Collection ATCC 25175
Streptococcus sobrinus American Type Culture Collection ATCC 33478
Actinomyces viscosus American Type Culture Collection ATCC 15987
Streptococcus salivarius  TOVE-R
Streptococcus mitis American Type Culture Collection ATCC 49456
Streptococcus sanguinis BCCM/LMG Bacteria Collection LMG 14657
Veillonella parvula Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures DSM 2007
Streptococcus gordonii American Type Culture Collection ATCC 49818
CELL LINES
Caco-2 cells European Collection of Authenticated Cell Cultures 86010202
HT29-MTX cells European Collection of Authenticated Cell Cultures 12040401
REAGENTS AND CONSUMABLES
Brain Heart Infusion (BHI) broth Oxoid CM1135
Blood Agar 2 Oxoid CM0055 Blood Agar medium
Menadione Sigma M9429
Hemin Sigma H9039
5% sterile defibrinated horse blood E&O Laboratories Ltd, P030
InnuPREP PCRpure Kit Analytik Jena 845-KS-5010250 PCR purification kit
Big Dye Applied Biosystems 4337454 Dye for sequencing
ABI Prism BigDye Terminator v3.1 cycle sequencing kit Applied Biosystems 4337456
SYBR Green I Invitrogen S7585
Propidium Iodide Invitrogen P1304MP
T25 culture flasks uncoated, cell-culture treated, vented, sterile VWR 734-2311
Trypsin-EDTA solution Sigma-Aldrich T3924-100ML
Trypan Blue solution
0.4%, liquid, sterile-filtered
Sigma-Aldrich T8154 
PBS Gibco 14190250
DMEM cell culture media, with GlutaMAX and Pyruvate Life technologies 31966-047
Corning Transwell polyester membrane cell culture inserts Sigma-Aldrich CLS3450-24EA
Mucin from porcine stomach Type II   Sigma-Aldrich M2378
Inactivated fetal bovine serum Greiner Bio One 758093
Antibiotic-Antimycotic (100X) Gibco 15240062
Triton X 100 for molecular biology Sigma-Aldrich T8787 
DPBS without calcium, magnesium Gibco 14190-250
Pierce LDH Cytotoxicity Assay Kit Thermo Fisher Scientific 88953
Corning HTS Transwell-24 well, pore size 0.4 µm Corning Costar Corp 3450
Nuclease-free water Serva Electrophoresis 28539010
EQUIPMENT
Neubauer counting chamber improved Carl Roth T729.1
BD Accuri C6 Flow cytometer BD Biosciences 653118
PowerLyzer 24 Homogenizer MoBio 13155
T100 Thermal Cycler BioRad 186-1096
Flush system Custom made -
InnOva 4080 Incubator Shaker New Brunswick Scientific 8261-30-1007 Shaker for 2.10
Memmert CO2 incubator Memmert GmbH & Co. ICO150med
Millicell ERS (Electrical Resistance System) EMD Millipore, Merck KGaA MERS00002
Millipore Milli-Q academic, ultra pure water system Millipore, Merck KGaA -
Shaker (ROCKER 3D basic) IKA 4000000 Shaker for 6.10

DOWNLOAD MATERIALS LIST

References

  1. Sender, R., Fuchs, S., Milo, R. Revised estimates for the number of human and bacteria cells in the body. PLoS Biology. 14, e1002533 (2016).
  2. Kelly, D., King, T., Aminov, R. Importance of microbial colonization of the gut in early life to the development of immunity. Mutation Research-Fundamental and Molecular Mechanisms of Mutagenesis. 58-69 (2007).
  3. Aas, J. A., Paster, B. J., Stokes, L. N., Olsen, I., Dewhirst, F. E. Defining the normal bacterial flora of the oral cavity. Journal of Clinical Microbiology. 43, 5721-5732 (2005).
  4. Marsh, P. D., Head, D. A., Devine, D. A. Dental plaque as a biofilm and a microbial community-Implications for treatment. Journal of Oral Biosciences. 57, 185-191 (2015).
  5. Socransky, S. S., Haffajee, A. D., Cugini, M. A., Smith, C., Kent, R. L. Microbial complexes in subgingival plaque. Journal of Clinical Periodontology. 25, 134-144 (1998).
  6. Haffajee, A. D., et al. Subgingival microbiota in healthy, well-maintained elder and periodontitis subjects. Journal of Clinical Periodontology. 25, 346-353 (1998).
  7. Venema, K. Microbial metabolites produced by the colonic microbiota as drivers for immunomodulation in the host. The FASEB Journal. 27, (2013).
  8. Marzorati, M., et al. The HMI (TM) module: A new tool to study the Host-Microbiota Interaction in the human gastrointestinal tract in vitro. BMC Microbiology. 14, 133 (2014).
  9. Tanzer, J. M., Kurasz, A. B., Clive, J. Competitive displacement of mutans streptococci and inhibition of tooth-decay by Streptococcus-Salivarius Tove-R. Infection and Immunity. 48, 44-50 (1985).
  10. Slomka, V., et al. Nutritional stimulation of commensal oral bacteria suppresses pathogens: the prebiotic concept. Journal of Clinical Periodontology. 44, 344-352 (2017).
  11. Hernandez-Sanabria, E., et al. In vitro increased respiratory activity of selected oral bacteria may explain competitive and collaborative interactions in the oral microbiome. Frontiers in Cellular and Infection Microbiology. 7, 235 (2017).
  12. Alvarez, G., Gonzalez, M., Isabal, S., Blanc, V., Leon, R. Method to quantify live and dead cells in multi-species oral biofilm by real-time PCR with propidium monoazide. AMB Express. 3, (2013).
  13. Ehsani, E., et al. Initial evenness determines diversity and cell density dynamics in synthetic microbial ecosystems. Scientific Reports. 8, 340 (2018).
  14. Hernandez-Sanabria, E., et al. Correlation of particular bacterial PCR-denaturing gradient gel electrophoresis patterns with bovine ruminal fermentation parameters and feed efficiency traits. Applied and Environmental Microbiology. 76, 6338-6350 (2010).
  15. Masters, J. R., Stacey, G. N. Changing medium and passaging cell lines. Nature Protocols. 2, 2276-2284 (2007).
  16. Calatayud, M., Velez, D., Devesa, V. Metabolism of inorganic arsenic in intestinal epithelial cell lines. Chemical Research in Toxicology. 25, 2402-2411 (2012).
  17. Minekus, M., et al. A standardised static in vitro digestion method suitable for food - an international consensus. Food & Function. 5, 1113-1124 (2014).
  18. Berney, M., Hammes, F., Bosshard, F., Weilenmann, H. U., Egli, T. Assessment and interpretation of bacterial viability by using the LIVE/DEAD BacLight kit in combination with flow cytometry. Applied and Environmental Microbiology. 73, 3283-3290 (2007).
  19. Props, R., Monsieurs, P., Mysara, M., Clement, L., Boon, N. Measuring the biodiversity of microbial communities by flow cytometry. Methods in Ecology and Evolution. 7, 1376-1385 (2016).
  20. Yamashita, Y., Takeshita, T. The oral microbiome and human health. Journal of Oral Science. 59, 201-206 (2017).
  21. Wade, W. G. The oral microbiome in health and disease. Pharmacological Research. 69, 137-143 (2013).
  22. Yu, M., et al. A resource for cell line authentication, annotation and quality control. Nature. 520, 307 (2015).
  23. Pelaseyed, T., et al. The mucus and mucins of the goblet cells and enterocytes provide the first defense line of the gastrointestinal tract and interact with the immune system. Immunological Reviews. 260, 8-20 (2014).
  24. Bengoa, A. A., et al. Simulated gastrointestinal conditions increase adhesion ability of Lactobacillus paracasei strains isolated from kefir to Caco-2 cells and mucin. Food Research International. 103, 462-467 (2018).
  25. Kleiveland, C. R., et al. The Impact of Food Bioactives on Health: in vitro and ex vivo models. Verhoeckx, K., et al. Springer International Publishing. 197-205 (2015).
  26. Laparra, J. M., Sanz, Y. Comparison of in vitro models to study bacterial adhesion to the intestinal epithelium. Letters in Applied Microbiology. 49, 695-701 (2009).
  27. Gagnon, M., Berner, A. Z., Chervet, N., Chassard, C., Lacroix, C. Comparison of the Caco-2, HT-29 and the mucus-secreting HT29-MTX intestinal cell models to investigate Salmonella adhesion and invasion. Journal of Microbiological Methods. 94, 274-279 (2013).
  28. Großkopf, T., Soyer, O. S. Synthetic microbial communities. Current Opinion in Microbiology. 18, 72-77 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics