Beurteilung der Lebensfähigkeit eines synthetischen bakterielle Konsortiums auf der In-vitro- Darm Host-Mikrobe Oberfläche

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Darm-Host-Mikroben-Interaktionen wurden bewertet, mit einem neuartigen Ansatz kombiniert eine synthetische mündliche Gemeinschaft, in-vitro- Magen-Darm-Verdauung und ein Modell der Dünndarm Epithel. Wir präsentieren Ihnen eine Methode, die auszuwertende ZELLINVASION von Krankheitserregern und Multi-Spezies-Biofilmen oder sogar probiotischen Formulierungen Überlebensfähigkeit getestet angepasst werden kann.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Calatayud Arroyo, M., Van de Wiele, T., Hernandez-Sanabria, E. Assessing the Viability of a Synthetic Bacterial Consortium on the In Vitro Gut Host-microbe Interface. J. Vis. Exp. (137), e57699, doi:10.3791/57699 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Das Zusammenspiel zwischen Host und Mikrobiota wurde längst erkannt und ausführlich beschrieben. Der Mund ist ähnlich wie bei anderen Abschnitten des Magen-Darm-Trakt, wie resident Mikrobiota auftritt und Kolonisierung durch exogene Bakterien verhindert. In der Tat mehr als 600 Arten von Bakterien in der Mundhöhle gefunden werden, und ein einzelnes Individuum kann rund 100 verschiedene jederzeit tragen. Orale Bakterien besitzen die Fähigkeit zur Einhaltung der verschiedenen Nischen im mündlichen Ökosystem, also innerhalb der ansässigen mikrobieller Gemeinschaften und Begünstigung Wachstum und Überleben integriert. Jedoch wurde die Strömung von Bakterien in den Darm beim Schlucken stören das Gleichgewicht der Darm Microbiota vorgeschlagen. In der Tat verschoben oraler Verabreichung von p. Gingivalis bakterielle Zusammensetzung im Ileum Mikroflora. Wir nutzten eine synthetische Gemeinschaft als eine vereinfachte Darstellung des natürlichen Ökosystems mündliche, das Überleben und die Lebensfähigkeit der mundbakterien simulierten Magen-Darm-Transit Bedingungen unterworfen aufzuklären. Vierzehn Arten wurden ausgewählt, in-vitro- Speichel, Magen und Darm Verdauungsprozesse ausgesetzt und präsentiert eine multicompartment Zellmodell Caco-2 und HT29-MTX Zellen um die Darm-Schleimhaut-Epithel zu simulieren. Dieses Modell diente dazu, die Auswirkungen der schluckte Bakterien auf Zellen in den enterohepatischen Kreislauf zu entwirren. Mit synthetischen Gemeinschaften können Kontrollierbarkeit und Reproduzierbarkeit. So, diese Methodik lässt sich anpassen, Erreger Lebensfähigkeit und nachträgliche Entzündung verbundenen Änderungen, Kolonisation Kapazität von probiotischen Mischungen zu beurteilen und letztlich mögliche bakterielle Auswirkungenauf den presystemic Kreislauf.

Introduction

Menschen Zusammenleben mit Bakterien, die unter der gleichen Nummer wie menschliche Zellen1vorhanden sind. Daher ist es von entscheidender Bedeutung wichtig, ein umfassendes Verständnis für die menschlichen Mikrobiom zu erhalten. Die Mundhöhle ist ein einzigartiges Umfeld, dass mehrere kleinere Lebensräume unterteilt ist, so enthält eine Vielzahl von Bakterien und Biofilme an den verschiedenen Standorten. Ein offenes Ökosystem können, einige Arten im Mund vorübergehende Besucher sein. Bestimmte Mikroorganismen besiedeln jedoch bald nach der Geburt und bilden Biofilme2organisiert. Diese sind in der Zahnoberfläche oberhalb der Gingiva Spalt, der subgingivalen Spalt, Zunge, Schleimhaut-Oberflächen und zahnärztliche Prothetik und Füllungen3gefunden. Bakterien können auch vorhanden sein, wie Flocken und planktischen Zellen in das Lumen des Zahn-Kanals, vermischt mit nekrotischen Pulpagewebe oder in einer flüssigen Phase ausgesetzt.

Es gibt aktive und kontinuierliche Übersprechen zwischen Wirtszellen und die ansässigen Mikrobiota-4. Bakterien kommunizieren innerhalb und zwischen den Arten, und nur ein kleiner Teil der natürlichen Kolonisatoren kann Gewebe, einhalten, während andere Bakterien, diese primäre Kolonisatoren befestigen. Zum Beispiel ist Zell-Zell-Bindung zwischen Mikroorganismen Schlüssel für sekundäre Kolonisatoren in orale Biofilme zu integrieren, und den Aufbau komplexer Netzwerke interagierender mikrobiellen Zellen4. Rund werden 70 % der bakteriellen Aggregate in eine Speichelprobe durch Bakterien SP., Streptococcus SP., Prevotella SP., Veillonella SP. und nicht identifizierten Bacteroidetesgebildet. F. Nucleatum ist ein Zwischenprodukt Kolonisator im subgingivaler Biofilm und Aggregate mit den späten Kolonisatoren p. Gingivalis, T. Denticola und Forsythia Forsythien, die an Parodontitis5beteiligt sind. Darüber hinaus nimmt Streptococcus Mitis Schleimhaut- und dental Lebensräume, während S. Sanguinis und S. Gordonii bevorzugen, Zähne3zu kolonisieren. Somit ist, S. Sanguinis in unteren Schneidezähne und Eckzähne, während im oberen Frontzähne6 Actinomyces Naeslundii gefunden wurde.

Darüber hinaus spielt die indigenen Microbiome eine Rolle bei der Aufrechterhaltung der Gesundheit2. Resident Mikrobiota beteiligt sich an immun Bildung und Ausbau der Erreger zu verhindern. Diese Kolonisierung Widerstand tritt auf, weil die native Bakterien besser angepasst an Oberflächen anbringen und effizienter Energiestoffwechsel die verfügbaren Nährstoffe für das Wachstum sein können. Obwohl probiotische Stämme die Magen-Darm-Passage überleben und aktiv bleiben, wurde das Fortbestehen der autochthonen Bakterien verschluckt von einer oberen Lage des Magen-Darm-Trakt nicht vollständig beschrieben. Damit unterworfen wir eine künstliche Community, Vertreter des Ökosystems mündliche simulierten Magen-Darm-Transit Bedingungen. Lebensfähigkeit der Bakterienzellen wurde anhand eines multicompartment Modells ähnelt das Darm Epithel. Aktuelle Darm Simulatoren bieten geeignete Reproduzierbarkeit in Bezug auf die Analyse der luminalen mikrobiellen Gemeinschaft7. Allerdings sind bakterielle Adhäsion und Host-Mikroben-Interaktion gesondert behandelt, als Kombination von Zelllinien mit mikrobieller Gemeinschaften8herausfordert. Im Gegensatz dazu präsentieren wir Ihnen einen Rahmen, der potenzielle mechanistische Erklärung der erfolgreichen Kolonisation Ereignisse berichtete über die Darm-Schnittstelle bietet. Dieses Modell kann in der Tat gemeinsam mit einem statischen Darm-Modell zur Bewertung der Auswirkungen von mikrobiellen Gemeinschaften auf Host Oberfläche Signalisierung verwendet werden.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

(1) Stämme und Kultur Bedingungen

Hinweis: Die synthetische mündliche Gemeinschaft wurde von Stämme häufig präsent in der mündlichen Microbiome3komponiert.

  1. Erhalten Sie die folgenden Stämme aus der amerikanischen Art Kultur Sammlung (ATCC): Aggregatibacter Actinomycetemcomitans (ATCC 43718), Fusobacterium Nucleatum (ATCC 10953) Bakterien Gingivalis (ATCC 33277), Prevotella Intermedia (ATCC 25611), Streptococcus Mutans (ATCC 25175), Streptococcus Sobrinus (ATCC 33478), Actinomyces Naeslundii (ATCC 51655), Streptococcus Gordonii (ATCC 49818), Actinomyces Viscosus (ATCC 15987) und Streptococcus Mitis (ATCC 49456).
  2. Veillonella Parvula vom Leibniz-Institut DSMZ-deutsche Sammlung von Mikroorganismen und Zellkulturen (DSM 2007), Streptococcus Sanguinis aus der BCCM/LMG Bakterien Sammlung (LMG 14657) erwerben und verwerten Streptococcus Salivarius Stamm TOVE-R9und Streptococcus Oralis10.

2. Entwicklung von bewirtschaftet Gemeindevertreter der mündlichen Microbiome

Hinweis: Erstellen einer synthetischen Gemeinschaft um die mögliche Haftung Kapazität der mundbakterien auf der in-vitro- Darm Epithel zu simulieren. Wachsen Sie Bakterien auf BLUTAGAR Platten ergänzt mit 5 μg/mL Hämin, 1 μg/mL Menadion und 5 % sterile Defibrinated Pferd Blut, wie in Hernandez-Sanabria Et Al. beschrieben (2017) 11. In Kürze:

  1. Auflösen von Hämin in 2 mL 1 M NaOH 100 mg, 100 mL destilliertem Wasser autoklaviert. In einem dunklen Behälter aufbewahren. Sterilisieren Sie durch einen 0,22 µm-Filter vor dem Hinzufügen zu Medium.
  2. 100 mg von Menadion in 20 mL 96 % igem Ethanol auflösen. Sterilisieren Sie durch einen 0,22 µm-Filter vor dem Hinzufügen zu Medium.
  3. 1 L BLUTAGAR Medium vorzubereiten (siehe Tabelle der Materialien) entsprechend den Anweisungen des Herstellers und Autoklaven. Lassen Sie abkühlen, bevor Sie das Pferd Blut und die Ergänzungen hinzufügen. Mischen Sie und Gießen Sie die Platten.
  4. Modifizierte Brain Heart Infusion (BHI) Brühe als zuvor gemeldeten12vorbereiten. Nach dem Autoklavieren 5 μg/mL von Hämin und 1 μg/mL von Menadion hinzufügen.
  5. Verzichten Sie 9 mL des Mediums in Hungate-Röhrchen zu, und schließen Sie mit einem Gummistopfen und eine Aluminiumkappe. Spülen Sie die Rohre mit N2Co2 (90 % / 10 %).
  6. Rufen Sie 1 mL der anaeroben Medium mit einer Spritze und legen Sie sie in einen 1,5 mL Microcentrifuge Schlauch. Wählen Sie einzelne Kolonien der einzelnen Bakterienarten, Aufschwemmen Sie Mittel- und zurück auf die anaerobe modifizierte BHI überweisen. Inkubieren Sie für 48 h bei 37 ° C, mit Ausnahme von S. Salivarius, die für 24 h inkubiert werden muss.
  7. Ggf. sollte Reinheit der Kulturen vor der Montage der synthetischen Gemeinschaft zu bestätigen. In Kürze:
    1. Extrahieren von DNA aus der flüssigen Kulturen wie Hernandez-Sanabria Et al. (2010) 13 und 16 s rRNA-gen unter Verwendung der Zündkapseln verstärken 27F (AGAGTTTGATYMTGGCTCAG) und 1492R (TACGGYTACCTTGTTACGACT), und das folgende Programm: 5 Minuten bei 95 ° C, 30 Zyklen von 95 ° C für 1 min 55 ° C für 1 min und 72 ° C für 1,5 min, gefolgt von eine letzte Verlängerung Schritt von 5 min bei 72 ° C.
    2. Reinigen Sie das PCR-Produkt mit einem kommerziellen kit (siehe Tabelle der Materialien), nach den Anweisungen des Herstellers.
    3. Führen Sie die Sequenzierung Reaktion der gereinigten Produkte in 10 μl Gesamtvolumen enthält 0,5 μL der Farbstoff (siehe Tabelle der Materialien), 3.2 Pmol M13f Grundierung (CGCCAGGGTTTTCCCAGTCACGAC), 2,0 μl 5 x Sequenzierung Puffer und 20 ng der Vorlage, mit ein kommerzielle Sequenzierung System mit Kit (siehe Tabelle der Materialien).
      Hinweis: Wir hatten dieses Verfahren kommerziell durchgeführt.
    4. Führen Sie eine BLAST-Suche auf alle Sequenzen (http://blast.ncbi.nlm.nih.gov/Blast.cgi) bestimmen die engsten bekannten Taxon und vergleichen mit der Sequenz des ursprünglichen Stammes mit RDP Klassifikator online-Tool (http://rdp.cme.msu.edu/) und die SINA Ausrichtung-Dienst (https://www.arb-silva.de/aligner/).
  8. Die Anzahl von Zellen am Ende der Inkubationszeit mit Durchflusszytometrie und SYBR Green/Propidium Jodid Fleck wie Hernandez-Sanabria Et Al. beschrieben zu messen (2017) 11. verdünnen Sie die Kulturen auf 105 Zellen mL-1, mit BHI geändert.
  9. Fügen Sie 1 mL S. Mitis in 75 mL anaerobe BHI und brüten Sie bis zu stationären Phase (6 h). Sammeln Sie folgend 0,75 mL jedes verdünnten Sorte und die Mischung unter anaeroben Bedingungen.
  10. Sobald alle Kulturen vermischt haben, nehmen Sie 1 mL des Mikrokosmos und 75 mL BHI hinzufügen. Inkubieren die synthetischen Gemeinschaft unter 10 % CO2, 10 % H2, 80 % N2 für 48 h bei 37 ° C und 200 u/min (siehe Tabelle der Materialien).
  11. Zelldichte in 2.8 zu messen. vor der Community auf das Handy-Modell präsentieren. Zusammensetzung der Gemeinschaft kann beurteilt werden, mit quantitative Real-Time PCR unter Verwendung der Zündkapseln und Glühen Temperaturen in Tabelle 1 von Slomka Et al. (2017) 10. Darüber hinaus 16 s rRNA Gensequenzierung Amplikons verwenden, um Informationen über die Gründungsmitglieder anwesend13,14. Verwenden Sie für jede Identität bestätigen Protokoll cDNA als Vorlage, um die Bakterien aktiv Transkription Proteine anzugeben, und verwenden Sie DNA als Vorlage, um Anwesenheit/Abwesenheit der Stämme zu offenbaren.

3. Allgemeine Zellkultur Praktiken

Hinweis: Für allgemeine Aspekte der Zellkultur, beziehen sich die Autoren auf Master und Stacey (2007)15. Erhalten Sie die Zell-Linien aus den Europäischen Sammlung von authentifiziert Zellkulturen (Caco-2 ECACC 86010202 und HT29-MTX-E12 ECACC 12040401, Public Health England, UK) verwendet. Reagenzien für die Zellkultur können erworben werden (siehe Tabelle der Materialien), sofern nicht anders angegeben.

  1. Wartung und passagierung Caco-2 und HT29-MTX Zell-Linien
    Hinweis: Caco-2 und HT29-MTX Zellen werden routinemäßig in 25 cm2 Gewebe Kulturflaschen mit ergänzten DMEM Medium (Tabelle 1) angebaut. Zellen sind trypsiniert beim Zusammenfluss von 60 – 70 % erreicht wird.
    1. Das Zellkulturmedium aus den Kolben zu entfernen. Zweimal mit 5 mL PBS ohne Ca++/Mg++waschen.
    2. Fügen Sie 2 mL einer 0,5 mg/L-Lösung von Trypsin und 0,22 g/L-Ethylen-Diamin-Tetraacetic-Säure (EDTA). Verteilen Sie die Trypsin-Lösung, indem Sie sanft bewegt den Kolben. 1,5 mL Trypsin-Lösung zu entfernen und die Kolben bei 37 ° C für 10 min inkubieren.
    3. Überprüfen Sie unter dem Mikroskop, wenn Zellen von der Oberfläche der Küvette getrennt sind. Weitere 5 min inkubieren Sie, wenn nötig.
    4. Fügen Sie 5 mL ergänzt Zellkulturmedien in den Kolben, die Trypsin zu inaktivieren. Pipettieren rauf und runter, eine homogene Einzelzelle Suspension zu erhalten.
    5. Sofort nehmen Sie 50 µL aliquoten die Zellsuspension und mischen mit sterilen 0,4 % Trypan blau Lösung in ein 1:1 (V/V) Anteil für Caco-2 Zellen oder 1:5 V/V für HT29-MTX. Mix von pipettieren und Last in einer Zählkammer (siehe Tabelle der Materialien).
    6. Zählen der lebensfähigen Zellen (weiße hell) unter die Lupe genommen (siehe Herstellerangaben).
    7. Samen Sie in eine neue Flasche bei einer Dichte von 4 x 105 Zellen/cm2 und 1 x 104 Zellen/cm2, Caco-2 und HT29-MTX, beziehungsweise.
      Hinweis: (1) Caco-2 Zellen zu unterscheiden und bilden enge Kreuzungen einmal Konfluenz zu erreichen. Es ist äußerst wichtig, über-Konfluenz vor Trypsinization zu vermeiden. Übermäßiges Wachstum von Zellen in Kolben kann in Zelle Ablösung nach Trypsinization und/oder Zelle Klumpen fehlschlägt. (2) HT29-MTX Zellen sind Schleim produzierende Zellen mit hoher Stoffwechselaktivität16. Diese Features verursachen einen schnellen Versauerung von Zellkulturmedien, vor allem, wenn Zellen in hoher Dichte. HEPES-Puffer kann die Zellkulturmedium (Tabelle 1), den pH-Wert zwischen 7 und 7.2 beizubehalten hinzugefügt werden. Medium sein kann, wenn der pH-Wert sinkt, wird ausgetauscht, wenn confluency weniger als 50 %. Jedoch wenn confluency > 50 % die Zellkultur muss geteilt werden.

4. Montage der Multicompartment Zellenmodell simuliert die Darm-Host-Mikroben-Schnittstelle

Hinweis: Füllen Sie kokultur in doppelter Kammer Brunnen (Durchmesser 24 mm, Pore Größe 0,4 μm; siehe Tabelle of Materials).

  1. Am apikalen Fach und 2 mL auf die basale 1,5 mL des kompletten Zellkulturmedien hinzufügen. Vor 20-30 min, gleichmäßige Verteilung der Zellsuspension zu erhalten, bei der Aussaat inkubieren.
  2. Trypsinize Sie die Zellkultur von Caco-2 und HT29-MTX, wie in Abschnitt 3 beschrieben. Das Trypsinization-Verfahren muss genau befolgt werden, um homogene Verteilung der beiden Zelllinien in einer Einzelzelle Suspension, ohne Klumpen zu erreichen.
  3. Der lebensfähigen Zellen zu zählen, wie in 3.1.8 beschrieben.
  4. Passen Sie die Zelldichte auf 6,5 x 104 Zellen/cm2 bei einem 90/10 Teil der Caco-2/HT29-MTX Zellen.
  5. Die Zellsuspensionen zu homogenisieren und einen vorausgefüllten sterilen Behälter mit ergänzten Zellkulturmedien das entsprechende Volumen der Caco-2 und HT29-MTX Zellen hinzufügen. Entfernen Sie die Pre-inkubierten Medien von der apikalen Seite der Kammer durch Absaugen.
  6. Vorsichtig mischen Sie die Zellsuspension durch pipettieren und übertragen Sie 1,5 mL in der apikalen Abteil der Kammer Einsätze zu. Das seeding Verfahren erfordert eine ständige Homogenisierung der Zellsuspension, wie Zellen zu sedimentieren neigen. Abhängig von der Erfahrung des Benutzers und der Arbeitsgeschwindigkeit muss Zellsuspension nach Entnahme von 1 – 3 Brunnen gemischt werden.
  7. Platten vorsichtig rückwärts und vorwärts zu bewegen und dann rechts nach links nach rechts (5 – 10 mal) erhalten eine gleichmäßige Ausbreitung der Zellen in den Brunnen. Transfer zum Inkubator und wiederholen Sie die Bewegung der Platten.
  8. Pflegen der kokultur Caco-2/HT29-MTX Zellen für 15 Tage erfrischende apikale und basale Fächer alle 2 Tage mit ergänzt DMEM. Nach dieser Zeit kann die Zellkulturmedien, ergänzt DMEM ohne Antibiotikum/antimykotische Lösung geändert werden.
  9. Wartung des Systems bis 20 – 21 Tage nach Aussaat durch das Aktualisieren des Mediums alle 2 Tage.
  10. Die epitheliale barriereintegrität vor Beginn der Test mit einem elektrischen Widerstand-System zu messen (siehe Tabelle der Materialien), den Anweisungen des Herstellers.
    1. Sicherzustellen, dass TEER Ausrüstung vollständig geladen ist (> 24 h) vor Beginn der Messungen.
    2. Trennen Sie die TEER-Ausrüstung das Netzteil und die Abdeckung mit einer Kunststoff-Autoklaven-Tasche. Machen Sie ein Loch in die Tasche zu einführen die Elektrode und stecken in den Eingangs-Port auf dem Zähler. Besprühen Sie mit 70 % Ethanol/Wasser (V/V) vor der Einführung der TEER-Ausrüstung in den Fluss-Schrank.
    3. Um die Elektrode zu desinfizieren, Tauchen Sie die elektrodenspitzen in 70 % Ethanol/Wasser (V/V) Lösung für 15 min. an der Luft trocknen lassen für 15 S. Spülen der Elektrode in vorgewärmten Zellkulturmedien.
    4. Nehmen Sie die Zellen aus dem Inkubator und lassen Sie Zellen auf Raumtemperatur in den Fluss Schrank kommen.
    5. Stellen Sie sicher, dass das Messgerät vom Ladegerät getrennt ist. Den Modus-Schalter auf Ohm und schalten Sie den Netzschalter ein.
    6. Messen Sie den Widerstand der Zelle durch Eintauchen der Elektrode mit der kürzere Spitze in den Einsatz und die längere Spitze aus dem Brunnen. Halten Sie die Elektrode in einem 90° Winkel auf der Platte einfügen.

(5) bakterielle Überleben nach In-vitro- Magen-Darm-Transit-Bedingungen

Hinweis: Bereiten Sie simulierten Verdauung Flüssigkeiten nach dem Protokoll von Minekus Et Al. (2014) 17, mit den unten beschriebenen Änderungen. Bereiten Sie die Verdünnungen mit Reinstwasser. Sterilisieren Sie Filter-alle Lösungen durch einen 0,22 µm-Filter und führen Sie die Verdauung unter sterilen Bedingungen.

  1. Mündliche Verdauung:
    1. 3 mL der bakteriellen Gemeinschaft in ein 50 mL steriles Röhrchen geben, mischen mit 3 mL simulierten Speichel Flüssigkeit (SSF), die (in Mmol L-1) enthalten: KCl, 15,1; KH2PO4, 3.7; Nahco33, 6,8; MgCl2(H2O)6, 0,5, (NH4) CO3, 0,06; HCl, 1.1; CaCl2(H2O)2, 0,75. Fügen Sie 75 U/mL der α-Amylase aus menschlichem Speichel Typ IX-A und 2 g/L Mucin vom Schwein Magen Typ II, der SSF.
    2. Inkubieren Sie die Mischung für 2 min bei 37 ° C und 100 u/min. Sammeln Sie eine 2 mL Probe zur DNA-Extraktion und Flow Cytometry Quantifizierung (S1).
  2. Magen Verdauung:
    1. Fügen Sie 4 mL simulierten magenflüssigkeit (SGF), mit (in Mmol L-1): KCl, 6,9; KH2PO4, 0,9; Nahco33, 25; NaCl, 47,2; MgCl2(H2O)6, 0.1, (NH4) CO3, 0,5; HCl, 15,6; CaCl2(H2O)2, 0,075. Darüber hinaus enthalten die SGF Mucin vom Schwein Magen Typ II 2 g/L.
    2. Messen Sie den pH-Wert und pH 3 mit 1 M HCl, bei Bedarf anpassen. Inkubation bei 37 ° C und 100 Umdrehungen pro Minute. Sammeln Sie eine 2 mL Probe (S2).
  3. Kleiner Darm Verdauung:
    1. Fügen Sie 4 mL simulierten Darm Flüssigkeit (SIF) mit (in Mmol L-1): KCl, 6,8; KH2PO4, 0,8; Nahco33, 85; NaCl, 38,4; MgCl2(H2O)6, 0,33; HCl, 8,4; CaCl2(H2O)2, 0,3; zur Verdauung Röhre.
    2. Auf pH 7 mit 1 M NaOH bei Bedarf anpassen. Inkubation bei 37 ° C und 100 Umdrehungen pro Minute. Sammeln Sie eine 2 mL Probe (S3).

(6) bakterielle Besiedlung Fähigkeit nach In-vitro- Magen-Darm-Transit-Bedingungen

  1. Zentrifugieren Sie 2 mL der kleinen Darm Verdauung, für 10 min bei 2.650 X g.
  2. Entfernen des Überstands und die bakterielle Pellet mit 5 mL ergänzt DMEM ohne antibiotische und antimykotische mischen.
  3. Färben und intakt/beschädigte Zellen mit einem Durchflusszytometer zu quantifizieren (siehe Tabelle der Materialien), wie von Hernandez-Sanabria Et Al. beschrieben (2017) 11.
  4. Passen Sie die Zelldichte, 105 lebensfähige Zellen/mL durch Verdünnung in ergänzt DMEM ohne antibiotische und antimykotische.
  5. Entfernen Sie das apikale Medium des Transwell Systems und 1,5 mL der Bakteriensuspension. Das System für 2 h unter Allgemeine Zelle Kulturbedingungen (37 ° C, Luftfeuchtigkeit von 95 %, 5 % CO2) Co-Kultur.
    Hinweis: Dieses Mal erweiterbar bis zu 48 h, je nach experimentellen Protokoll erforderlich. Die kokultur pflegbar in einem anderen Inkubator als das für routinemäßige Zelle Wartung, um Kontaminationen zu vermeiden.
  6. Messen Sie die TEER-Werte nach der Inkubation, die Integrität der epithelialen Barriere zu bewerten, wie 4.11 beschrieben.
  7. Nach Abschluss der Inkubationszeit, apikale Medien zu entfernen, und 0,5 mL für weitere Analysen (S4) zu sammeln. Eine Teilstichprobe der Medien kann zur Beurteilung der Zellviabilität von Laktat-Dehydrogenase (LDH) Assay verwendet werden (siehe Tabelle der Materialien), den Anweisungen des Herstellers.
  8. Zugeben Sie 0,5 mL 10 mM N-Acetylcystein in HBSS (NAC-Puffer), den Schleim produziert von den HT29-MTX zu lösen und wieder eingehalten Bakterien. Die Platten bei 37 ° C für 1 h, unter Rühren inkubieren (135 u/min, siehe Tabelle of Materials).
  9. Wiederherstellen Sie der NAC-HBSS in einem Microcentrifuge Schlauch (S5) und waschen Sie zweimal die Zellen mit 1 mL DPBS.
  10. Geben Sie 0,5 mL 0,5 % Triton x-100 (w/V) auf der Oberseite der Monolayer stören die Zellen durch pipettieren, erholen sich die Flüssigkeit und Wirbel für 1 min. Geschwindigkeit entscheidend zur Vermeidung von Schäden die Bakterienzellen mit dem Reinigungsmittel ist.
  11. Zentrifugieren Sie die Zellen für 5 min bei 2.650 X gund trennen Sie der Überstand (S6) und das Pellet (S7).

7. die Probenanalyse

Hinweis: Analysieren Sie gesammelten Proben (S1-S7), bakterielle Lebensfähigkeit zu bewerten und Haftung für die Darmzellen, nach einer simulierten Magen-Darm-Verdauung.

  1. Bakterielle Lebensfähigkeit: S1-S5 Proben zweimal durch einen 0,45 µm übergeben und Bakterienzellen mit lebenden/Toten Zelle Färbung zu quantifizieren und flow Cytometry, wie in Schritt 2.811angegeben.
  2. Mögliche Haftung: bereiten Sie serielle Verdünnungen (-1 bis-8) für S1-S6 und Streifen 10 µL in BLUTAGAR und modifiziert BHI-Platten. Inkubation bei 37 ° C unter anaeroben Bedingungen für 24 – 48 h Platte die gleiche Menge an unverdünnt S7.
    1. Taxonomische Identifizierung von Bakterien eingehalten:
      1. Wählen Sie einzelne Kolonien mit einer Kultur-Schleife und Aufschwemmen Sie jeweils auf 10 µL Nuklease-freies Wasser. Sammeln Sie 4 µL dieser Suspension und verwenden Sie es als Vorlage für PCR-Amplifikation der 16 s rRNA-gen mit dem Primer und in 2.7.1 beschriebenen Bedingungen.
      2. Führen Sie durch Sequenzierung nach dem Protokoll 2.7.3 und Validierung der Sequenz mit dem Verfahren im 2.7.4 enthalten.
  3. Tun Weitere nachgelagerte Analyse wie total DNA-Extraktion, qPCR Quantifizierung und/oder 16 s rRNA Amplikons Sequenzierung, RNA-Extraktion und transkriptomischen profiling wie gewünscht.
    Hinweis: Flow Cytometry Quantifizierung erfolgte unmittelbar nach der Probenahme. Als Kontrolle für Membran-permeabilized Zellen diente eine Probe auf 70 ° C für 3 Minuten ausgesetzt. Hintergrundgeräusche wurde durch Messung mit Durchflusszytometrie, die Verdauung Flüssigkeiten oder Proben aus der Zelle-Kultur-Modell ohne Bakterien beurteilt. Jede Probe wurde in dreifacher Ausfertigung gemessen.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Dieses Protokoll führt zu der Generation von einem Modell geeignet für die Aufklärung, das Überleben und die Lebensfähigkeit der mundbakterien simulierten Magen-Darm-Transit Bedingungen unterworfen. Die Grafen von intakten Zellen aus einzelnen Stämme beträgt ca. 108 Zellen mL-1 vor der Gründung der synthetischen Gemeinschaft, während die bewirtschaftet Mikrokosmos enthalten über 90 % der lebensfähigen Zellen während der Einrichtung der Gemeinschaft ( Abbildung 1A und 1 b). Basierend auf der Live/Dead-Quantifizierung, sinkt bakterielle Rentabilität nach jedem Schritt der Verdauung (Abbildung 2). Dies ist ein Ergebnis der sauren pH-Wert während der Magen-Passage und die Salze der Gallensäure in den Dünndarm Verdauung Flüssigkeiten, wie Sie unter physiologischen Bedingungen enthalten. Lebensfähigkeit während des Transits durch in Vitro und in Vivo Magen-Darm-Verdauung kann auf Veränderungen in der Umwelt abhängen (z. B. gefüttert vs. fastete Bedingungen), oder sogar auf Bakterien Schutz Prozesse (Spore Bildung oder Magensaftresistente Beschichtung).

Flow durchflusszytometrischen zählt müssen mit geeigneten Steuerelemente, z. B. Hitze getötet Bakterien oder Hintergrund Proben durchzuführen genaue lebensfähigen Zelle Quantifizierung18verglichen werden. Die harten Bedingungen der Magen und Dünndarm Verdauung können Bakterien in lebensfähig aber nicht kultivierbarer Zellen sind lebende Bakterien, die nicht wachsen oder Teilen zu tun. Aus diesem Grund unterscheiden sich Platte Grafen von lebensfähigen zellenzahlen mit Durchflusszytometrie erhalten. Beispielsweise sind in Abbildung 3, lebensfähige Zellen erholte sich von der Schleimhaut Schnittstelle im Flow Cytometry Grundstück in blau gefärbt. Allerdings wurde kein Wachstum beobachtet als diesen Schleim Proben waren vergoldet (Ergebnisse nicht angezeigt).

Der Bruch auf dem Bakterien höhere Rentabilität zeigen ist die zelltrümmer (S7), Platte zählen (Abbildung 4) ergab. Die Anzahl der Kolonien kann variabel sein, aber metabolisch aktiven Bakterien findet sich in den weniger verdünnten Proben.

Figure 1
Abbildung 1: Zelle Lebensfähigkeit der Bakterien bewirtschaftet mikrobiellen Gemeinschaften zu Beginn der in-vitro- Magen-Darm-Verdauung zu komponieren. (A) lebensfähig Zellzahlen (logarithmische Einheiten) durch Leben/Tod-Färbung und Flow-zytometrie quantifiziert (Durchschnitt ± Standardabweichung, n = 3). (B) repräsentative Flow Cytometry Grundstück bewirtschaftet mikrobiellen Gemeinschaft nach 48 h Co Kultur. In grün, rot und schwarz vertreten lebensfähige, beschädigte und Hintergrund oder nicht klassifizierte Bakterien Punkte bzw.. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2: Handy-Lebensfähigkeit der Bakterien nach der simulierten Magen-Darm-Verdauung. Balken stehen für die Anzahl der lebensfähigen Zellen (logarithmische Einheiten) nach der oralen, Magen- und kleine Darm Verdauung-Schritten (Durchschnitt ± Standardabweichung, n = 3). Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 3
Abbildung 3: Repräsentative Grundstück von lebensfähigen bakteriellen Zellen in der Schleimhaut Interphase. Rote Punkte repräsentieren die Hintergrund und blaue Punkte der lebensfähigen Zellen. Flow Cytometry Bedingungen entstanden, basierend auf Requisiten Et al. (2016) 19. Schleimhaut Proben wurden verdünnt 1: 100 (V/V) gebeizt mit Sybr Green/Propidium Jodid für 15 min und 100 µL der Probe wurde an FL1 gemessen: 533/30 nm, FL2: 585/40 nm, FL3: > 670 nm langen Pass und FL4: 675/25 nm. Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 4
Abbildung 4: koloniebildenden Einheiten (KBE) gewachsen aus der zelltrümmer in geändert BHI Platten. Drei biologische Wiederholungen dienten für die bakterielle Adhäsion-Assay und drei technische repliziert wurden für die KBE-Quantifizierung durchgeführt. Zwei replizieren Platten mit-1 bis-6 Verdünnungen der Zelle Trümmer (S7) sind in der Abbildung gezeigt. Bitte klicken Sie hier für eine größere Version dieser Figur.

Zellkultur Anhänger / Suspension Kultivierung von Medium Allgemeine Ergänzungen Spezifische Ergänzungen Verdopplungszeit Inkubationsbedingungen
Caco-2 (ECACC 86010202) Anhänger Dulbeccos geändert Eagle Medium (DMEM) mit 4,5 g/L Glukose Inaktivierten fötalen Rinderserum (10 % V/V)
Penicillin (100 U/mL) *
Streptomycin (0,1 mg/mL) *
Amphotericin (0,0025 mg/mL) *
Glutamax (4 mM)
Nicht benötigten Aminosäuren (1 % V/V)
Pyruvat (1 mM)
65 – 72 h 95 % Luftfeuchtigkeit und 10 % CO2
CO2 -Inkubator (siehe Tabelle der Materialien)
HT29-MTX (ECACC 12040401) Anhänger HEPES (1 mM) 20 – 24 Uhr
* Antibiotika und Antimykotika wurden aus den Zellkulturmedien 2 Tage vor dem Start der Assays entfernt.

Tabelle 1: Beschreibung der Zelle Linien und Medien Zusammensetzung für die Zelle Kultur Wartung.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Die mündliche Microbiome ist ein zentrales Element in der menschlichen Gesundheit, wie kürzlich berichtet von mehreren Autoren20,21. Bisherigen Erkenntnisse deuten darauf hin, dass die Einnahme von Speichel, die große Belastungen des Bakteriums enthalten die mikrobiellen Ökosystems des Dünndarms, beeinflussen kann, ist einer der wichtigsten Standorte für immune Priming. Die Kombination eines statischen oberen Magen-Darm-Verdauung-Modells mit der Host-Schnittstelle, vertreten durch intestinale epitheliale und Schleim-sezernierenden Zellen diente, die Auswirkungen der mikrobielle Komponente auf dem Host zu entwirren.

In-vitro- Modelle sind grundlegende Werkzeuge für Forschung, mechanistische Studien und erreichen Hintergrundwissen zu verringern, soll ermöglichen eine effizientere und bessere Ziel in Vivo Studien machen. Aus diesem Grund ist es wichtig, Reinheit, Wirtschaftlichkeit und optimales Wachstum der axenic Kulturen vor der Gründung der synthetischen mikrobiellen Gemeinschaft sicherzustellen. Es wird empfohlen, Bewertung der Rentabilität und der Zusammensetzung der bakteriellen Gemeinschaften vor der Exposition gegenüber Zellkulturen, um Verzerrungen in der Analyse zu vermeiden. Hohe Anzahl von beschädigten Bakterien kann behindern die Adhäsion und weitere Auswirkungen auf die Integrität der zellenmodell. Darüber hinaus wird der Einsatz einer vertrauenswürdigen Quelle von Zelllinien Zelle Zeile Fehlidentifikationen, Verunreinigungen und schlechte Beschriftung, Verbesserung der experimentellen Reproduzierbarkeit22minimieren.

Schleim-produzierende Zellen einschließen können Ähnlichkeit in den Dünndarm, wie Schleim und Schleimstoffe die ersten Verteidigungslinie der Magen-Darm-Trakt23bieten. Darüber hinaus eignet sich die Darmschleimhaut für bakterielle Besiedlung, zulassend kennzeichnenden bilateralen Verkehr von bakteriellen Stoffwechselprodukten. Darüber hinaus erhöhen simulierte Magen-Darm-Bedingungen die Adhäsionsfähigkeit Lactobacillus Paracasei Stämme zu Caco-2 und Mucin24, die Bedeutung der Einbeziehung Verdauungsprozesse in unserem Modell zu unterstützen.

Weitere Verbesserungen im Modell können eingeführt werden, um die immun Host-Komponente, wie zuvor bewertete25zu integrieren. Allerdings haben kokultur Stromsysteme von epithelialen und immune Zellen nicht Host-Mikroben-Interaktion-Anwendungen (z. B. Bewertung von bioaktiven Verbindungen, die Nahrung oder Probiotika), benutzt wurde, die vermuten, dass diese Systeme fehlt Reproduzierbarkeit25.

Frühere Untersuchungen mit Caco-2, HT29-MTX oder Ko-Kulturen bewertet das Anhaften von probiotischen oder pathogenen Stämmen auf Säugerzellen26,27. Mit einzelnen Flecken oder Vereinigungen von einigen Mikroorganismen vorsehen eine begrenzte Übersicht auf der Host-Mikrobe Interaktionen, und es ist nicht repräsentativ für die Komplexität des menschlichen Magen-Darm-Trakt. Obwohl die Verwendung von natürlichen mikrobiellen Gemeinschaften repräsentativer für die in-Vivo -Szenario sein kann, sind sie schwer zu charakterisieren und zu studieren. Im Gegensatz dazu bietet unsere Methodik die Möglichkeit mehrere Host-Mikroben-Interaktionen, mit einer komplexen und repräsentativen Mikrokosmos zu bewerten. Die Verwendung einer definierten synthetischen mikrobiellen Gemeinschaft ermöglicht die Erstellung eines Systems mit reduzierter Komplexität28. Änderungen in der Gemeinschaft kann ein Ergebnis der microenvironmental Bedingungen im Rahmen der einzelnen Experimente. Somit kann die mikrobielle Komponente dieses Modells leicht nach oben oder unten skaliert werden für die Auswirkungen der Umwelt als selektive Kraft zu dekonstruieren. Schließlich garantiert Probenahme Zugänglichkeit weitere Charakterisierung der funktionellen Aktivitäten menschlicher Zellen und der damit verbundenen mikrobiellen Gemeinschaft.

In den letzten Jahren wurden neue in-vitro- Modelle basierend auf organoide Technologie entwickelt. Organellen sind 3D Zellkulturen, die einige der wichtigsten Merkmale des dargestellten primären Gewebes zu übernehmen. Obwohl Darm Organellen in der Nähe von physiologischen System für das Studium adulte Stammzellen und Gewebe sind, hat solches Modell auch einige Einschränkungen. Intestinale Organellen haben eingeschränkte Nutzung in ähnlich Entzündungsreaktionen zu Infektionen oder Medikamente, da sie die Immunzellen fehlen. Darüber hinaus sind Organellen hinsichtlich Tragfähigkeit, Größe und Form, behindern die Phänotyp Screening und rendering-Standardisierung komplexer heterogener. Trotz der Begrenzung des immortalisierte Zelllinien für in-vitro- Modellierung von gesundem Gewebe bietet der Einsatz von gut charakterisierten und stabilen Zelllinien auch Vorteile wie Wiederholbarkeit, Reproduzierbarkeit und niedrige Kosten. Diese Vorteile ermöglichen gleichzeitige Vorführung von mehreren Bedingungen, aber die translationale Verwendung der Daten ist umstritten. Primäre Zellen möglicherweise mehr Vertreter der in Vivo -Physiologie; aber sie haben hohe interindividuelle Variabilität, sind nicht vollständig charakterisiert sind heterogen und haben eine begrenzte Zeitspanne. Diese Faktoren sind ein Nachteil für die Aufnahme mehrerer Bedingungen oder in einem Assay repliziert.

Als Kombination von Zelllinien mit komplexer mikrobieller Gemeinschaften eine Herausforderung darstellen kann, konzentrierten wir uns auf die Entwicklung einer reproduzierbaren und wiederholbaren Modells mit hoher Flexibilität und Anwendbarkeit in Laboratorien mit Grundzelle Ausrüstung bis repräsentativer Modelle wurde zur Verfügung und gut geprägt. Wir haben die Funktionalität der verschiedenen bakteriellen Gemeinschaften mit diese multicompartment Modelle, zum Beispiel für die Bewertung von probiotischen Verhalten im oberen Magen-Darm-Trakt und kennzeichnenden XENOBIOTIKA Auswirkungen auf den Darm-Schnittstelle ausgewertet. Daher schlagen wir dieses Modell als Basis für weitere Tests mit einer Vielzahl von Probiotika, Medikamente oder Lebensmittel Verbindungen innerhalb eines Ökosystems relevant und definierten in Vitro .

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts preisgeben

Acknowledgments

Die Autoren erkennen dankbar finanziellen Unterstützung von Flandern Research Foundation, Marta Calatayud Arroyo (FWO postdoctoral Fellowship-12N2815N). Emma Hernandez-Sanabria ist postdoctoral Fellow von Flandern Innovation und Unternehmertum (Agentschap Voor Innovatie Tür vielen de Technologie, Binnenschifffahrt) unterstützt.

Materials

Name Company Catalog Number Comments
STRAINS
Aggregatibacter actinomycetemcomitans American Type Culture Collection ATCC 43718
Fusobacterium nucleatum American Type Culture Collection ATCC 10953
Porphyromonas gingivalis American Type Culture Collection ATCC 33277
Prevotella intermedia American Type Culture Collection ATCC 25611
Streptococcus mutans American Type Culture Collection ATCC 25175
Streptococcus sobrinus American Type Culture Collection ATCC 33478
Actinomyces viscosus American Type Culture Collection ATCC 15987
Streptococcus salivarius  TOVE-R
Streptococcus mitis American Type Culture Collection ATCC 49456
Streptococcus sanguinis BCCM/LMG Bacteria Collection LMG 14657
Veillonella parvula Leibniz Institute DSMZ-German Collection of Microorganisms and Cell Cultures DSM 2007
Streptococcus gordonii American Type Culture Collection ATCC 49818
CELL LINES
Caco-2 cells European Collection of Authenticated Cell Cultures 86010202
HT29-MTX cells European Collection of Authenticated Cell Cultures 12040401
REAGENTS AND CONSUMABLES
Brain Heart Infusion (BHI) broth Oxoid CM1135
Blood Agar 2 Oxoid CM0055 Blood Agar medium
Menadione Sigma M9429
Hemin Sigma H9039
5% sterile defibrinated horse blood E&O Laboratories Ltd, P030
InnuPREP PCRpure Kit Analytik Jena 845-KS-5010250 PCR purification kit
Big Dye Applied Biosystems 4337454 Dye for sequencing
ABI Prism BigDye Terminator v3.1 cycle sequencing kit Applied Biosystems 4337456
SYBR Green I Invitrogen S7585
Propidium Iodide Invitrogen P1304MP
T25 culture flasks uncoated, cell-culture treated, vented, sterile VWR 734-2311
Trypsin-EDTA solution Sigma-Aldrich T3924-100ML
Trypan Blue solution
0.4%, liquid, sterile-filtered
Sigma-Aldrich T8154 
PBS Gibco 14190250
DMEM cell culture media, with GlutaMAX and Pyruvate Life technologies 31966-047
Corning Transwell polyester membrane cell culture inserts Sigma-Aldrich CLS3450-24EA
Mucin from porcine stomach Type II   Sigma-Aldrich M2378
Inactivated fetal bovine serum Greiner Bio One 758093
Antibiotic-Antimycotic (100X) Gibco 15240062
Triton X 100 for molecular biology Sigma-Aldrich T8787 
DPBS without calcium, magnesium Gibco 14190-250
Pierce LDH Cytotoxicity Assay Kit Thermo Fisher Scientific 88953
Corning HTS Transwell-24 well, pore size 0.4 µm Corning Costar Corp 3450
Nuclease-free water Serva Electrophoresis 28539010
EQUIPMENT
Neubauer counting chamber improved Carl Roth T729.1
BD Accuri C6 Flow cytometer BD Biosciences 653118
PowerLyzer 24 Homogenizer MoBio 13155
T100 Thermal Cycler BioRad 186-1096
Flush system Custom made -
InnOva 4080 Incubator Shaker New Brunswick Scientific 8261-30-1007 Shaker for 2.10
Memmert CO2 incubator Memmert GmbH & Co. ICO150med
Millicell ERS (Electrical Resistance System) EMD Millipore, Merck KGaA MERS00002
Millipore Milli-Q academic, ultra pure water system Millipore, Merck KGaA -
Shaker (ROCKER 3D basic) IKA 4000000 Shaker for 6.10

DOWNLOAD MATERIALS LIST

References

  1. Sender, R., Fuchs, S., Milo, R. Revised estimates for the number of human and bacteria cells in the body. PLoS Biology. 14, e1002533 (2016).
  2. Kelly, D., King, T., Aminov, R. Importance of microbial colonization of the gut in early life to the development of immunity. Mutation Research-Fundamental and Molecular Mechanisms of Mutagenesis. 58-69 (2007).
  3. Aas, J. A., Paster, B. J., Stokes, L. N., Olsen, I., Dewhirst, F. E. Defining the normal bacterial flora of the oral cavity. Journal of Clinical Microbiology. 43, 5721-5732 (2005).
  4. Marsh, P. D., Head, D. A., Devine, D. A. Dental plaque as a biofilm and a microbial community-Implications for treatment. Journal of Oral Biosciences. 57, 185-191 (2015).
  5. Socransky, S. S., Haffajee, A. D., Cugini, M. A., Smith, C., Kent, R. L. Microbial complexes in subgingival plaque. Journal of Clinical Periodontology. 25, 134-144 (1998).
  6. Haffajee, A. D., et al. Subgingival microbiota in healthy, well-maintained elder and periodontitis subjects. Journal of Clinical Periodontology. 25, 346-353 (1998).
  7. Venema, K. Microbial metabolites produced by the colonic microbiota as drivers for immunomodulation in the host. The FASEB Journal. 27, (2013).
  8. Marzorati, M., et al. The HMI (TM) module: A new tool to study the Host-Microbiota Interaction in the human gastrointestinal tract in vitro. BMC Microbiology. 14, 133 (2014).
  9. Tanzer, J. M., Kurasz, A. B., Clive, J. Competitive displacement of mutans streptococci and inhibition of tooth-decay by Streptococcus-Salivarius Tove-R. Infection and Immunity. 48, 44-50 (1985).
  10. Slomka, V., et al. Nutritional stimulation of commensal oral bacteria suppresses pathogens: the prebiotic concept. Journal of Clinical Periodontology. 44, 344-352 (2017).
  11. Hernandez-Sanabria, E., et al. In vitro increased respiratory activity of selected oral bacteria may explain competitive and collaborative interactions in the oral microbiome. Frontiers in Cellular and Infection Microbiology. 7, 235 (2017).
  12. Alvarez, G., Gonzalez, M., Isabal, S., Blanc, V., Leon, R. Method to quantify live and dead cells in multi-species oral biofilm by real-time PCR with propidium monoazide. AMB Express. 3, (2013).
  13. Ehsani, E., et al. Initial evenness determines diversity and cell density dynamics in synthetic microbial ecosystems. Scientific Reports. 8, 340 (2018).
  14. Hernandez-Sanabria, E., et al. Correlation of particular bacterial PCR-denaturing gradient gel electrophoresis patterns with bovine ruminal fermentation parameters and feed efficiency traits. Applied and Environmental Microbiology. 76, 6338-6350 (2010).
  15. Masters, J. R., Stacey, G. N. Changing medium and passaging cell lines. Nature Protocols. 2, 2276-2284 (2007).
  16. Calatayud, M., Velez, D., Devesa, V. Metabolism of inorganic arsenic in intestinal epithelial cell lines. Chemical Research in Toxicology. 25, 2402-2411 (2012).
  17. Minekus, M., et al. A standardised static in vitro digestion method suitable for food - an international consensus. Food & Function. 5, 1113-1124 (2014).
  18. Berney, M., Hammes, F., Bosshard, F., Weilenmann, H. U., Egli, T. Assessment and interpretation of bacterial viability by using the LIVE/DEAD BacLight kit in combination with flow cytometry. Applied and Environmental Microbiology. 73, 3283-3290 (2007).
  19. Props, R., Monsieurs, P., Mysara, M., Clement, L., Boon, N. Measuring the biodiversity of microbial communities by flow cytometry. Methods in Ecology and Evolution. 7, 1376-1385 (2016).
  20. Yamashita, Y., Takeshita, T. The oral microbiome and human health. Journal of Oral Science. 59, 201-206 (2017).
  21. Wade, W. G. The oral microbiome in health and disease. Pharmacological Research. 69, 137-143 (2013).
  22. Yu, M., et al. A resource for cell line authentication, annotation and quality control. Nature. 520, 307 (2015).
  23. Pelaseyed, T., et al. The mucus and mucins of the goblet cells and enterocytes provide the first defense line of the gastrointestinal tract and interact with the immune system. Immunological Reviews. 260, 8-20 (2014).
  24. Bengoa, A. A., et al. Simulated gastrointestinal conditions increase adhesion ability of Lactobacillus paracasei strains isolated from kefir to Caco-2 cells and mucin. Food Research International. 103, 462-467 (2018).
  25. Kleiveland, C. R., et al. The Impact of Food Bioactives on Health: in vitro and ex vivo models. Verhoeckx, K., et al. Springer International Publishing. 197-205 (2015).
  26. Laparra, J. M., Sanz, Y. Comparison of in vitro models to study bacterial adhesion to the intestinal epithelium. Letters in Applied Microbiology. 49, 695-701 (2009).
  27. Gagnon, M., Berner, A. Z., Chervet, N., Chassard, C., Lacroix, C. Comparison of the Caco-2, HT-29 and the mucus-secreting HT29-MTX intestinal cell models to investigate Salmonella adhesion and invasion. Journal of Microbiological Methods. 94, 274-279 (2013).
  28. Großkopf, T., Soyer, O. S. Synthetic microbial communities. Current Opinion in Microbiology. 18, 72-77 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics