ट्यूमर के लिए Paramyxoviruses-लक्षित चुहियों: डिजाइन और मूल्यांकन पूर्व Vivo

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

इस प्रोटोकॉल immunomodulators की अभिव्यक्ति के लिए जनरेशन और oncolytic वायरस के पूर्व vivo लक्षण वर्णन के लिए एक विस्तृत कार्यप्रवाह का वर्णन, खसरा वायरस एंकोडिंग bispecific टी सेल engagers एक उदाहरण के रूप में का उपयोग कर । अन्य वेक्टर प्लेटफार्मों और transgenes के लिए आवेदन और अनुकूलन नैदानिक अनुवाद के लिए उपंयास immunovirotherapeutics के विकास में तेजी लाने के लिए होगा ।

Cite this Article

Copy Citation | Download Citations

Heidbuechel, J. P., Engeland, C. E. Paramyxoviruses for Tumor-targeted Immunomodulation: Design and Evaluation Ex Vivo. J. Vis. Exp. (143), e58651, doi:10.3791/58651 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

सफल कैंसर immunotherapy के लिए दीर्घकालिक ट्यूमर नियंत्रण प्राप्त करने की क्षमता है । हाल ही में नैदानिक सफलताओं के बावजूद, वहां सुरक्षित और प्रभावी व्यक्तिगत ट्यूमर प्रतिरक्षा प्रोफाइल के अनुरूप चिकित्सा के लिए एक तत्काल जरूरत बनी हुई है । Oncolytic वायरस विरोधी ट्यूमर प्रतिरक्षा प्रतिक्रियाओं के साथ ही ट्यूमर प्रतिबंधित जीन अभिव्यक्ति की प्रेरण सक्षम । इस प्रोटोकॉल पीढ़ी और इम्यूनोमॉड्यूलेटरी oncolytic वैक्टर के पूर्व vivo विश्लेषण का वर्णन है । खसरा वैक्सीन वायरस एंकोडिंग bispecific टी सेल engagers पर ध्यान केंद्रित एक उदाहरण के रूप में, सामांय पद्धति अंय वायरस प्रजातियों और transgenes के लिए अनुकूलित किया जा सकता है । प्रस्तुत कार्यप्रवाह डिजाइन, क्लोनिंग, बचाव, और रिकॉमबिनेंट वायरस के प्रसार में शामिल हैं । परख की प्रतिकृति कैनेटीक्स और lytic गतिविधि का विश्लेषण करने के लिए वेक्टर के रूप में अच्छी तरह के रूप में अलग immunomodulator पूर्व vivo की कार्यक्षमता शामिल हैं, इस प्रकार और अधिक विकास के लिए नैदानिक मॉडल में उपंयास एजेंटों की पीढ़ी की सुविधा अंततः नैदानिक अनुवाद ।

Introduction

Oncolytic वायरस (OVs) विरोधी कैंसर चिकित्सकीय के रूप में विकसित किया जा रहा है कि विशेष रूप से भीतर की नकल और स्वस्थ ऊतकों को छोड़ जबकि ट्यूमर कोशिकाओं को मार डालो । यह अब आम समझ है कि oncolytic virotherapy (OVT), ज्यादातर मामलों में, कुशल प्रतिकृति और वायरस के प्रसार के द्वारा पूरा ट्यूमर lysis पर पूरी तरह भरोसा नहीं है, लेकिन उपचार की सफलता के लिए कार्रवाई के अतिरिक्त तंत्र की आवश्यकता है, सहित संवहनी और stromal लक्ष्यीकरण और, महत्वपूर्ण बात, प्रतिरक्षा उत्तेजना1,2,3,4। जबकि कई जल्दी OV अध्ययन unmodified वायरस का इस्तेमाल किया, वर्तमान अनुसंधान एक बेहतर जैविक समझ से लाभ हुआ है, वायरस जैव कि संभावित उपंयास OVs होते हैं, और आनुवंशिक इंजीनियरिंग द्वारा की पेशकश की संभावनाओं को उंनत OV बनाने के लिए 5,6,7प्लेटफार्मों ।

immunotherapy की हालिया सफलता को देखते हुए, इम्यूनोमॉड्यूलेटरी transgenes OVs की जेनेटिक इंजीनियरिंग के संबंध में विशेष रुचि के हैं OV-संक्रमित ट्यूमर कोशिकाओं द्वारा ऐसे जीन उत्पादों की लक्षित अभिव्यक्ति प्रणालीगत प्रशासन की तुलना में विषाक्तता को कम कर देता है । लक्ष्यीकरण या तो अंतर्निहित oncoselectivity के साथ वायरस का उपयोग करके या वायरल tropism8को संशोधित करके हासिल की है । स्थानीय चुहियों OVT के बहुआयामी विरोधी ट्यूमर तंत्र को बढ़ाता है । इसके अलावा, इस रणनीति वायरस, ट्यूमर कोशिकाओं, और मेजबान प्रतिरक्षा प्रणाली के बीच एक साथ खेलना पूछताछ में महत्वपूर्ण भूमिका निभाई है । इस अंत करने के लिए, इस प्रोटोकॉल एक लागू और समायोज्य कार्यप्रवाह डिजाइन प्रदान करता है, क्लोन, बचाव, प्रचार, और oncolytic paramyxovirus (विशेष रूप से खसरा वायरस) ऐसे transgenes एंकोडिंग वैक्टर मांय ।

प्रतिरक्षा प्रतिक्रिया का मॉडुलन transgene कैंसर के विभिंन चरणों को लक्षित उत्पादों की एक विस्तृत विविधता से प्राप्त किया जा सकता है-प्रतिरक्षा चक्र9, बढ़ाने ट्यूमर प्रतिजन मांयता सहित [जैसे, ट्यूमर से जुड़े एंटीजन (ताळा) या के उत्प्रेरण प्रमुख histocompatibility जटिल (MHC) वर्ग मैं अणु] कुशल प्रतिजन प्रस्तुति (साइटोकिंस) के लिए वृक्ष सेल परिपक्वता पर समर्थन; भर्ती और साइटोटोक्सिक और हेल्पर टी कोशिकाओं जैसे वांछित प्रतिरक्षा कोशिकाओं को सक्रिय [chemokines, bispecific टी सेल engagers (BTEs)]; इस तरह के नियामक टी कोशिकाओं, माइलॉयड-व्युत्पंन दमन कोशिकाओं, ट्यूमर से जुड़े मैक्रोफेज, और कैंसर से जुड़े fibroblasts (एंटीबॉडी, BTEs, साइटोकिंस) के रूप में दमन कोशिकाओं लक्ष्यीकरण; और प्रभाव सेल अवरोध और थकावट (चौकी अवरोधकों) को रोकने. इस प्रकार, जैविक एजेंटों की एक बहुतायत उपलब्ध है । ऐसे वायरस के मूल्यांकन-इनकोडिंग immunomodulators चिकित्सीय प्रभावकारिता और संभव तालमेल के बारे में के रूप में अच्छी तरह से संबंधित तंत्र की समझ के बारे में कैंसर थेरेपी में सुधार करने के लिए आवश्यक है ।

नकारात्मक भावना Paramyxoviridae परिवार के एकल असहाय आरएनए वायरस oncolytic वैक्टर के रूप में उनके उपयोग के लिए अनुकूल कई सुविधाओं की विशेषता है । ये एक प्राकृतिक oncotropism, transgenes के लिए बड़ी जीनोमिक क्षमता (5 kb से अधिक)10,11, syncytia गठन सहित कुशल प्रसार, और उच्च immunogenicity12शामिल हैं । इसलिए, OV प्लेटफार्मों पर आधारित कुत्ते temper वायरस13, कण्ठमाला वायरस14, न्यूकैसल रोग वायरस15, सेंडाइ वायरस16,17, simian वायरस 518, और Tupaia paramyxovirus19 विकसित किए गए हैं । सबसे प्रमुखता से, लाइव तनु खसरा वायरस वैक्सीन उपभेदों (एमवी) नैदानिक और नैदानिक विकास में प्रगति की है20,21। इन वायरस उपभेदों एक उत्कृष्ट सुरक्षा रिकॉर्ड22के साथ नियमित प्रतिरक्षण के लिए दशकों के लिए इस्तेमाल किया गया है । इसके अलावा, paramyxoviruses की कड़ाई से cytosolic प्रतिकृति के कारण mutagenesis के लिए कोई जोखिम नहीं है । एक बहुमुखी रिवर्स आनुवंशिकी विरोधी जीनोमिक सीडीएनए जो अतिरिक्त प्रतिलेखन इकाइयों (ATUs) में transgenes के सम्मिलन के लिए अनुमति देता है पर आधारित प्रणाली11,23,24उपलब्ध है । MV वेक्टर्स एंकोडिंग सोडियम-आयोडाइड symporter (एमवी-एनआईएस) इमेजिंग और रेडियोथेरेपी या घुलनशील carcinoembryonic प्रतिजन के लिए (एमवी-सीईए) वायरल जीन अभिव्यक्ति के लिए एक किराए मार्कर के रूप में वर्तमान में नैदानिक परीक्षणों में मूल्यांकन किया जा रहा है (NCT02962167, NCT02068794, NCT02192775, NCT01846091, NCT02364713, NCT00450814, NCT02700230, NCT03456908, NCT00408590, और NCT00408590) । सुरक्षित प्रशासन की पुष्टि की गई है और विरोधी के मामलों ट्यूमर प्रभावकारिता पिछले अध्ययन में सूचित किया गया है25,26,27,28,29, 30 (Msaouelटी al.31द्वारा समीक्षित), अतिरिक्त oncolytic खसरा वायरस है कि विकसित किया गया है और नैदानिक परीक्षण के लिए जिस तरह फ़र्श । एमवी एंकोडिंग इम्यूनोमॉड्यूलेटरी कैंसर के विविध चरणों को लक्षित अणुओं-उन्मुक्ति चक्र को ट्यूमर के विकास में देरी और/या चूहों में अस्तित्व को लम्बा, प्रतिरक्षा की मध्यस्थता प्रभावकारिता और syngeneic में दीर्घकालिक सुरक्षात्मक प्रतिरक्षा स्मृति के लिए सबूत के साथ दिखाया गया है माउस मॉडल । वेक्टर-एनकोडेड transgenes में शामिल है granulocyte-मैक्रोफेज कॉलोनी उत्तेजक फैक्टर (जीएम-सीएसएफ)३२,३३, H. हेलिकोबेक्टर न्युट्रोफिल-सक्रिय प्रोटीन३४, प्रतिरक्षा चौकी अवरोधकों३५, interleukin-12 (IL-12)३६, ताळा३७, और BTEs३८, जो पार-CD3 के साथ एक ट्यूमर सतह प्रतिजन लिंक और इस तरह polyclonal टी कोशिकाओं द्वारा विरोधी ट्यूमर गतिविधि पैदा, टी सेल रिसेप्टर विशिष्टता और सह उत्तेजना के बावजूद ( चित्रा 1) । इन निर्माणों के लिए प्राप्त होनहार नैदानिक परिणाम आगे शोधों के प्रयासों की मांग करते हैं ।

Talimogene laherparepvec (T-VEC), एक प्रकार की मैं दाद सिंप्लेक्स वायरस एंकोडिंग जीएम-सीएसएफ, केवल oncolytic संयुक्त राज्य अमेरिका खाद्य और औषधि प्रशासन (एफडीए) और यूरोपीय दवाओं एजेंसी (EMA) द्वारा अनुमोदित चिकित्सीय है । देर से २०१५ में अनुमोदन के लिए अग्रणी चरण III अध्ययन अंतर ट्यूमर इंजेक्शन के स्थल पर ही नहीं दिखाया गया है, लेकिन यह भी abscopal प्रभाव (यानी, गैर इंजेक्शन घावों की छूट) उन्नत मेलेनोमा३९में. T-VEC के बाद से अंय ट्यूमर संस्थाओं में आवेदन के लिए अतिरिक्त परीक्षण में प्रवेश किया है (जैसे, गैर मेलेनोमा त्वचा कैंसर, NCT03458117; अग्नाशय के कैंसर, NCT03086642) और संयोजन चिकित्सा के मूल्यांकन के लिए, विशेष रूप से प्रतिरक्षा चौकी के साथ अवरोधकों (NCT02978625, NCT03256344, NCT02509507, NCT02263508, NCT02965716, NCT02626000, NCT03069378, NCT01740297, और Ribasटी al.४०) ।

यह न केवल oncolytic immunotherapy की क्षमता को दर्शाता है, लेकिन यह भी आगे अनुसंधान के लिए की जरूरत है OVT और चुहियों के बेहतर संयोजन की पहचान । अतिरिक्त वैक्टर और नैदानिक परीक्षण के लिए उनके विकास के तर्कसंगत डिजाइन इस उपक्रम के लिए महत्वपूर्ण है । यह भी अंतर्निहित तंत्र की समझ अग्रिम जाएगा और अधिक व्यक्तिगत कैंसर के इलाज की दिशा में प्रगति के लिए निहितार्थ है । इस अंत करने के लिए, इस प्रकाशन के संशोधन और लक्षित कैंसर immunotherapy के लिए paramyxoviruses के विकास के लिए पद्धति प्रस्तुत करता है और, और अधिक विशेष रूप से, oncolytic खसरा वायरस टी सेल-आकर्षक एंटीबॉडी (चित्रा 2) एंकोडिंग के ।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

नोट: [O], [P], और [M] में लागू होने वाले उपधाराओं का संकेत देते हैं: सामांय में OVs, (अधिकांश) paramyxoviruses, या केवल एमवी, क्रमशः । [B] BTE transgenes के लिए विशिष्ट अनुभागों को इंगित करता है ।

1 Immunomodulator की क्लोनिंग-खसरा वायरस वैक्टर में Transgenes एंकोडिंग

  1. [ओ] डिजाइन संमिलित अनुक्रम ।
    1. [O] साहित्य अनुसंधान के आधार पर ब्याज की एक immunomodulator पर या आनुवंशिक स्क्रीन४१ जैसे खोजपूर्ण डेटा पर निर्णय और उचित डेटाबेस से प्रासंगिक सीडीएनए अनुक्रम प्राप्त जैसे GenBank, यूरोपीय न्यूक्लियोटाइड संग्रह, या अंतर्राष्ट्रीय ImMunoGeneTics सूचना प्रणाली (IMGT) ।
    2. [ओ] transgene अनुक्रम (चित्रा 3) के लिए अतिरिक्त सुविधाओं को जोड़ें । एक पूर्ववर्ती श्मिट अनुक्रम और प्रजातियों-विशिष्ट codon अनुकूलन अभिव्यक्ति में वृद्धि कर सकते हैं । संकेत अनुक्रम स्राव के लिए आवश्यक हैं । पता लगाने और४२शुद्धि के लिए N-और/या C-टर्मिनल प्रोटीन टैग एंकोडिंग अनुक्रम शामिल हैं । में प्रवेश के लिए प्रतिबंध साइटों को शामिल करें वेक्टर ।
      नोट: [एम] अतिरिक्त प्रतिलेखन इकाइयों (ATUs) mv पोलीमरेज़ जीन शुरू और बंद संकेतों रिकॉमबिनेंट एमवी जीनोम से transgene अभिव्यक्ति के लिए आवश्यक हैं । उपयुक्त विरोधी जीनोमिक सीडीएनए वैक्टर, सीएमवी प्रवर्तकों द्वारा नियंत्रित और निर्धारित पदों पर सकारात्मक भावना transgenes की शुरूआत के लिए अद्वितीय प्रतिबंध साइटों के साथ ATUs युक्त, पहले11विकसित किया गया है । [पी] transgene की पर्याप्त स्थिति महत्वपूर्ण है, क्योंकि यह वायरल प्रतिकृति और अभिव्यक्ति transgene paramyxoviruses४३के लिए विशिष्ट ढाल के कारण अभिव्यक्ति को प्रभावित करता है । एक ातु में परिचय विरोधी के ' 3 अंत जीनोम के करीब (यानी, नेता की स्थिति या पी जीन के बहाव में) आम तौर पर उच्च transgene अभिव्यक्ति में कम वायरल प्रतिकृति की लागत पर परिणाम । वृद्धि की पुनरावृत्ति और transgene अभिव्यक्ति के निचले स्तर की उंमीद की जा सकती है जब एच जीन के ातु बहाव का उपयोग कर । कई paramyxoviruses के जीनोम की पैकेजिंग, खसरा वायरस सहित, प्रत्येक nucleocapsid४४प्रोटीन द्वारा छह न्यूक्लियोटाइड के बंधन की आवश्यकता है । ऐसे वायरस में transgenes के सम्मिलन के लिए, सुनिश्चित करें कि पूर्ण जीनोम के न्यूक्लियोटाइड की संख्या छह से विभाज्य हो जाएगा. यह भी "के रूप में छह के नियम"४५,४६कहा जाता है । यदि आवश्यक हो, फ्रेम पाली या समय से पहले बंद codons शुरू करने के बिना डालने (श्मिट अनुक्रम या स्टॉप codon के बहाव के ऊपर) में अतिरिक्त न्यूक्लियोटाइड शामिल हैं । [M] transgene में विशेष दृश्यों से बचें जो एमवी जीन स्टार्ट (AGGRNCMARGW) और स्टॉप (RTTAWANAAAA) संकेतों और आरएनए एडिटिंग सीक्वेंस (AAAAAGGG) के समान हैं । इस तरह के आम सहमति दृश्यों प्रकाशित किया गया है (जैसे, देखें पार्क एट अल.४७) ।
    3. [O] वांछित अनुक्रम की खरीद oligonucleotide या मानक आणविक क्लोनिंग४८का उपयोग कर उपलब्ध दृश्यों से इकट्ठा ।
      नोट: [ओ] transgene के पीसीआर प्रवर्धन के लिए, ऊपर प्रतिबंध साइट और डालने के पहले 15-20 न्यूक्लियोटाइड और बहाव के प्रतिबंध के बाद डालने के अंतिम 15-20 न्यूक्लियोटाइड सहित एक रिवर्स प्राइमर सहित एक आगे प्राइमर डिजाइन साइट.
  2. [हे] वायरल (विरोधी) जीनोम एंकोडिंग डीएनए में क्लोन डालें ।
    1. [हे] क्लोन डीएनए वैक्टर या डीएनए विरोधी में डालने-आरएनए वायरस के जीनोम मानक आणविक क्लोनिंग तकनीक द्वारा४८ (यानी, एंजाइमी प्रतिबंध डीएनए बंधाव द्वारा पीछा किया) ।
      1. [O] गैर-संगत प्रतिबंध साइटों का उपयोग करके या बंधाव करने से पहले de-फास्फारिलीकरण द्वारा वेक्टर का re-बंधाव रोकें ।
      2. [ओ] agarose जेल ट्रो द्वारा बंधाव उत्पाद को अलग और बाद में जेल शुद्धि व्यावसायिक रूप से उपलब्ध किट का उपयोग कर । सामान्य में, इष्टतम बंधाव दक्षता सदिश के लिए सम्मिलित की एक 3:1 दाढ़ अनुपात में हासिल की है.
    2. [ओ] सक्षम जीवाणुओं में बंधाव उत्पाद रूपांतरण बड़े plasmids के कुशल वसूली के लिए उपयुक्त (यानी, ई. कोलाई४९की गर्मी सदमे प्रदर्शन) और बैक्टीरियल की पहचान करने के लिए सही डीएनए बंदरगाह के पास पीसीआर५० .
    3. [O] व्यावसायिक रूप से उपलब्ध डीएनए तैयारी किट का उपयोग करके एक ही जीवाणु क्लोन से परिवर्धित डीएनए को अलग करते हैं । उचित प्रतिबंध एंजाइमों के साथ नियंत्रण डाइजेस्ट द्वारा जीनोमिक अखंडता की पुष्टि करें (जैसे, एमवी जीनोम के लिए HindIII [एम]). अनुक्रमण द्वारा transgene की सही प्रविष्टि और अखंडता की पुष्टि करें ।
      नोट: [एम] एमवी एच-ातु में डाला transgenes के लिए, निम्नलिखित प्राइमरों के साथ सैंज अनुक्रमण प्रदर्शन: एच-९०१८ [आगे प्राइमर, एच ओपन रीडिंग फ्रेम (ओआरएफ) में एमवी जीनोम स्थिति ९०१८ को बांधता है]: 5 ' GTGTGCTTGCGGACTCAGAATC 3 '; एल-9249 + (रिवर्स प्राइमर, एल ओआरएफ में एमवी जीनोम स्थिति ९२४९ को बांध): 5 ' CAGATAGCGAGTCCATAACGG 3 ' ।

2. बचाव रिकॉमबिनेंट खसरा वायरस के कणों एंकोडिंग Immunomodulators

  1. [ओ] रिकॉमबिनेंट वायरस कणों से उत्पन्न (विरोधी) जीनोमिक डीएनए के माध्यम से अभिकर्मक वायरस निर्माता कोशिकाओं के लिए संबंधित वायरस के लिए मानक प्रोटोकॉल के अनुसार. बाँझ शर्तों के तहत काम करने के लिए दिशा निर्देशों का पालन करें । हुड के तहत सेल संस्कृति प्रदर्शन, विशेष रूप से सभी वर्ग द्वितीय जैविक सुरक्षा अलमारियां में वायरस को शामिल कदम ।
    1. सीडीएनए23,24, प्लेट एमवी निर्माता (अफ्रीकी ग्रीन बंदर गुर्दे व्युत्पंन वीरो) से खसरा वायरस के बचाव के लिए [एम] समान रूप से अभिकर्मक से पहले एक 6-अच्छी प्लेट 24 एच पर कोशिकाओं । 2 मिलीलीटर Dulbecco के संशोधित ईगल के मध्यम (DMEM) में बीज 2 x 105 कोशिकाओं को अच्छी तरह से प्रति 10% भ्रूण गोजातीय सीरम (FBS) युक्त 65-75% अभिकर्मक के समय में प्रवाह को प्राप्त करने के लिए ।
      नोट: [P] कोशिकाओं वायरस प्रेरित syncytia गठन से पहले तबदील हो तो कक्ष संख्या कम करें ।
    2. [पी] Transfect डीएनए के साथ कोशिकाओं वायरल विरोधी जीनोम, आवश्यक सहायक plasmids कूटबंधन, और, यदि वांछित, एक प्लाज्मिड एक फ्लोरोसेंट रिपोर्टर एंकोडिंग अभिकर्मक दक्षता का आकलन करें ।
      1. [एम] मिश्रण खसरा वायरस विरोधी जीनोम, ५०० स्तनधारी अभिव्यक्ति के प्रत्येक एनजी plasmids रिकॉमबिनेंट डीएनए एंकोडिंग के 5 µ जी खसरा विषाणु एन और एल प्रोटीन, और १०० plasmids एंकोडिंग पी प्रोटीन और २०० µ एल DMEM की कुल मात्रा में एक फ्लोरोसेंट रिपोर्टर के प्रत्येक एनजी ।
      2. liposomal अभिकर्मक रिएजेंट के १८.६ µ एल जोड़ें, तुरंत ट्यूब झाड़ने से मिश्रण, और कमरे के तापमान (आरटी) में 25 मिनट के लिए मशीन ।
      3. [पी] DMEM के १.८ मिलीलीटर, 2% FBS, ५० µ जी/एमएल कनमीसिन (या अन्य एंटीबायोटिक दवाओं के साथ मध्यम बदलें) प्रति अच्छी तरह से, तो अभिकर्मक मिश्रण dropwise को अच्छी तरह से और भंवर ध्यान से जोड़ें । ३७ ° c, 5% सह2पर रात भर कोशिकाओं गर्मी । मध्यम बदलें ताजा DMEM, 2% FBS, और ५० µ जी/एमएल कनमीसिन अगले दिन के 2 मिलीलीटर के साथ; जब मध्यम अंलीय हो जाता है यह दोहराएं ।
        सावधानी: [ओ] अभिकर्मक से निंनलिखित चरणों के माध्यम से, के रूप में वायरस उपस्थित हो सकता है के रूप में, सुरक्षा नियमों के अनुसार कोशिकाओं और सामग्री संभाल । के निपटान (संभावित) संक्रामक अपशिष्ट उचित ।
  2. [पी] लीजिए और वायरस के कणों का प्रचार ।
    1. [पी] रिपोर्टर जीन अभिव्यक्ति और syncytia गठन (चित्रा 4) के लिए सूक्ष्म द्वारा दैनिक कोशिकाओं का निरीक्षण । हार्वेस्ट वायरस जब बड़े syncytia, 20 या अधिक कोशिकाओं से मिलकर, दिखाई दे रहे हैं, या जब कोशिकाओं को भी घने हो (यानी, जब वे कई परतों में विकसित करने के लिए शुरू, आमतौर पर 7 के बाद-9 दिन).
      नोट: [P] यदि कोई syncytia एक दिया वेक्टर के निर्माण के लिए मनाया जाता है, यह जरूरी नहीं कि बचाव में विफल रहा है मतलब नहीं है । के रूप में संक्रामक वायरस फिर भी नमूने में मौजूद हो सकता है, passaging के लिए ताजा निर्माता कोशिकाओं को हस्तांतरण ।
    2. [पी] बीज लगभग १.५ x 10 10% FBS के साथ DMEM के 12 मिलीलीटर में6 निर्माता कोशिकाओं, 10 सेमी व्यंजन पर प्रत्याशित फसल, या २.५ x 10 थाली प्रति6 कोशिकाओं से पहले 24 ज 4-6 एच वायरस के passaging करने के लिए पहले वायरस के समय में 65-75% प्रवाह को प्राप्त करने के लिए inoculat आयन.
    3. [पी] वायरस संतति एकत्र करने के लिए, ध्यान से थाली से अनुयाई निर्माता कोशिकाओं परिमार्जन एक सेल खुरचनी का उपयोग कर और एक केंद्रापसारक ट्यूब में कोशिकाओं से युक्त supernatant हस्तांतरण । २,५०० x g और 4 डिग्री सेल्सियस पर 5 मिनट के लिए केंद्रापसारक द्वारा सेल मलबे निकालें ।
      नोट: स्क्रैप की कोशिकाओं को उपइष्टतम संस्कृति की स्थिति और संभावित सूक्ष्म कलाकृतियों की कीमत पर वायरस carryover को अधिकतम करने के लिए केंद्रापसारक के बिना सीधे स्थानांतरित किया जा सकता है ।
      चेतावनी: [हे] जब कोशिकाओं स्क्रैप मीडिया फैल से बचें । एयरोसोल गठन को कम करें ।
    4. [P] 4 मिलीलीटर की एक अंतिम मात्रा के लिए सीरम मुक्त माध्यम के साथ कदम 2.2.3 से सेल मुक्त supernatant मिश्रण से इनोक्युलम तैयार करते हैं । इनोक्युलम द्वारा उत्पादक कोशिकाओं पर माध्यम की जगह और ३७ डिग्री सेल्सियस और 5% सह2पर कम 2 घंटे के लिए गर्मी कोशिकाओं । 10% FBS के साथ DMEM के 6 मिलीलीटर जोड़ें और 10% FBS के साथ ताजा DMEM के 12 मिलीलीटर के माध्यम बदलने से पहले रात भर कोशिकाओं गर्मी ।
    5. [पी] syncytia फट (यानी, जब झिल्ली व्यवधान दिखाई हो जाता है) से पहले कम से कम दो बार दैनिक और फसल वायरस कोशिकाओं का निरीक्षणकरें । वायरस के पहले पारित होने की फसल के लिए, प्लेट से supernatant निकालें, सीरम मुक्त माध्यम के ६०० µ एल जोड़ने के लिए, एक सेल लिफ्टर के साथ कोशिकाओं परिमार्जन, और एक साफ ट्यूब के लिए स्थानांतरण ।
      नोट: [एम] वायरस तनाव५१,५२ और संक्रमण की प्रगति के आधार पर, वायरल प्रतिकृति और प्रसार की सुविधा के लिए ३२ ° c के लिए संक्रमित कोशिकाओं के साथ प्लेट स्थानांतरण । सामान्य में, एमवी Schwarz उपभेदों ३७ डिग्री सेल्सियस पर अच्छी तरह से प्रचार, जबकि Edmonston बी तनाव वायरस से संक्रमित कोशिकाओं के हस्तांतरण के लिए ३२ ° c परिणाम धीमी syncytia गठन लेकिन उच्च titers.
      नोट: [पी] सेल परत फसल के दौरान शुष्क करने की अनुमति नहीं है, के रूप में इस वायरल कणों की कम infectivity में परिणाम होगा । हालांकि कुछ वायरस संक्रमित कोशिकाओं के supernatant को खारिज करते समय खो जाते हैं, उच्च titers कोशिका परत से प्राप्त किया जा सकता है ।
    6. [पी] तुरंत तरल नाइट्रोजन में वायरस निलंबन फ्रीज । पर स्टोर-८० ° c के लिए ंयूनतम 24 h पूरी तरह से ठंड सुनिश्चित करने के लिए । यदि आवश्यक हो, तो कार्यविधि को बाधित करने के लिए कई दिनों तक विस्तारित करें ।
    7. ३७ डिग्री सेल्सियस पर गल द्वारा वायरल कणों रिलीज । Homogenize द्वारा भंवर, और २,५०० x g और 4 डिग्री सेल्सियस पर 5 मिनट के लिए केंद्रापसारक । supernatants को लेबल cryotubes और स्टोर पर-८० ° c में स्थानांतरित करें ।
      नोट: [ओ] aliquot आकार में वायरस की दुकान बाद में प्रयोगों के लिए पर्याप्त है, क्योंकि वे तरजीही रूप से केवल एक बार गल रहे है और तुरंत इस्तेमाल किया । [पी] आगे रुक-गल चक्र या भंडारण पर 4 ° c कई दिनों में वायरल titers की उल्लेखनीय कमी में परिणाम ।
    8. [P] एक दिन पहले आगे passaging के लिए आवश्यक राशि और titer प्राप्त करने के लिए, बीज 4 x 106 DMEM के 12 मिलीलीटर में उत्पादक कोशिकाओं 15 सेमी व्यंजन पर 10% FBS के साथ । ०.०३ के संक्रमण (MOI) की बहुलता पर वायरस के साथ Inoculate । प्लेट प्रति सीरम मुक्त माध्यम के 8 मिलीलीटर में संक्रमित और परिवर्तन मध्यम से DMEM करने के लिए 10% FBS के लिए कोशिकाओं की मशीनिंग के बाद एक से अधिक प्लेटों का उपयोग करके कम 2 ज. स्केल ।
    9. चरण 2.2.5 में वर्णित फसल, जब syncytia पूरे सेल परत भर में फैल गया है । पूल ५० मिलीलीटर ट्यूबों और प्रक्रिया में प्राप्त निलंबन के रूप में कदम 2.2.6 – 2.2.7 में वर्णित है ।
      नोट: [ओ] यह फसल कटाई से पहले बैक्टीरियल और फंगल संक्रमण के लिए नेत्रहीन सभी प्लेटों की जांच करने के लिए महत्वपूर्ण है । सामान्य रूप से, मल्टीप्लेक्स पीसीआर द्वारा माइकोप्लाज्मा या आकस्मिक वायरस के साथ संदूषण के लिए नियमित रूप से सभी सेल लाइनों की जांच करें ।
  3. [पी] यूज्ड वायरल titers । ९६-अच्छी तरह से प्लेटों का उपयोग aliquot प्रति octuplicates में वायरस शेयरों की titers निर्धारित करें । प्रति वायरस बचाव तीन व्यक्तिगत aliquots के अनुमापन प्रदर्शन और प्रयोगों में इस्तेमाल किया जा करने के लिए वायरस निलंबन की मात्रा की गणना करने के लिए औसत मूल्य का उपयोग करें ।
    1. [पी] निर्माता कोशिकाओं पूल, गिनती, और समायोजित करने के लिए १.५ x 10 10% FBS के साथ DMEM में एमएल प्रति5 कोशिकाओं ।
    2. [पी] प्लास्टिक ९० µ एल DMEM 10% FBS के साथ एक अच्छी तरह से थाली के प्रत्येक कुआं में ।
    3. [P] वायरस स्टॉक के एक aliquot से 10 µ l को प्लेट के पहले कॉलम में सभी 8 कुओं में डालें और कम से ऊपर और नीचे से pipetting करके अच्छी तरह से 10 बार मिलाएं ।
    4. [पी] सीरियल 10-गुना वायरस के कमजोर पड़ने का प्रदर्शन । एक मल्टीचैनल प्लास्टिक का उपयोग कर दूसरे कॉलम के लिए पहले से प्रत्येक कुआं के 10 µ एल स्थानांतरण । ऊपर और नीचे pipetting और प्रत्येक कमजोर पड़ने वाले कदम के लिए ताजा प्लास्टिक सुझावों का उपयोग करके अच्छी तरह से मिलाएं । अंतिम स्तंभ के प्रत्येक कुआं से 10 µ l को छोड़ें.
      नोट: प्रत्येक ९६-खैर प्लेट 12 सीरियल कमजोर पड़ने कदम के लिए अनुमति देता है । [एम] एमवी वैक्टर के लिए, 10 गुना कमजोर पड़ने के 8 कदम आम तौर पर पर्याप्त हैं, के रूप में 1 से ऊपर titers x 109 सेल संक्रामक इकाइयों (ciu)/mL शायद ही कभी चरण २.२ में वर्णित प्रचार की विधि द्वारा प्राप्त कर रहे हैं । [पी] वायरस के बिना नियंत्रण कुओं की तुलना के लिए इस्तेमाल किया जा सकता है और संदूषण की निगरानी ।
    5. [पी] सेल निलंबन के १०० µ एल जोड़ने के लिए एक अच्छी तरह से और ३७ ° c, 5% सह पर मशीन ४८ h. के लिए कोशिकाओं के समरूप वितरण प्राप्त करने के निलंबन में सेल के झुरमुट की अनुपस्थिति सुनिश्चित करें ।
    6. [पी] एक प्रकाश माइक्रोस्कोप का उपयोग कर syncytia के लिए जाँच करें । दृश्य syncytia युक्त उच्चतम कमजोर पड़ने कारक के साथ कॉलम के प्रत्येक कुआं में syncytia गिनती ।
    7. [P] syncytia की कुल संख्या को आठ द्वारा विभाजित करके उस स्तंभ में प्रति well syncytia की औसत संख्या परिकलित करें । संबंधित कॉलम के कमजोर पड़ने कारक के साथ कि औसत गुणा, पहले कॉलम५३ के लिए 102 ciu प्रति मिलीलीटर से शुरू (एक उदाहरण के रूप में चित्रा 5 देखें) ।

3. वायरल वैक्टर एंकोडिंग Immunomodulators की नकल और साइटोटोक्सिक क्षमताओं का निर्धारण

  1. [O] प्रतिकृति कैनेटीक्स जनरेट किया गया रिकॉमबिनेंट वायरस और एक-चरण या बहु-चरण वृद्धि curves (जेन्टलमैन) के साथ संशोधित वेक्टर की तुलना करें । एक कदम जेन्टलमैन के लिए, वायरल संतति सभी कोशिकाओं (सैद्धांतिक रूप से, १००% संक्रमण) के एक साथ संक्रमण के बाद मूल्यांकन कर रहे हैं । बहु-चरण जेन्टलमैन वायरस प्रतिकृति के कई राउंड का पालन करने के लिए संक्रमित कक्षों का एक कम प्रतिशत पर प्रारंभ करें ।
    1. [एम] खसरा वायरस प्रतिकृति कैनेटीक्स के विश्लेषण के लिए, बीज 1 x 105 वीरो कोशिकाओं के साथ DMEM के 1 मिलीलीटर में 10% FBS पर अच्छी तरह से एक दिन पहले संक्रमण के लिए प्लेटें । प्लेट तकनीकी प्रतिकृति के रूप में ब्याज की प्रत्येक timepoint के लिए दो कुओं कम से कम ।
    2. [ओ] बहु कदम के लिए या उच्च MOI पर एक कदम जेन्टलमैन [एम] के लिए कम MOI पर वायरस के साथ कोशिकाओं को संक्रमित (०.०३ और 3 वीरो कोशिकाओं पर एमवी प्रतिकृति के लिए, क्रमशः). ३०० µ एल के साथ मध्यम बदलें सीरम मुक्त माध्यम के वायरस के संबंधित राशि और ३७ डिग्री सेल्सियस और 5% सह2 पर मशीन से युक्त कम से 2 h. इनोक्युलम निकालें, 10% FBS के साथ DMEM के 1 मिलीलीटर जोड़ने, और जारी रखने की मशीन ।
    3. [P] जैसे 12, 24, ३६, ४८, ७२, और ९६ एच के रूप में प्रासंगिक timepoints में संक्रमण के बाद, सीधे माध्यम में कोशिकाओं को scraping द्वारा वायरल संतान फसल । प्रत्येक अच्छी तरह से एक व्यक्तिगत ट्यूब, स्नैप-फ्रीज में तरल नाइट्रोजन और दुकान पर-८० ° c अनुमापन तक स्थानांतरण सामग्री ।
      नोट: [P] प्रतिकृति नमूने औसत titers के विश्लेषण के लिए इस चरण पर परित हो सकता है ।
    4. [P] सभी timepoints से नमूने ले लीजिए । ३७ डिग्री सेल्सियस पर एक साथ वायरल संतति के मूल्यांकन के लिए गल । भंवर और गोली सेल मलबे के लिए केंद्रापसारक द्वारा 5 मिनट में २,५०० x g और 4 डिग्री सेल्सियस ।
    5. [P] ऊपर वर्णित के रूप में प्रत्येक के निर्माण और timepoint के औसत titers की गणना । समय के साथ प्लाट titers । के साथ और बिना डाला transgenes, विभिंन transgenes के साथ या विभिंन पदों पर डाला transgenes के साथ वैक्टर के विकास curves तुलना ( चित्रा 6देखें) ।
  2. [O] immunomodulator-एंकोडिंग और अनसंशोधित वायरस की lytic गतिविधियों की तुलना करें ।
    1. [O] प्रतिबाधा माप, स्तनपान कराने वाली डिहाइड्रोजनेज (LDH) रिलीज परख, या चयापचय आधारित वर्णमिति कोशिका व्यवहार्यता परख सहित संभव के तरीके से चयन [जैसे, 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium (MTT ) और 2, 3-बीआईएस-(2-methoxy-4-नाइट्रो-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) की परख] ।
      1. [एम] XTT परख, बीज वीरो कोशिकाओं के रूप में कदम 3.1.1 में वर्णित का उपयोग कर खसरा वायरस वैक्टर के cytotoxicity का विश्लेषण करने के लिए । प्रत्येक timepoint के लिए एक गैर संक्रमित नियंत्रण की प्रतिकृति शामिल करें ।
        नोट: [हे] एक ही नमूना पर अलग timepoints पर XTT परख प्रदर्शन तकनीकी त्रुटियों को सीमित कर सकते हैं, लेकिन दोहराया धोने और XTT रिएजेंट के लिए जोखिम व्यवहार्य कोशिकाओं की संख्या को प्रभावित करता है । प्रतिबाधा सतत माप के लिए एक वैकल्पिक readout प्रदान करता है.
    2. [M] के एक MOI पर वीरो कोशिकाओं को संक्रमित 1 के रूप में चरण 3.1.2 में वर्णित है ।
      नोट: [M] ऐसे कुछ murine ट्यूमर सेल लाइनों के रूप में कम स्वतंत्र लक्ष्य कोशिकाओं के संक्रमण के लिए, 3 या 5 के एक उच्च MOI आवश्यक हो सकता है ।
    3. [हे] ब्याज की timepoints पर (जैसे, 12, 24, ३६, ४८, ७२, और संक्रमण के बाद ९६ एच) XTT एजेंट की आवश्यक राशि तैयार (यानी, ३००µ एल के प्रति अच्छी तरह से प्लस 10% अतिरिक्त) । प्रकाश जोखिम से बचें ।
    4. [एम] प्रत्येक timepoint पर, संबंधित कुओं से मध्यम निकालें । XTT रिएजेंट और अंधेरे में ३७ डिग्री सेल्सियस पर गर्मी की ३०० µ एल द्वारा बदलें । supernatants इकट्ठा जब नियंत्रण कुओं में एजेंट गहरी लाल है, जो आम तौर पर 15 मिनट और 2 घंटे के बीच लेता है, और पर फ्रीज-20 डिग्री सेल्सियस हो गया है ।
      नोट: [ओ] मशीन बार वायरस के निर्माण पर निर्भर, कोशिका प्रकार, घनत्व, और cytopathic प्रभाव ।
    5. [हे] सभी नमूनों को इकट्ठा करने के बाद, एक साथ गल । एक संदर्भ तरंग दैर्ध्य के रूप में ६३० एनएम के साथ ४५० एनएम के लिए एक ९६-अच्छी तरह से प्लेट और मापने के लिए प्रत्येक नमूने के १०० µ एल स्थानांतरण ।
    6. [O] भूखंड timepoints (x-अक्ष) बनाम नमूनों की ऑप्टिकल अवशोषक नियंत्रण के सापेक्ष, कोशिका व्यवहार्यता के लिए एक किराए के रूप में चयापचय गतिविधि का संकेत (y-अक्ष). समय के साथ सापेक्ष अवशोषण घटते वायरल cytotoxicity का तात्पर्य ( चित्रा 6बीदेखें).

4. संक्रमित कोशिकाओं से स्रावित वायरस इनकोडिंग Immunomodulators की गतिविधि का विश्लेषण

  1. [O] गुप्त transgene वायरस संक्रमित लक्ष्य कोशिकाओं द्वारा व्यक्त उत्पादों को अलग ।
    1. [पी] वायरस निर्माता कोशिकाओं T175 कुप्पी में ७०% प्रवाह को बढ़ने दो ।
    2. [पी] कोशिकाओं से मध्यम निकालें और सीरम निकालने के लिए पंजाब के 12 मिलीलीटर के साथ दो बार धो लें । वायरस के साथ Inoculate कोशिकाओं सीरम के 12 मिलीलीटर में ०.०३ के एक MOI पर मुक्त माध्यम और ३७ ° c और 5% सह रात भर में मशीन । ताजा सीरम मुक्त माध्यम के 12 मिलीलीटर के साथ मध्यम बदलें ।
      1. [एम] Edmonston बी वायरस के लिए, संक्रमण की सुविधा और syncytia के समय से पहले फटने को रोकने के लिए एक और 24 एच के लिए ४० एच के बाद ३७ से ३२ डिग्री सेल्सियस के लिए कोशिकाओं स्थानांतरण । वायरस तनाव५१,५२ और syncytia प्रगति, मशीन तापमान और समय के आधार पर इष्टतम प्रोटीन उपज और पवित्रता के लिए समायोजित किया जा सकता है ।
    3. [पी] ध्यान से syncytia फटने से पहले कोशिकाओं अलग बिना supernatants इकट्ठा । बिगड़ेगा, syncytia पूरे सेल परत में फैल गया है । पूल supernatants में ५० मिलीलीटर ट्यूबों ।
      नोट: [पी] transgene उत्पाद के कुशल शुद्धिकरण के लिए, syncytia के फटने से बचें और संक्रमित कोशिकाओं के supernatants की कटाई करते समय सेल के मलबे को कम करें ।
    4. [पी] २,५०० x g और 4 डिग्री सेल्सियस पर 5 मिनट के लिए supernatant से सेल मलबे निकालें और ०.२२ µm फिल्टर के माध्यम से गुजर रहा है । निस्पंदन की कुल मात्रा पर निर्भर करता है, यह एक सिरिंज या एक वैक्यूम पंप का उपयोग किया जा सकता है ।
    5. [O] एक उपयुक्त शुद्धि विधि का उपयोग कर transgene उत्पाद को अलग । एक हेक्सा के साथ शुद्ध प्रोटीन-histidine (अपने) अपनत्व एक्सचेंज द्वारा टैग क्रोमैटोग्राफी नी-ंत् मिनी स्पिन कॉलम३८ का उपयोग कर के रूप में संक्षेप में यहां वर्णित (steps 4.1.5.1 – 4.1.5.4) ।
      नोट: [ओ] तेजी से और बर्फ पर सभी कदम प्रदर्शन करते हैं । पूर्व सर्द बफ़र्स और 4 ° c करने के लिए पूर्व शांत केंद्रापसारक ।
      1. [ओ] 10 मिमी (वाशिंग बफर 1, WB1), 20 मिमी (वाशिंग बफर 2, WB2), और ५०० मिमी (रेफरेंस बफर, EB) के अंतिम सांद्रता पर पंजाबियों, २०० मिमी सोडियम क्लोराइड और imidazole के साथ बफर के प्रत्येक १०० मिलीलीटर तैयार करें । ८.० और EB के लिए ७.० WB1 और WB2 के पीएच समायोजित करें । प्रोटीन के आधार पर शुद्ध किया जा करने के लिए, imidazole सांद्रता समायोजित करना पड़ सकता है ।
      2. [ओ] WB1 के ६०० µ एल के साथ Equilibrate कॉलम और एक खुले ढक्कन के साथ 2 मिनट के लिए ८०० x g पर केंद्रापसारक ।
      3. [हे] लोड ६०० µ एल के कॉलम पर फ़िल्टर्ड supernatants । के बंधन की अनुमति दें अपने-टैग प्रोटीन से स्तंभ मैट्रिक्स को २०० x g पर 5 मिनट के लिए एक बंद ढक्कन के साथ । लोड हो रहा है और बाध्यकारी ३०० µ जी उसकी-कॉलम प्रति प्रोटीन टैग की कुल तक दोहराया जा सकता है ।
      4. [ओ] WB1 के साथ तीन बार धोने और WB2 के साथ, या जब तक प्रवाह के माध्यम से बेरंग है । जोड़ें ६०० µ एल के बफर और स्पिन ८०० एक्स जी पर खुले ढक्कन के साथ 2 मिनट के लिए ।
      5. [O] Elute प्रोटीन एक ताजा ट्यूब में ३०० µ एल के साथ दो रेफरेंस स्टेप्स का प्रदर्शन करके EB और केंद्रापसारक के लिए 2 मिनट में ८०० x g.
      6. [O] नमक और उत्पाद के आकार के अनुसार केंद्रापसारक फिल्टर का उपयोग कर उत्पादों ध्यान केंद्रित । ४,००० x gपर 10 मिनट के लिए केंद्रापसारक के माध्यम से 15 मिलीलीटर और फिल्टर की मात्रा में पंजाबियों जोड़ें जब तक वांछित पवित्रता और एकाग्रता प्राप्त की है दोहराएँ । प्रोटीन एकाग्रता बढ़ाने के लिए, लगभग २०० µ एल के लिए अंतिम मात्रा को कम करने के लिए ४० मिनट पर ४,००० x g
  2. [हे] शुद्धता और उत्पाद की पहचान की पुष्टि करें ।
    1. [O] ऐसे bicinchoninic एसिड (बीसीए) या ब्रैडफोर्ड परख५४,५५के रूप में मानक वर्णमिति परख का उपयोग अलग में कुल प्रोटीन की मात्रा यों तो । [M] ठेठ मूल्यों से रेंज कर सकते हैं 1 – 3 µ g transgene उत्पाद प्रति एमएल supernatant संक्रमित कोशिकाओं की.
    2. [ओ] प्रोटीन के सापेक्ष ठहराव के लिए अलग, सोडियम dodecyl सल्फेट polyacrylamide जेल ट्रो (एसडीएस-PAGE) और प्रदर्शन Coomassie५६धुंधला के माध्यम से पृथक ।
    3. [हे] immunoblotting द्वारा विशिष्ट एंटीबॉडी प्रोटीन या एक संबद्ध पेप्टाइड टैग५७लक्ष्यीकरण का उपयोग करके शुद्ध उत्पादों की पहचान की पुष्टि करें ।
    4. [हे] विश्लेषण प्रोटीन बाध्यकारी विशिष्टता है कि एंजाइम से जुड़े immunosorbent परख (एलिसा) या प्रवाह cytometry शामिल हो सकते है का उपयोग कर ( चित्रा 7देखें) । सेल बाइंडिंग एक हाल ही में वर्णित चुंबकीय pulldown परख३८का उपयोग कर पुष्टि की जा सकती है ।
      नोट: [O] उपयुक्त नियंत्रणों का उपयोग करें । कक्ष बाइंडिंग परख में, लक्षित अणु (जैसा चित्र 9में) व्यक्त नहीं कोशिकाओं के साथ नकारात्मक नियंत्रण शामिल है और गैर लक्ष्यीकरण प्रोटीन किराए (8 चित्रा) । फ्लो cytometry प्रयोगों में, सकारात्मक, नकारात्मक और isotype नियंत्रण (चित्रा 7) शामिल हैं ।
      1. [ओ] सह लक्ष्य कोशिकाओं और प्रोटीन अलग करने के लिए बाध्यकारी अनुमति देते हैं । [बी] BTEs के परिधीय रक्त mononuclear कोशिकाओं (PBMCs) मानव रक्त५८से अलग करने के लिए बाध्यकारी विश्लेषण के लिए, BTE के २०० एनजी के साथ 1% µ (बाध्यकारी बफर, BB) 1 के लिए बर्फ पर एच के साथ 106 कोशिकाओं के साथ-साथ पंजाब के १०० FBS ।
      2. [ख] असीम प्रोटीन को दूर करने के लिए बी बी के 1 मिलीलीटर के साथ कोशिकाओं को धो लें । 5 मिनट के लिए ३०० x g पर केंद्रापसारक, supernatant त्यागें, और बी एम के १०० µ एल में गोली resuspend । biotinylated या तो ब्याज के प्रोटीन या एक जुड़े पेप्टाइड टैग और 30 मिनट के लिए बर्फ पर गर्मी लक्ष्यीकरण एंटीबॉडी जोड़ें । इंफ्लूएंजा hemagglutinin (हा) टैग के साथ BTEs के लिए, उपयोग १०० विरोधी के एनजी-हा-बायोटिन (क्लोन 3F10) ।
      3. [B] दो बार बी बी के 1 मिलीलीटर के साथ कोशिकाओं को धो और बी सी के ८० µ एल में resuspend । streptavidin-युग्मित चुंबकीय microbeads के 20 µ एल जोड़ें और 4 डिग्री सेल्सियस पर 15 मिनट के लिए मशीन ।
      4. [बी] धो एक बार अतिरिक्त मोतियों को हटाने के लिए और 2 मिमी EDTA (कॉलम बफर, सीबी) के साथ पूरक बी सी के ५०० µ एल में गोली resuspend ।
      5. [ख] कॉलम के साथ कोशिकाओं को अलग और प्रदाता के मैनुअल के अनुसार एक चुंबकीय खड़े हो जाओ ।
        1. [ख] सीबी के ५०० µ एल की अनुमति देकर Equilibrate गुरुत्वाकर्षण प्रवाह द्वारा कॉलम के माध्यम से पारित करने के लिए ।
          नोट: [B] स्तंभ शुष्क कभी नहीं चलाना चाहिए । प्लास्टिक सावधानी से और बुलबुले से बचने के लिए degas बफ़र्स ।
        2. [ख] कॉलम के तहत एक साफ ट्यूब प्लेस और स्तंभ के लिए सेल/मनका निलंबन लागू होते हैं । धो के प्रति सीबी के ५०० µ l के साथ कॉलम को तीन बार धोएं । निलंबन के प्रवाह के माध्यम से इकट्ठा और ट्यूब में सबसे पहले धोने कदम की, तो बर्फ पर स्टोर के माध्यम से ।
        3. [B] Elute मनका-बाउंड कोशिकाओं चुंबकीय क्षेत्र द्वारा बनाए रखा । इस अंत करने के लिए, चुंबकीय स्टैंड से कॉलम हटाने के लिए, यह एक साफ ट्यूब पर जगह है, सीबी के 1 मिलीलीटर जोड़ें, और जल्दी से एक गोताख़ोर का उपयोग कर ट्यूब में कॉलम के माध्यम से बफर धक्का । बर्फ पर ट्यूब रखें ।
      6. [बी] के माध्यम से और १६,००० एक्स जी में 20 मिनट के लिए और 4 डिग्री सेल्सियस के लिए गोली के लिए रेफरेंस के नमूनों प्रवाह युक्त ट्यूब केंद्रापसारक । supernatants और लाइसे कक्षों को radioimmunoprecipitation परख (RIPA) बफ़र में छोड़ें (सुझाए गए: ७५ µ l) । प्रदर्शन एसडीएस-पृष्ठ५६
      7. [B] एक उपयुक्त प्राथमिक एंटीबॉडी का उपयोग करते हुए immunoblotting निष्पादित करें । एंटीबॉडी transgene उत्पाद या एक सेलुलर प्रोटीन (जैसे, β-actin, चित्रा 8) BTE-सेल बाइंडिंग का आकलन करने के लिए लक्ष्य कर सकते हैं ।
  3. [O] पृथक immunomodulators की प्रतिरक्षा कार्यक्षमता का आकलन करते हैं ।
    1. [ओ] इनकोडिंग immunomodulator की विशेषताओं के अनुसार प्रासंगिक परख की पहचान । अपेक्षित इम्यूनोमॉड्यूलेटरी गतिविधि के बारे में, सेल प्रसार, प्रवास, परिपक्वता, सक्रियण, या cytotoxicity का आकलन करने के तरीके लागू किया जा सकता है ।
      नोट: [ओ] सेल प्रसार CFSE द्वारा विश्लेषण किया जा सकता है५९ लेबलिंग या Ki67 दाग६०। Transwell या स्क्रैच प्रयोग सेल माइग्रेशन६१का विश्लेषण करने के लिए उपलब्ध हैं । परिपक्वता और कोशिकाओं के सक्रियकरण संबंधित मार्करों के लिए उपयुक्त धुंधला प्रोटोकॉल का उपयोग कर मूल्यांकन किया जा सकता है । [ख] उपलब्ध तकनीक का आकलन करने के लिए BTE मध्यस्थता सेलुलर cytotoxicity प्रतिबाधा माप और क्रोमियम रिहाई परख शामिल हैं. यदि क्रोमियम रिलीज के लिए चयन परख, उचित सुरक्षा उपायों का निरीक्षण जब रेडियोधर्मी सामग्री हैंडलिंग ।
    2. [बी] एक गैर रेडियोधर्मी विकल्प के रूप में, निम्न विस्तार से वर्णन करता है कि कैसे BTE का मूल्यांकन करने के लिए प्रेरित, सेल LDH रिलीज परख द्वारा मध्यस्थता cytotoxicity (संक्षिप्त में पहले वर्णित३८).
      1. [B] प्रयोग के दौरान परीक्षण की जाने वाली शर्तों पर निर्णय लेना ( चित्र 9 को एक उदाहरण के रूप में देखें) । Timepoints (दिन के लिए घंटे), immunomodulator की सांद्रता (स्नातकोत्तर/एमएल करने के लिए µ जी/एमएल) और प्रभाव के लिए लक्ष्य सेल (E:T) अनुपात (1:50 और 50:1 के बीच, उदाहरण के लिए) विविध किया जा सकता है । triplicates में हमेशा नमूने तैयार करें ।
      2. [ख] प्रोटीन के बिना नमूनों और बिना प्रभाव कोशिकाओं, एक सेल प्रकार (टीएसपी और ईसपा) के सहज LDH रिहाई के लिए नियंत्रण शामिल हैं, एक लक्ष्य सेल अधिकतम lysis नियंत्रण (टीमैक्स) डिटर्जेंट के साथ readout से पहले जोड़ा, एक मध्यम केवल नियंत्रण, और टीमैक्सके लिए एक मात्रा पर नियंत्रण ।
        नोट: [बी] लक्ष्य कोशिकाओं और गर्मी के समय की आवश्यक संख्या भिंन हो सकते हैं । प्रारंभिक परीक्षण करने के लिए प्रभावी पैरामीटर की पहचान करने के लिए प्रभाव कोशिकाओं और immunomodulators बिना चलाता है । टीsp और tअधिकतम नमूने और संबंधित नियंत्रण अलग कक्ष संख्या और timepoints का आकलन करने के लिए शामिल हैं ।
      3. [ख] प्रतिरक्षा प्रभाव कोशिकाओं को अलग (जैसे, मानव रक्त के घनत्व ढाल केंद्रापसारक द्वारा माउस splenocytes६२से murine टी कोशिकाओं के PBMCs५८ या नकारात्मक चयन प्राप्त करने के लिए) ।
      4. [ख] बीज लक्ष्य कोशिकाओं के अनुसार कदम 4.3.2 (जैसे, 5 x 10 ³ प्रति अच्छी तरह से) एक U-नीचे ९६-अच्छी तरह से थाली में ।
      5. [बी] संबंधित नमूनों को वांछित सांद्रता में पृथक प्रोटीन जोड़ें । वांछित अनुपात में प्रतिरक्षा प्रभाव कोशिकाओं जोड़ें. अच्छी तरह से प्रति १०० µ एल की कुल मात्रा में मध्यम जोड़ें ।
      6. [ख] कदम 4.3.2 में निर्धारित समय सीमा के लिए मशीन, आम तौर पर के बीच 4 और ४८ ज (उत्तेजित PBMCs के लिए 24 ज और हौसले से अलग murine टी कोशिकाओं के लिए ४८ ज; छोटे गर्मी बार उत्तेजित प्रतिरक्षा कोशिकाओं के लिए आवेदन कर सकते हैं), ३७ डिग्री सेल्सियस और 5% सह2पर ।
      7. [ख] ४५ मिनट नमूनों को इकट्ठा करने से पहले, टीमैक्स नमूनों और इसी माध्यम नियंत्रण युक्त कुओं के लिए 10x lysis समाधान के 10 µ एल जोड़ें । जारी रखें गर्मी ।
      8. [बी] २५० x g पर कोशिकाओं के नीचे स्पिन 4 मिन. Transfer ५० प्रत्येक supernatant के µ एल के लिए एक फ्लैट नीचे ९६ अच्छी तरह से प्लेट । कक्ष-बाउंड LDH से बचने के लिए कक्षों को स्थानांतरित न करें ।
      9. [ख] सब्सट्रेट समाधान तैयार निर्माता के अनुसार । प्रत्येक अच्छी तरह से ५० µ एल जोड़ें और 30 मिनट के लिए या टीमैक्स नमूने गहरे लाल बारी तक अंधेरे में आर टी में गर्मी ।
      10. [ख] एक अच्छी तरह से रोकने के समाधान के ५० µ एल जोड़ें । ४,००० x gपर 1 मिनट के लिए केंद्रापसारक द्वारा एयर बुलबुले निकालें, और एक खोखले सुई के साथ मैंयुअल रूप से । ४९० एनएम पर ऑप्टिकल अवशोषक उपाय ।
      11. [B] प्रत्येक नमूने के लिए% विशिष्ट lysis मान परिकलित करें ।
        1. [B] के साथ और lysis समाधान के बिना मध्यम नियंत्रण की प्रतिकृति के लिए औसत की गणना । क्रमशः प्रयोगात्मक नमूनों से और टीमैक्स और सहज रिलीज नियंत्रण से प्राप्त मूल्यों घटाना । आगे की गणना के लिए इन पृष्ठभूमि सही मान का उपयोग करें ।
        2. [B] औसत पृष्ठभूमि-सही tमैक्स, tsp, और Esp नियंत्रण के लिए परिकलित करें । इन औसत मानों का उपयोग करते हुए, निम्न समीकरण प्रत्येक नमूने के लिए विशिष्ट lysis का प्रतिशत yields:

          Equation 1
        3. [B] प्लॉट% विशिष्ट lysis मान बनाम प्रोटीन एकाग्रता या E:T अनुपात और गैर-लक्ष्यीकरण नियंत्रण नमूनों से तुलना करें ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

चित्रा 1 oncolytic खसरा वायरस एंकोडिंग bispecific टी सेल engagers की कार्रवाई के तंत्र को दर्शाता है । इस प्रोटोकॉल के वर्कफ़्लो का चित्रण करने वाला एक फ़्लोचार्ट चित्र 2में प्रस्तुत किया गया है । चित्रा 3 एक संशोधित oncolytic खसरा वायरस जीनोम का एक उदाहरण से पता चलता है । यह खसरा वायरस विरोधी जीनोम और डाला transgenes की विशेष सुविधाओं के लिए लागू विशिष्ट परिवर्तनों का एक दृश्य प्रतिनिधित्व प्रदान करता है । ठेठ खसरा वायरस प्रेरित syncytia चित्रा 4में चित्रित कर रहे हैं । बचाव के timepoint में उच्च कोशिका घनत्व पर ध्यान दें (A, B), यह दर्शाता है कि प्रयोग दोहराने पर कोशिका संख्या कम हो सकती है. मशीन तापमान और समय वीरो कोशिकाओं पर passaging के लिए अनुकूलित किया जा सकता है (सी, डी) प्लेट भर में syncytia के सुधार प्रसार को प्राप्त करने के लिए. चित्रा 5 एक ठेठ अनुमापन परख के परिणाम का प्रतिनिधित्व करता है । चित्रा 6में, एक कदम वृद्धि curves (A) और सापेक्ष कोशिका व्यवहार्यता (बी) के साथ टीका के बाद unmodified (एमवी) और BTE-एंकोडिंग oncolytic खसरा वायरस (एमवी-एच-mCD3xhCD20) दिखाया जाता है । जबकि वीरो कोशिकाओं पर तुलना वैक्टर की वृद्धि घटता समान, lytic गतिविधि transgene-एंकोडिंग वायरस lags के पीछे murine ट्यूमर सेल लाइन में दिखाई देते हैं । पांच विभिंन कमजोर पड़ने पर BTEs के साथ मशीनेड लक्ष्य प्रतिजन-व्यक्त कोशिकाओं के प्रवाह cytometry डेटा चित्रा 7में प्रदान की जाती है, एक एकाग्रता पर निर्भर तरीके से कोशिकाओं द्वारा बाध्यकारी BTE का संकेत है । चित्रा 8 BTE-जुड़े कोशिकाओं के चुंबकीय pulldown के बाद एक अनुकरणीय immunoblot का प्रतिनिधित्व करता है । Pulldown के साथ गैर लक्ष्यीकरण BTEs (एन1, एन2) कोशिकाओं का पता लगाने की मात्रा उपज नहीं था, जबकि रेफरेंस अंश में बैंड, बाध्य कोशिकाओं के संकेत, BTE नमूनों (टी1, टी2) लक्ष्यीकरण के लिए मनाया गया । BTE-मध्यस्थता, लक्ष्य प्रतिजन-विशिष्ट और एकाग्रता-murine टी कोशिकाओं के आश्रित cytotoxicity चित्र 9में एक प्रतिनिधि LDH जारी परख द्वारा संकेत दिया है.

Figure 1
चित्रा 1 : oncolytic खसरा वायरस की कार्रवाई के तंत्र एक bispecific टी सेल engager (एमवी-BTE) एंकोडिंग । एक ट्यूमर कोशिका के संक्रमण (संक्रमित: ग्रे, अनसंक्रमित: लाइट ब्लू) एमवी-BTE के साथ वायरल प्रतिकृति और ट्यूमर भर में फैले द्वारा पीछा किया जाता है, ट्यूमर कोशिका lysis और प्रतिरक्षा उत्तेजना में जिसके परिणामस्वरूप. इसके साथ ही, BTEs [दो एकल टी कोशिकाओं (पीला) और एक ट्यूमर सतह प्रतिजन (ब्लू)] पर CD3 लक्ष्यीकरण से व्युत्पंन चेन से मिलकर उत्पादित कर रहे है और स्थानीय रूप से वायरस संक्रमित कोशिकाओं द्वारा स्रावित । BTE-मध्यस्थ क्रॉस-ट्यूमर कोशिकाओं के साथ जोड़ने आराम, polyclonal टी कोशिकाओं, आगे ट्यूमर कोशिका हत्या में जिसके परिणामस्वरूप के सक्रियकरण लाती है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्रा 2 : फ़्लोचार्ट डिज़ाइन, जनरेट कर रहा है, और मूल्यांकन उपंयास वायरल वैक्टर एंकोडिंग इम्यूनोमॉड्यूलेटरी transgenes के कार्यप्रवाह का वर्णन । चरण 1 से 4 प्रोटोकॉल के संबंधित अनुभागों को प्रतिबिंबित । बुलेट बिंदु प्रासंगिक विचार और उपचरण इंगित करते हैं । प्रक्रिया की अनुभवजंय प्रकृति के कारण, समायोजन या शोधन कार्यप्रवाह के किसी भी कदम पर आवश्यक हो सकता है । इसके अलावा, प्रयोगात्मक निष्कर्षों नई परिकल्पनाओं के लिए नेतृत्व और अतिरिक्त वैक्टर या संयोजन उपचार के विकास को प्रेरित कर सकते हैं । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 3
चित्रा 3 : एक खसरा वायरस जीनोम के योजनाबद्ध प्रतिनिधित्व । बढ़ाया ग्रीन फ्लोरोसेंट प्रोटीन (eGFP) एक अतिरिक्त प्रतिलेखन इकाई के नेता (ld) अनुक्रम के बहाव में इनकोडिंग है । एन, पी, एम, एफ, एच, और एल नामित जीन खसरा वायरस संरचनात्मक प्रोटीन nucleoprotein, पी प्रोटीन, मैट्रिक्स प्रोटीन, फ्यूजन प्रोटीन, hemagglutinin प्रोटीन, और बड़े प्रोटीन (पोलीमरेज़), क्रमशः, जो अंतर के रूप में व्यक्त की visualized है एंकोडिंग ऊपर. एक bispecific टी सेल engager (BTE) transgene एक अतिरिक्त प्रतिलेखन इकाई (ातु) एच ओपन रीडिंग फ्रेम के बहाव में डाला जाता है । transgene encodes कुशल स्राव के लिए एक Igκ नेता पेप्टाइड के रूप में के रूप में अच्छी तरह से इंफ्लूएंजा hemagglutinin (हा) और हेक्सा-histidine (अपने) का पता लगाने और शुद्धि के लिए प्रोटीन टैग । चर भारी (VH) और हल्की श्रृंखला (वीएल) एंटीबॉडी लक्ष्यीकरण के CD3 और CD20, क्रमशः के लिए कोडिंग जीन, glycine (जी) और serine (ओं) के अवशेषों युक्त पेप्टाइड लिंक अनुक्रम के माध्यम से जुड़े हैं । transgene अनुक्रम श्मिट अनुक्रम से पहले है । कोडन क्षेत्र के बहाव, अतिरिक्त न्यूक्लियोटाइड छह के नियम का पालन करने के लिए exemplarily शामिल किया गया है । डालने के कैसेट दो प्रतिबंध संबंधित ातु में प्रविष्टि को सक्षम करने साइटों द्वारा बाजू है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 4
चित्र 4 : खसरा वायरस प्रेरित syncytia । (A, B) वीरो कोशिकाओं रिकॉमबिनेंट खसरा वायरस एंकोडिंग बढ़ाया ग्रीन फ्लोरोसेंट प्रोटीन (eGFP) और एक bispecific टी सेल engager (BTE) लक्ष्यीकरण murine CD3 और मानव CD20 के बचाव के लिए सीडीएनए के साथ transfected थे । एक फ्लोरोसेंट syncytium की उपस्थिति (सफेद तीर) संक्रामक वायरस के सफल बचाव को इंगित करता है । (सी, डी) खसरा वायरस बचाव के बाद काटा गया था और वीरो कोशिकाओं पर प्रचारित (गद्यांश 1). बड़े syncytia का गठन किया है और पहले से ही फट (पीले तीर) शुरू कर रहे हैं । छवियों चरण इसके विपरीत द्वारा अधिग्रहीत किया गया (बी, डी) और प्रतिदीप्ति माइक्रोस्कोपी के लिए उत्तेजना के बाद ८० ms (A) और १०० ms (C). कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 5
चित्रा 5 : एक अनुमापन परख के प्रतिनिधि परिणाम । एमवी-एच-mCD3xhCD20, एक BTE-एंकोडिंग oncolytic खसरा वायरस, वीरो कोशिकाओं पर के एक तिहाई बीतने के बैच के अनुमापन । एक 10 गुना सीरियल कमजोर पड़ने एक ९६-अच्छी तरह से थाली पर प्रदर्शन किया गया था, के साथ शुरू 10 µ एल वायरस निलंबन के प्रत्येक कुआं में कॉलम 1.No syncytia कॉलम 7 में दिखाई दे रहे थे, के रूप में शूंय से संकेत दिया । कॉलम 6 में वायरस निलंबन के अगले सबसे कम कमजोर पड़ने के लिए, प्रति अच्छी तरह से छह syncytia के एक औसत मनाया गया था, लगभग 6 x 107 सेल संक्रामक इकाइयों (ciu) प्रति मिलीलीटर वायरस निलंबन के एक अंतिम titer में जिसके परिणामस्वरूप । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 6
चित्रा 6 : प्रतिकृति कैनेटीक्स और रिकॉमबिनेंट खसरा वायरस की lytic गतिविधि. (एक) एक कदम वृद्धि घटता unmodified खसरा वायरस (एमवी) या खसरा वायरस एक bispecific टी सेल engager (एमवी-एच-mCD3xhCD20) के साथ वीरो कोशिकाओं के संक्रमण के बाद उत्पंन किया गया 1 के एक MOI में । वायरल संतति का Titers संक्रमण के बाद नामित timepoints पर मूल्यांकित किया गया था, जो इसी प्रकार के वायरस प्रतिकृति कैनेटीक्स का संकेत देता है । मतलब है और आठ नमूनों की मानक विचलन (चार तकनीकी प्रतिकृति timepoint प्रति दो जैविक प्रतिकृति के प्रत्येक) दिखाए जाते हैं । () कोशिका व्यवहार्यता MC38 murine कोलोरेक्टल कार्सिनोमा कोशिकाओं पर का मूल्यांकन किया गया था छुरा व्यक्त मानव carcinoembryonic प्रतिजन और एमवी रिसेप्टर CD46 (MC38-सीईए-CD46) मध्यम के साथ टीका के बाद ही (नकली) या संकेत वायरस के एक MOI पर 1 । XTT सेल व्यवहार्यता परख संकेत दिया timepoints पर प्रदर्शन किया गया । सेल व्यवहार्यता में कमी के लिए पहले timepoints में मनाया गया था unmodified सदिश के लिए । १००% से अधिक का मान, के रूप में एमवी के लिए गणना एच-mCD3xhCD20 12 एच timepoint में, अक्सर संक्रमण के बाद शीघ्र ही मनाया जाता है, जो सेलुलर तनाव या कोशिका व्युत्पंन वायरस निलंबन में मौजूद कारकों की वजह से हो सकता है । माध्य मान से अधिक मानक विचलन की तीन तकनीकी प्रतिकृति प्रत्येक timepoint के लिए दिखाए जाते हैं । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 7
चित्र 7 : bispecific टी सेल engagers (BTEs) द्वारा लक्षित सेल बंधन खसरा वायरस संक्रमित कोशिकाओं से व्यक्त की है । मानव मेंटल सेल लिंफोमा कोशिकाओं endogenously व्यक्त CD20 (Granta-५१९) मानव immunoglobulin जी के साथ मशीन एफसी रिसेप्टर्स ब्लॉक करने के लिए, 2, 4, 6, 8, या 10 µ एल के साथ मशीन द्वारा पीछा किया गया (एक) शुद्ध mCD3xhCD20 BTE समाधान की, क्रमशः । phycoerythrin (PE) का उपयोग करते हुए BTE-बाउंड कक्षों का पता लगाया गया-संयुग्मित एंटीबॉडी लक्ष्यीकरण BTE-संबद्ध हा-टैग । BTE सांद्रता के साथ संबंधित दाग कोशिकाओं के प्रतिशत । () selectivity और बाइंडिंग की विशिष्टता के लिए नियंत्रण । यहां दिखाए गए एक स्वतंत्र प्रयोग से नियंत्रण कर रहे हैं, एक नमूना सहित BTE के साथ नहीं, लेकिन BTE-लक्ष्यीकरण एंटीबॉडी केवल (एंटीबॉडी की कोशिकाओं के लिए विशिष्ट बंधन के लिए नियंत्रण) के साथ या एक BTE है कि ब्याज की कोशिकाओं को बांध करने के लिए जाना जाता है के साथ नहीं की मशीन के साथ । , या तो BTE लक्ष्यीकरण एंटीबॉडी (सकारात्मक नियंत्रण) या एक isotype एंटीबॉडी के साथ मशीन द्वारा पीछा किया । यदि उपलब्ध हो, तो isogenic कक्ष पसंद का लक्ष्य antigen व्यक्त नहीं बाइंडिंग selectivity आगे की जांच करने के लिए उपयोग किया जा सकता है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 8
चित्र 8 : मानव परिधीय रक्त mononuclear कोशिकाओं (PBMCs) के चुंबकीय pulldown खसरा वायरस इनकोडिंग BTEs से बंधे । कोशिकाओं को मानव टी सेल के दो अलग बैचों-लक्ष्यीकरण (t1, टी 2) या गैर लक्ष्यीकरण नियंत्रण BTEs (n1, n2), क्रमशः के साथ मशीन थे । BTE-बाउंड कोशिकाओं चुंबकीय मोती, गोली, और लीजड ड का उपयोग कर स्तंभों पर बनाए रखा गया था । β-actin lysates में immunoblotting द्वारा पता लगाया गया था । बैंड के रेफरेंस नमूनों में तीव्रता संबंधित BTE-सेल बाइंडिंग का संकेत देती है । प्रवाह के माध्यम से नमूनों सभी नमूनों में कोशिकाओं की उपस्थिति की पुष्टि करें । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 9
चित्र 9 : खसरा वायरस इनकोडिंग BTEs की साइटोटोक्सिक गतिविधि । लक्ष्य ट्यूमर कोशिकाओं (5 x 10 ³ B16-CD20-CD46 कोशिकाओं के प्रति अच्छी तरह से) 1:50 के अनुपात में murine टी कोशिकाओं के साथ मशीन थे । BTEs पहले MV-H-mCD3xhCD20-संक्रमित कोशिकाओं के supernatant से शुद्ध संकेत सांद्रता में जोड़े गए थे । लक्ष्य कोशिकाओं के सापेक्ष lysis ४८ एच के बाद LDH जारी परख द्वारा मूल्यांकन किया गया था BTE लक्ष्य प्रतिजन (B16-CD46) की कमी कोशिकाओं का मूल्यांकन प्रतिजन-विशिष्ट cytotoxicity के संदर्भ के रूप में सेवा की । मतलब प्लस मानक विचलन प्रति नमूना तीन तकनीकी प्रतिकृति दिखाई जाती हैं । लक्ष्य प्रतिजन-एक्सप्रेस कोशिकाओं विशेष रूप से एक BTE एकाग्रता-निर्भर तरीके से लीजड ड थे । BTE उत्पाद की शुद्धता और लक्ष्य प्रतिजन अभिव्यक्ति स्तर प्रभाव कोशिका हत्या. वर्तमान उदाहरण में, 15% विशिष्ट कोशिका हत्या 1 µ g/एमएल के एक अपेक्षाकृत उच्च BTE एकाग्रता पर हासिल किया गया था । यह लंबे समय सह के साथ इस तरह के एक प्रयोगात्मक सेटअप के लिए एक ठेठ मूल्य-मशीन बार और उप इष्टतम टी सेल संस्कृति की स्थिति है । अन्य सेटिंग्स में, अप करने के लिए ६०% विशिष्ट हत्या एमवी से शुद्ध BTEs का उपयोग कर प्राप्त किया गया था-संक्रमित supernatants, १०० एनजी के BTE सांद्रता पर एक पठार तक पहुँचने/एमएल और उच्चतर३८. यह इंगित करता है कि, काउंटर सहज ज्ञान युक्त, इस परख की सीमा से कम १००% विशिष्ट हत्या है, जो टीमैक्स नियंत्रण में विभिंन विकास कैनेटीक्स द्वारा समझाया जा सकता है सह संस्कृति के नमूनों की तुलना में है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Oncolytic immunotherapy (यानी, चुहियों के साथ संयोजन में OVT) कैंसर के इलाज के लिए महान वादा रखती है, और विकास और Oncolytic इम्यूनोमॉड्यूलेटरी प्रोटीन एंकोडिंग वायरस के अनुकूलन की मांग की । इस प्रोटोकॉल तरीकों का वर्णन करने के लिए उत्पंन और प्रासंगिक नैदानिक मॉडल और उपंयास विरोधी कैंसर चिकित्सकीय में संभावित भविष्य नैदानिक अनुवाद में बाद में परीक्षण के लिए ऐसे वैक्टर मांय ।

विभिंन लाभों के साथ कई अलग oncolytic वायरस प्लेटफार्मों६३उपलब्ध हैं । कैंसर विशिष्टता के अलावा, वेक्टर सुरक्षा, विनिर्माण के लिए आवश्यकताओं, ट्यूमर सेल lysis में प्रभावकारिता, और प्रतिरक्षा प्रतिक्रियाओं की प्रेरण, क्लोनिंग क्षमता एक विशिष्ट oncolytic का उपयोग immunomodulators के सफल vectorization के लिए महत्वपूर्ण है । दुर्भाग्य से, अलग OVs की प्रत्यक्ष तुलना वर्तमान में कमी है और क्रम में व्यक्तिगत रोगियों के लिए इष्टतम उपचार के विकल्प की पहचान करने के लिए पीछा किया जाना चाहिए । इस तर्कसंगत विकास और उपंयास transgene-एंकोडिंग वैक्टर के परीक्षण को बढ़ावा देने के द्वारा सुविधा दी जा सकती है, के रूप में एमवी के लिए यहां उदाहरण-BTE । एमवी के लाभकारी गुणों को देखते हुए (यानी, oncotropism, सुरक्षा, fusogenicity, immunogenicity, आनुवंशिक संशोधन की व्यवहार्यता) इस प्रोटोकॉल इस oncolytic वेक्टर पर केंद्रित है, जो अन्य OV के लिए सामान्यीकृत किया जा सकता है, विशेष रूप से paramyxoviruses .

उंमीदवार transgenes (1.1.1 कदम) के रूप में संभावित प्रासंगिक immunomodulators के एक तर्कसंगत विकल्प के लिए, कैंसर की एक पूरी तरह से समझ-उन्मुक्ति चक्र आवश्यक है, व्यवस्थित साहित्य अनुसंधान अपरिहार्य बना । इसके अलावा, बड़े पैमाने पर स्क्रीन, हालांकि महंगा, उपंयास लक्ष्यों की पहचान करने के लिए मूल्यवान साबित कर सकते है (जैसे, देखें पटेल एट अल.४१) ।

रिकॉमबिनेंट OVs के डिजाइन के लिए, वांछित अभिव्यक्ति प्रोफाइल पर विचार किया जाना चाहिए । आरएनए वायरस के मामले में, जीन अभिव्यक्ति संबंधित पोलीमरेज़ द्वारा आरएनए स्तर पर नियंत्रित किया जाता है. जब एमवी जीनोम में प्रविष्टि के लिए transgene कैसेट डिजाइनिंग (1.1.2 कदम), दृश्यों कि एमवी पोलीमरेज़ जीन शुरू/बंद संकेतों और आरएनए संपादन साइटों और छह के नियम का पालन से परहेज सफल वेक्टर विकास के लिए महत्वपूर्ण है । इसके अलावा, paramyxovirus जीन अभिव्यक्ति स्तर जीनोम के भीतर स्थिति के अनुरूप है, एक अभिव्यक्ति ढाल४३से जिसके परिणामस्वरूप । सामान्य रूप में, एक ऊपर की स्थिति में transgene की स्थिति कम प्रतिकृति के खर्च पर अभिव्यक्ति बढ़ाता है । हालांकि, इन पैरामीटर्स भी आकार, संरचना, और संबंधित transgene के अनुक्रम पर निर्भर करते हैं । नतीजतन, इस प्रोटोकॉल में वर्णित पद्धति की एक सीमा उपंयास वेक्टर डिजाइन के अनुभवजंय परीक्षण के लिए की जरूरत है । विशिष्ट मामलों में, transgene अनुक्रम या स्थिति के समायोजन के लिए वांछित वेक्टर विशेषताओं (चित्रा 2) को प्राप्त करने के लिए आवश्यक हो सकता है । चेकपॉइंट एंटीबॉडी आवेषण के लिए विभिंन पदों की व्यवस्थित तुलना एचके लिए इष्टतम परिणाम दिखाया-ातु (अप्रकाशित डेटा) । BTE आवेषण के रूप में तुलनीय गुण है (आकार और immunoglobulin डोमेन), एमवी-BTE वैक्टर analogously३८क्लोन किया गया ।

वायरस सीडीएनए से संक्रामक कणों का बचाव (२.१ कदम) कुछ निर्माण के लिए कई प्रयास की आवश्यकता हो सकती है । समायोजन कक्ष संख्या syncytia गठन के लिए सेल घनत्व का अनुकूलन कर सकते हैं । जबकि एक निश्चित घनत्व कुशल सेल के लिए आवश्यक है करने के लिए सेल प्रसार और कोशिका झिल्ली के संलयन, संपर्क निषेध वायरल प्रतिकृति कम कर देता है । इसके अलावा, संक्रामक कणों की संख्या दिखाई सेल संलयन प्रेरित करने के लिए पर्याप्त नहीं हो सकता है । हालांकि, के रूप में वायरस syncytia के अभाव में उपस्थित हो सकते हैं, बचाव के नमूने फिर भी काटा जा सकता है और संभावित प्रसार के लिए ताजा निर्माता कोशिकाओं को हस्तांतरित । अकुशल अभिकर्मक गरीब डीएनए गुणवत्ता या अनुपयुक्त या नीचा अभिकर्मक के कारण एजेंट विशिष्ट समस्याओं है कि अपेक्षाकृत के लिए नए डीएनए की तैयारी और परीक्षण के विभिंन रिएजेंट, क्रमशः उत्पादन द्वारा मूल्यांकन और उपचार के लिए आसान कर रहे है प्रतिनिधित्व करते हैं ।

सफल वायरस प्रोपेगेशन (चरण २.२) वायरल प्रतिकृति और सेल lysis का निर्धारण शर्तों पर महत्वपूर्ण रूप से निर्भर है । उत्पादक कोशिकाओं की कम यात्रा की संख्या का उपयोग की सिफारिश की है, और संक्रमित कोशिकाओं को नियमित रूप से syncytia प्रगति के लिए जांच की जरूरत है । कक्ष संख्या, तापमान, और गर्मी समय समायोजन करने के लिए वायरल प्रसार बनाम सेल प्रसार संतुलन की आवश्यकता हो सकती है ।

वायरस के उत्पादन की वर्णित विधि की एक महत्वपूर्ण सीमा क्रूड सेल lysates से वायरस के निलंबन की तैयारी है । शोधकर्ताओं को इस बात की जानकारी होनी चाहिए कि वायरस के सस्पेंशन में सेलुलर फैक्टर्स होते हैं । वायरस कणों संक्रामक कणों की कुल संख्या की कीमत पर घनत्व ढाल/सुक्रोज तकिया ultracentrifugation के माध्यम से केंद्रित किया जा सकता है और भी संभावित सेलुलर अवशेषों की सांद्रता बढ़ रही है । वायरस भी संक्रमित कोशिका supernatants से केंद्रित किया जा सकता है, शुद्धता में वृद्धि लेकिन समग्र उपज को कम करने । जीएमपी और paramyxoviruses के बड़े पैमाने पर उत्पादन आम तौर पर उत्पादक कोशिकाओं के कई परतों का उपयोग किया जाता है में वृद्धि हुई titer उपज६३के लिए एक रेशा नेट पर अस्तव्यस्त सटीक निगरानी, निरंतर मीडिया विनिमय, सीरम मुक्त शर्तों, और बाद निस्पंदन कदम उत्पादित वायरस की उच्च शुद्धता सुनिश्चित करते हैं ।

वायरल titers का मूल्यांकन (चरण २.३ और ३.१) वर्णित syncytia गिनती विधि के माध्यम से सटीक नहीं है, लेकिन यह प्रदर्शन करने के लिए आसान है और पर्याप्त रूप से सटीक जब तकनीकी दोहराने की पर्याप्त संख्या का उपयोग कर । जब OV-मध्यस्थता cytotoxicity (चरण ३.२) का मूल्यांकन, उपलब्ध परख की सीमाओं पर विचार करने की आवश्यकता है । चयापचय परख प्रयोगात्मक उपचार के cytostatic और cytolytic प्रभाव के बीच भेद नहीं है । cytolysis को मापने के लिए, एक LDH जारी परख प्रदर्शन किया जा सकता है । हालांकि, दोनों प्रकार की परख से वायरस की तैयारी की सामग्री से प्रभावित किया जा सकता है क्रूड सेल lysates (चित्रा 6) ।

वायरस से व्यक्त प्रोटीन का अलगाव-संक्रमित कोशिकाओं (४.१ कदम) उपज और शुद्धता में बहुत भिंन हो सकते हैं, संबंधित transgene और उपयोग के रूप में अच्छी तरह से तकनीकी सटीकता पर वायरस के आधार पर । इस प्रकार, प्रोटीन शुद्धि के गुणवत्ता नियंत्रण संबंधित प्रयोगात्मक परिणामों के मूल्यांकन के लिए महत्वपूर्ण है ।

संभावित कार्यात्मक परख के एक संपूर्ण विवरण के रूप में संभव immunomodulators की व्यापक विविधता को कवर इस प्रकाशन के दायरे से बाहर है, इस प्रोटोकॉल पूर्व vivo पद्धति पर केंद्रित करने के लिए सेलुलर cytotoxicity उपाय (४.३ कदम) । सेलुलर cytotoxicity, विशेष रूप से सीडी 8 + टी कोशिकाओं द्वारा, सफल immunotherapies६४में प्रतिरक्षा ट्यूमर नियंत्रण का एक महत्वपूर्ण मध्यस्थ है । यह वर्तमान immunotherapy एंटीबॉडी का उपयोग करने के लिए सामांय और bispecific टी सेल engagers में विशेष रूप से विरोधी ट्यूमर प्रतिरक्षा प्रतिक्रियाओं को बढ़ाने के दृष्टिकोण के लिए महत्वपूर्ण निहितार्थ है । oncolytic वैक्टर द्वारा स्थानीय BTE अभिव्यक्ति आरएनए३८ और डीएनए वायरस६५,६६,६७,६८सहित कई नैदानिक अध्ययन में आशाजनक परिणाम मिले हैं ।

ट्यूमर, वायरस, transgene उत्पाद की जटिल बातचीत के कारण, और रहने वाले जीवों में मेजबान प्रतिरक्षा प्रणाली, immunomodulator के सत्यापन-कोशिका संस्कृति में एंकोडिंग oncolytic वैक्टर के रूप में यहां का प्रदर्शन चिकित्सकीय परिणामों की भविष्यवाणी करने के लिए पर्याप्त नहीं है । महत्वपूर्ण बात, वेक्टर और immunomodulator कार्यों के प्रस्तावित पृथक मूल्यांकन, क्रमशः, अवधारणा के सबूत के लिए आवश्यक है, लेकिन संभावित तालमेल और ट्यूमर microenvironment के भीतर जटिल बातचीत का वर्णन करने में विफल रहता है । दोनों विषाक्तता और वीवो मॉडल में प्रासंगिक में प्रभावकारिता के लिए परीक्षण उपंयास रिकॉमबिनेंट वेक्टर के विकास के आगे के लिए महत्वपूर्ण है constructs लेकिन आसानी से पूरा नहीं है । प्रतिरक्षा सुरक्षा मकाक जैसे गैर-मानव रहनुमाओं में नियमित रूप से निगरानी की जाती है, और माउस मॉडलों को पुनर्वितरण और प्रभावकारिता विश्लेषण के लिए20,६९का उपयोग किया जाता है । हालांकि, इन मॉडलों के कई मेजबान ऊतकों और मेजबान permissiveness में वायरस रिसेप्टर्स की अभिव्यक्ति के बारे में सीमाएं हैं, और कुछ ही अपर्याप्त रूप से OV, ट्यूमर, और प्रतिरक्षा microenvironment के परिसर में खेलने की नकल । इस प्रकार, उपयुक्त मॉडलों के सावधान विचार अनिवार्य है ।

एमवी-BTE उपचार पहले मानव xenograft और syngeneic माउस मॉडल में मूल्यांकन किया गया है. कोई BTE transgene उत्पादों BTE-एंकोडिंग एमवी३८के साथ इलाज चूहों के सीरम में detectable थे, स्वाभाविक रूप से oncotropic वैक्सीन तनाव वायरस के आगे क्षीणन के बिना भी प्रणालीगत जोखिम की सफल रोकथाम का संकेत है । स्थानीय अभिव्यक्ति के लिए महत्वपूर्ण है OV-इनकोडिंग immunomodulators जो विषाक्त कर रहे है जब प्रशासित प्रणालीबद्ध । यदि आवश्यक हो, ट्यूमर विशिष्टता को पुनः लक्ष्यीकरण द्वारा पसंद की सेल सतह मार्कर को बढ़ाया जा सकता है७०,७१,७२ और microRNA-आधारित de-लक्ष्यीकरण के लिए बढ़ाया oncotropism७३,७४ ( Ruiz और रसेल७५द्वारा समीक्षित) । अतिरिक्त संशोधनों के लिए विशिष्ट चिकित्सीय उपयोगों के लिए वैक्टर ऑप्टिमाइज़ करने के लिए पेश किया जा सकता है (Miest और Cattaneo द्वारा समीक्षित७६), नैदानिक प्रयोजनों के लिए transgenes के सम्मिलन सहित७७,७८ या दवा रसायन चिकित्सा के साइड इफेक्ट को कम करने के लिए रूपांतरण७९,८०, सुरक्षा स्विच८१का परिचय, और ट्यूमर स्ट्रोमा या vasculature के लक्ष्यीकरण (जैसे, bispecific एंटीबॉडी के माध्यम से८२).

एक तरफ वायरल वेक्टर के आनुवंशिक संशोधन के अलावा, chimeric प्रतिजन रिसेप्टर (कार) टी सेल हस्तांतरण८३, कीमोथेरेपी८४,८५,८६, या रेडियोथेरेपी८७के साथ संयोजन परहेजों, ८८ , ८९ आगे OVT की प्रदर्शनों की भी वृद्धि । के रूप में एमवी उन्मुक्ति अत्यधिक प्रचलित है, रणनीतियों एंटीबॉडी बेअसर दरकिनार करने के लिए संबंधित paramyxoviruses९०के उन लोगों के लिए लिफाफा नच का आदान प्रदान सहित विकसित किया गया है, कणों की बहुलक कोटिंग, सेल वाहक का उपयोग करने के लिए वायरस उद्धार, और क्षणिक प्रतिरक्षादमन (रसेल एट अल.6द्वारा समीक्षित) । आगे उंनत OV immunotherapy परहेजों के विकास के लिए उचित पशु मॉडल में सुरक्षा और चिकित्सीय प्रभावकारिता के परीक्षण की आवश्यकता है, रोगी सामग्री के साथ, और, अंततः, नियंत्रित नैदानिक परीक्षणों में ।

संभव संयोजनों की बहुतायत को देखते हुए व्यापक परीक्षण संभव नहीं है । गणितीय मॉडलिंग संभावित संयोजन परहेजों की प्राथमिकता के रूप में के रूप में अच्छी तरह से उनके संबंधित खुराक और शेड्यूलिंग silico में उपचार परिणामों की भविष्यवाणी द्वारा सहायता कर सकते हैं (सैंटियागो एट अल.९१द्वारा समीक्षित) । जब उपंयास के efficacies परीक्षण, तर्कसंगत डिजाइन वैक्टर, ध्वनि के साथ अनुवाद अनुसंधान अंतर्निहित virological और प्रतिरक्षा प्रक्रियाओं की गहरी समझ के लिए महत्वपूर्ण भूमिका निभाई है । यह उपयुक्त मॉडल की पीढ़ी के लिए महत्वपूर्ण है, आगे की क्षमता लक्ष्य पर जानकारी, और सामांय में क्षेत्र में उंनति । अंत में, वेक्टर डिजाइन, पीढ़ी के प्रासंगिक तरीकों में प्रत्यक्ष अंतर्दृष्टि, और काम के इस लाइन में लक्षण वर्णन के विकास में तेजी लाने और भविष्य नैदानिक अनुवाद के लिए उपंयास चिकित्सकीय के अंवेषण का समर्थन करेंगे ।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

C.E. Engeland हीडलबर्ग विश्वविद्यालय के स्वामित्व वाले कैंसर Immunovirotherapy के लिए आरएनए वायरस के बारे में एक पेटेंट के सह-आविष्कारक के रूप में सूचीबद्ध है । J.P.W. Heidbuechel का खुलासा करने के लिए कुछ नहीं है ।

Acknowledgments

इन तरीकों Virotherapy समूह में प्रो डॉ डॉ गाइ Ungerechts हीडलबर्ग में ट्यूमर रोगों के लिए राष्ट्रीय केंद्र में स्थापित किया गया था । हम उनके ऋणी हैं और प्रयोगशाला दल के सभी सदस्य, विशेष रूप से डॉ॰ टोबीस धब्बा, डॉ॰ Rūta Veinalde, जूडिथ Förster, Birgit Hoyler, और जेसिका अल्बर्ट । इस काम को और Kröner-Fresenius-Stiftung (ग्रांट 2015_A78 टू C.E. Engeland) और जर्मन नेशनल साइंस फाउंडेशन (DFG, ग्रांट एन 1119/2-1 को C.E. Engeland) ने सपोर्ट किया था । J.P.W. Heidbuechel कैंसर अनुसंधान के लिए Helmholtz इंटरनेशनल ग्रेजुएट स्कूल द्वारा एक वजीफा प्राप्त करता है ।

Materials

Name Company Catalog Number Comments
Rapid DNA Dephos & Ligation Kit Roche Life Science, Mannheim, Germany 4898117001
CloneJET PCR Cloning Kit Thermo Fisher Scientific, St. Leon-Rot K1231
Agarose Sigma-Aldrich, Taufkirchen, Germany A9539-500G
QIAquick Gel Extraction Kit QIAGEN, Hilden, Germany 28704
NEB 10-beta Competent E. coli New England Biolabs (NEB), Frankfurt/Main, Germany C3019I
LB medium after Lennox Carl Roth, Karlsruhe, Germany X964.1
Ampicillin Carl Roth, Karlsruhe, Germany HP62.1
QIAquick Miniprep Kit QIAGEN, Hilden, Germany 27104
Restriction enzyme HindIII-HF New England Biolabs (NEB), Frankfurt/Main, Germany R3104S
Dulbecco's Modified Eagle's Medium (DMEM) Invitrogen, Darmstadt, Germany 31966-021
Fetal bovine serum (FBS) Biosera, Boussens, France FB-1280/500
FugeneHD Promega, Mannheim, Germany E2311 may be replaced by transfection reagent of choice
Kanamycin Sigma-Aldrich, Taufkirchen, Germany K0129
Vero cells ATCC, Manassas, VA, USA CCL81
B16-CD46/ B16-CD20-CD46 J. Heidbuechel, DKFZ Heidelberg available upon request
Granta-519 DSMZ, Braunschweig, Germany ACC 342
Opti-MEM (serum-free medium) Gibco Life Technologies, Darmstadt, Germany 31985070
Colorimetric Cell Viability Kit III (XTT) PromoKine, Heidelberg, Germany PK-CA20-300-1000 includes XTT reagent
Dulbecco's Phosphate-Buffered Saline (PBS) Gibco Life Technologies, Darmstadt, Germany 14190-094
QIAquick Ni-NTA Spin Columns QIAGEN, Hilden, Germany 31014
Sodium chloride Carl Roth, Karlsruhe, Germany 3957.3
Imidazole Carl Roth, Karlsruhe, Germany I5513-25G
Amicon Ultra-15, PLGC Ultracel-PL Membran, 10 kDa Merck, Darmstadt, Germany UFC901024
BCA Protein Assay Kit Merck Milipore 71285-3
IgG from human serum Sigma-Aldrich, Taufkirchen, Germany I4506
Anti-HA-PE Miltenyi Biotech, Bergisch Gladbach, Germany 130-092-257 RRID: AB_871939
Mouse IgG1, kappa Isotype Control, Phycoerythrin Conjugated, Clone MOPC-21 antibody BD Biosciences, Heidelberg, Germany 555749 RRID: AB_396091
Anti-HA-biotin antibody, clone 3F10 Sigma-Aldrich, Taufkirchen, Germany 12158167001 RRID: AB_390915
Anti-Biotin MicroBeads Miltenyi Biotech, Bergisch Gladbach, Germany 130-090-485
MS Columns Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-201
MiniMACS Separator Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-102
MACS MultiStand Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-303
RIPA buffer Rockland Immunochemicals, Gilbertsville, PA, USA MB-030-0050
CytoTox 96 Non-Radioactive Cytotoxicity Assay Promega, Mannheim, Germany G1780 includes 10x lysis solution, substrate solution (substrate mix and assay buffer), and stop solution
Cell lifter Corning, Reynosa, Mexico 3008
10 cm dishes Corning, Oneonta, NY, USA 430167
15 cm dishes Greiner Bio-One, Frickenhausen, Germany 639160
96-well plates, U-bottom TPP, Trasadingen, Switzerland 92097
96-well plates, flat bottom Neolab, Heidelberg, Germany 353072
6-well plates Neolab, Heidelberg, Germany 353046
12-well plates Neolab, Heidelberg, Germany 353043
50 mL tubes nerbe plus, Winsen/Luhe, Germany 02-572-3001
T175 cell culture flasks Thermo Fisher Scientific, St. Leon-Rot 159910
0.22 µm filters Merck, Darmstadt, Germany SLGPM33RS

DOWNLOAD MATERIALS LIST

References

  1. Lichty, B. D., Breitbach, C. J., Stojdl, D. F., Bell, J. C. Going viral with cancer immunotherapy. Nature Reviews Cancer. 14, (8), 559-567 (2014).
  2. Cassady, K. A., Haworth, K. B., Jackson, J., Markert, J. M., Cripe, T. P. To Infection and Beyond: The Multi-Pronged Anti-Cancer Mechanisms of Oncolytic Viruses. Viruses. 8, (2), (2016).
  3. Twumasi-Boateng, K., Pettigrew, J. L., Kwok, Y. Y. E., Bell, J. C. Oncolytic viruses as engineering platforms for combination immunotherapy. Nature Reviews Cancer. (2018).
  4. Achard, C., et al. Lighting a Fire in the Tumor Microenvironment Using Oncolytic Immunotherapy. EBioMedicine. 31, 17-24 (2018).
  5. Kelly, E., Russell, S. J. History of oncolytic viruses: genesis to genetic engineering. Molecular Therapy. The Journal of the American Society of Gene Therapy. 15, (4), 651-659 (2007).
  6. Russell, S. J., Peng, K. W., Bell, J. C. Oncolytic virotherapy. Nature Biotechnology. 30, (7), 658-670 (2012).
  7. Russell, S. J., Peng, K. W. Oncolytic Virotherapy: A Contest between Apples and Oranges. Molecular Therapy: The Journal of the American Society of Gene Therapy. 25, (5), 1107-1116 (2017).
  8. Seymour, L. W., Fisher, K. D. Oncolytic viruses: finally delivering. British Journal of Cancer. 114, (4), 357-361 (2016).
  9. Chen, D. S., Mellman, I. Oncology meets immunology: the cancer-immunity cycle. Immunity. 39, (1), 1-10 (2013).
  10. Gao, Q., Park, M. S., Palese, P. Expression of transgenes from newcastle disease virus with a segmented genome. Journal of Virology. 82, (6), 2692-2698 (2008).
  11. Billeter, M. A., Naim, H. Y., Udem, S. A. Reverse genetics of measles virus and resulting multivalent recombinant vaccines: applications of recombinant measles viruses. Current Topics in Microbiology and Immunology. 329, 129-162 (2009).
  12. Matveeva, O. V., Guo, Z. S., Shabalina, S. A., Chumakov, P. M. Oncolysis by paramyxoviruses: multiple mechanisms contribute to therapeutic efficiency. Molecular Therapy Oncolytics. 2, (2015).
  13. Suter, S. E., et al. In vitro canine distemper virus infection of canine lymphoid cells: a prelude to oncolytic therapy for lymphoma. Clinical Cancer Research. 11, (4), 1579-1587 (2005).
  14. Ammayappan, A., Russell, S. J., Federspiel, M. J. Recombinant mumps virus as a cancer therapeutic agent. Molecular Therapy Oncolytics. 3, 16019 (2016).
  15. Schirrmacher, V. Oncolytic Newcastle disease virus as a prospective anti-cancer therapy. A biologic agent with potential to break therapy resistance. Expert Opinion on Biological Therapy. 15, (12), 1757-1771 (2015).
  16. Saga, K., Kaneda, Y. Oncolytic Sendai virus-based virotherapy for cancer: recent advances. Oncolytic Virotherapy. 4, 141-147 (2015).
  17. Matveeva, O. V., Kochneva, G. V., Netesov, S. V., Onikienko, S. B., Chumakov, P. M. Mechanisms of Oncolysis by Paramyxovirus Sendai. Acta Naturae. 7, (2), 6-16 (2015).
  18. Gainey, M. D., Manuse, M. J., Parks, G. D. A hyperfusogenic F protein enhances the oncolytic potency of a paramyxovirus simian virus 5 P/V mutant without compromising sensitivity to type I interferon. Journal of Virology. 82, (19), 9369-9380 (2008).
  19. Engeland, C. E., et al. A Tupaia paramyxovirus vector system for targeting and transgene expression. The Journal of General Virology. 98, (9), 2248-2257 (2017).
  20. Russell, S. J., Peng, K. W. Measles virus for cancer therapy. Current Topics in Microbiology and Immunology. 330, 213-241 (2009).
  21. Aref, S., Bailey, K., Fielding, A. Measles to the Rescue: A Review of Oncolytic Measles Virus. Viruses. 8, (10), (2016).
  22. Demicheli, V., Rivetti, A., Debalini, M. G., Di Pietrantonj, C. Vaccines for measles, mumps and rubella in children. The Cochrane Database of Systematic Reviews. (2), 004407 (2012).
  23. Radecke, F., et al. Rescue of measles viruses from cloned DNA. The EMBO Journal. 14, (23), 5773-5784 (1995).
  24. Martin, A., Staeheli, P., Schneider, U. RNA polymerase II-controlled expression of antigenomic RNA enhances the rescue efficacies of two different members of the Mononegavirales independently of the site of viral genome replication. Journal of Virology. 80, (12), 5708-5715 (2006).
  25. Russell, S. J., et al. Remission of disseminated cancer after systemic oncolytic virotherapy. Mayo Clinic Proceedings. 89, (7), 926-933 (2014).
  26. Hardcastle, J., et al. Immunovirotherapy with measles virus strains in combination with anti-PD-1 antibody blockade enhances antitumor activity in glioblastoma treatment. Neuro-Oncology. 19, (4), 493-502 (2017).
  27. Dispenzieri, A., et al. Phase I trial of systemic administration of Edmonston strain of measles virus genetically engineered to express the sodium iodide symporter in patients with recurrent or refractory multiple myeloma. Leukemia. 31, (12), 2791-2798 (2017).
  28. Galanis, E., et al. Phase I trial of intraperitoneal administration of an oncolytic measles virus strain engineered to express carcinoembryonic antigen for recurrent ovarian cancer. Cancer Research. 70, (3), 875-882 (2010).
  29. Galanis, E., et al. Oncolytic measles virus expressing the sodium iodide symporter to treat drug-resistant ovarian cancer. Cancer Research. 75, (1), 22-30 (2015).
  30. Kurokawa, C., et al. Constitutive Interferon Pathway Activation in Tumors as an Efficacy Determinant Following Oncolytic Virotherapy. Journal of the National Cancer Institute. (2018).
  31. Msaouel, P., et al. Clinical Trials with Oncolytic Measles Virus: Current Status and Future Prospects. Current Cancer Drug Targets. 18, (2), 177-187 (2018).
  32. Grote, D., Cattaneo, R., Fielding, A. K. Neutrophils contribute to the measles virus-induced antitumor effect: enhancement by granulocyte macrophage colony-stimulating factor expression. Cancer Research. 63, (19), 6463-6468 (2003).
  33. Grossardt, C., et al. Granulocyte-macrophage colony-stimulating factor-armed oncolytic measles virus is an effective therapeutic cancer vaccine. Human Gene Therapy. 24, (7), 644-654 (2013).
  34. Iankov, I. D., et al. Expression of immunomodulatory neutrophil-activating protein of Helicobacter pylori enhances the antitumor activity of oncolytic measles virus. Molecular Therapy: The Journal of the American Society of Gene Therapy. 20, (6), 1139-1147 (2012).
  35. Engeland, C. E., et al. CTLA-4 and PD-L1 Checkpoint Blockade Enhances Oncolytic Measles Virus Therapy. Molecular Therapy: The Journal of the American Society of Gene Therapy. 22, (11), 1949-1959 (2014).
  36. Veinalde, R., et al. Oncolytic measles virus encoding interleukin-12 mediates potent antitumor effects through T cell activation. Oncoimmunology. 6, (4), 1285992 (2017).
  37. Hutzler, S., et al. Antigen-specific oncolytic MV-based tumor vaccines through presentation of selected tumor-associated antigens on infected cells or virus-like particles. Scientific Reports. 7, (1), 16892 (2017).
  38. Speck, T., et al. Targeted BiTE expression by an oncolytic vector augments therapeutic efficacy against solid tumors. Clinical Cancer Research. (2018).
  39. Andtbacka, R. H., et al. Talimogene Laherparepvec Improves Durable Response Rate in Patients With Advanced Melanoma. Journal of Clinical Oncology: Official Journal of the American Society of Clinical Oncology. 33, (25), 2780-2788 (2015).
  40. Ribas, A., et al. Oncolytic Virotherapy Promotes Intratumoral T Cell Infiltration and Improves Anti-PD-1 Immunotherapy. Cell. 170, (6), 1109-1119 (2017).
  41. Patel, S. J., et al. Identification of essential genes for cancer immunotherapy. Nature. 548, (7669), 537-542 (2017).
  42. Kimple, M. E., Brill, A. L., Pasker, R. L. Overview of affinity tags for protein purification. Current Protocols in Protein Science. 73, Unit 9.9 (2013).
  43. Cattaneo, R., Rebmann, G., Baczko, K., ter Meulen, V., Billeter, M. A. Altered ratios of measles virus transcripts in diseased human brains. Virology. 160, (2), 523-526 (1987).
  44. Gutsche, I., et al. Structural virology. Near-atomic cryo-EM structure of the helical measles virus nucleocapsid. Science. 348, (6235), New York, N.Y. 704-707 (2015).
  45. Kolakofsky, D., et al. Paramyxovirus RNA synthesis and the requirement for hexamer genome length: the rule of six revisited. Journal of Virology. 72, (2), 891-899 (1998).
  46. Kolakofsky, D., Roux, L., Garcin, D., Ruigrok, R. W. Paramyxovirus mRNA editing, the "rule of six" and error catastrophe: a hypothesis. The Journal of General Virology. 86, Pt 7 1869-1877 (2005).
  47. Parks, C. L., et al. Analysis of the noncoding regions of measles virus strains in the Edmonston vaccine lineage. Journal of Virology. 75, (2), 921-933 (2001).
  48. JoVE Science Education Database. Molecular Cloning. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  49. JoVE Science Education Database. Bacterial Transformation: The Heat Shock Method. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  50. Bergkessel, M., Guthrie, C. Colony PCR. Methods in Enzymology. 529, 299-309 (2013).
  51. Rota, J. S., Wang, Z. D., Rota, P. A., Bellini, W. J. Comparison of sequences of the H, F, and N coding genes of measles virus vaccine strains. Virus Research. 31, (3), 317-330 (1994).
  52. Bankamp, B., Takeda, M., Zhang, Y., Xu, W., Rota, P. A. Genetic characterization of measles vaccine strains. The Journal of Infectious Diseases. 204, Suppl 1 533-548 (2011).
  53. Dulbecco, R., Vogt, M. Plaque formation and isolation of pure lines with poliomyelitis viruses. The Journal of Experimental Medicine. 99, (2), 167-182 (1954).
  54. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical Biochemistry. 150, (1), 76-85 (1985).
  55. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry. 72, 248-254 (1976).
  56. JoVE Science Education Database. Separating Protein with SDS-PAGE. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  57. JoVE Science Education Database. The Western Blot. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  58. Menck, K., et al. Isolation of human monocytes by double gradient centrifugation and their differentiation to macrophages in teflon-coated cell culture bags. Journal of Visualized Experiments. (91), e51554 (2014).
  59. Quah, B. J., Parish, C. R. The use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to monitor lymphocyte proliferation. Journal of Visualized Experiments. (44), (2010).
  60. Gerdes, J. Ki-67 and other proliferation markers useful for immunohistological diagnostic and prognostic evaluations in human malignancies. Seminars in Cancer Biology. 1, (3), 199-206 (1990).
  61. JoVE Science Education Database. The Transwell Migration Assay. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  62. Lim, J. F., Berger, H., Su, I. H. Isolation and Activation of Murine Lymphocytes. Journal of Visualized Experiments. (116), e54596 (2016).
  63. Ungerechts, G., et al. Moving oncolytic viruses into the clinic: clinical-grade production, purification, and characterization of diverse oncolytic viruses. Molecular Therapy Methods & Clinical Development. 3, 16018 (2016).
  64. Fridman, W. H., Zitvogel, L., Sautes-Fridman, C., Kroemer, G. The immune contexture in cancer prognosis and treatment. Nature Reviews Clinical Oncology. 14, (12), 717-734 (2017).
  65. Yu, F., et al. T-cell engager-armed oncolytic vaccinia virus significantly enhances antitumor therapy. Molecular Therapy: The Journal of the American Society of Gene Therapy. 22, (1), 102-111 (2014).
  66. Fajardo, C. A., et al. Oncolytic Adenoviral Delivery of an EGFR-Targeting T-cell Engager Improves Antitumor Efficacy. Cancer Research. 77, (8), 2052-2063 (2017).
  67. Freedman, J. D., et al. Oncolytic adenovirus expressing bispecific antibody targets T-cell cytotoxicity in cancer biopsies. EMBO Molecular Medicine. 9, (8), 1067-1087 (2017).
  68. Wing, A., et al. Improving CART-Cell Therapy of Solid Tumors with Oncolytic Virus-Driven Production of a Bispecific T-cell Engager. Cancer Immunology Research. 6, (5), 605-616 (2018).
  69. Myers, R. M., et al. Preclinical pharmacology and toxicology of intravenous MV-NIS, an oncolytic measles virus administered with or without cyclophosphamide. Clinical Pharmacology and Therapeutics. 82, (6), 700-710 (2007).
  70. Rittner, K., Schreiber, V., Erbs, P., Lusky, M. Targeting of adenovirus vectors carrying a tumor cell-specific peptide: in vitro and in vivo studies. Cancer Gene Therapy. 14, (5), 509-518 (2007).
  71. Nakamura, T., et al. Rescue and propagation of fully retargeted oncolytic measles viruses. Nature Biotechnology. 23, (2), 209-214 (2005).
  72. Campadelli-Fiume, G., et al. Retargeting Strategies for Oncolytic Herpes Simplex Viruses. Viruses. 8, (3), 63 (2016).
  73. Leber, M. F., et al. MicroRNA-sensitive oncolytic measles viruses for cancer-specific vector tropism. Molecular Therapy: The Journal of the American Society of Gene Therapy. 19, (6), 1097-1106 (2011).
  74. Baertsch, M. A., et al. MicroRNA-mediated multi-tissue detargeting of oncolytic measles virus. Cancer Gene Therapy. 21, (9), 373-380 (2014).
  75. Ruiz, A. J., Russell, S. J. MicroRNAs and oncolytic viruses. Current Opinion in Virology. 13, 40-48 (2015).
  76. Miest, T. S., Cattaneo, R. New viruses for cancer therapy: meeting clinical needs. Nature Reviews Microbiology. 12, (1), 23-34 (2014).
  77. Phuong, L. K., et al. Use of a vaccine strain of measles virus genetically engineered to produce carcinoembryonic antigen as a novel therapeutic agent against glioblastoma multiforme. Cancer Research. 63, (10), 2462-2469 (2003).
  78. Dingli, D., et al. Image-guided radiovirotherapy for multiple myeloma using a recombinant measles virus expressing the thyroidal sodium iodide symporter. Blood. 103, (5), 1641-1646 (2004).
  79. Abate-Daga, D., et al. Oncolytic adenoviruses armed with thymidine kinase can be traced by PET imaging and show potent antitumoural effects by ganciclovir dosing. PLoS One. 6, (10), 26142 (2011).
  80. Ungerechts, G., et al. Lymphoma chemovirotherapy: CD20-targeted and convertase-armed measles virus can synergize with fludarabine. Cancer Research. 67, (22), 10939-10947 (2007).
  81. Ketzer, P., et al. Artificial riboswitches for gene expression and replication control of DNA and RNA viruses. Proceedings of the National Academy of Sciences of the United States of America. 111, (5), 554-562 (2014).
  82. Freedman, J., et al. Targeting T-cells to human cancer associated fibroblasts using an oncolytic virus expressing a FAP-specific T-cell engager. Keystone Symposia & Digitell, Inc. (2018).
  83. Nishio, N., et al. Armed oncolytic virus enhances immune functions of chimeric antigen receptor-modified T cells in solid tumors. Cancer Research. 74, (18), 5195-5205 (2014).
  84. Bressy, C., Benihoud, K. Association of oncolytic adenoviruses with chemotherapies: an overview and future directions. Biochemical Pharmacology. 90, (2), 97-106 (2014).
  85. Wennier, S. T., Liu, J., McFadden, G. Bugs and drugs: oncolytic virotherapy in combination with chemotherapy. Current Pharmaceutical Biotechnology. 13, (9), 1817-1833 (2012).
  86. Fillat, C., Maliandi, M. V., Mato-Berciano, A., Alemany, R. Combining oncolytic virotherapy and cytotoxic therapies to fight cancer. Current Pharmaceutical Design. 20, (42), 6513-6521 (2014).
  87. Li, H., Peng, K. W., Russell, S. J. Oncolytic measles virus encoding thyroidal sodium iodide symporter for squamous cell cancer of the head and neck radiovirotherapy. Human Gene Therapy. 23, (3), 295-301 (2012).
  88. Opyrchal, M., et al. Effective radiovirotherapy for malignant gliomas by using oncolytic measles virus strains encoding the sodium iodide symporter (MV-NIS). Human Gene Therapy. 23, (4), 419-427 (2012).
  89. Mansfield, D., et al. Oncolytic Vaccinia virus and radiotherapy in head and neck cancer. Oral Oncology. 49, (2), 108-118 (2013).
  90. Miest, T. S., et al. Envelope-chimeric entry-targeted measles virus escapes neutralization and achieves oncolysis. Molecular Therapy: The Journal of the American Society of Gene Therapy. 19, (10), 1813-1820 (2011).
  91. Santiago, D. N., et al. Fighting Cancer with Mathematics and Viruses. Viruses. 9, (9), (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics