Paramyxovirus för tumör-riktade immunmodulering: Design och utvärdering Ex Vivo

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Det här protokollet beskriver en detaljerad arbetsflöde för generering och ex vivo karakterisering av onkolytisk virus för uttryck av immunomodulatorer, med mässlingvirus kodning bispecific T cell engagers som exempel. Ansökan och anpassning till andra vektor plattformar och transgener kommer att påskynda utvecklingen av nya immunovirotherapeutics för kliniska översättning.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Heidbuechel, J. P., Engeland, C. E. Paramyxoviruses for Tumor-targeted Immunomodulation: Design and Evaluation Ex Vivo. J. Vis. Exp. (143), e58651, doi:10.3791/58651 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Framgångsrika cancer immunoterapi har potential att uppnå långsiktig tumör kontroll. Trots senaste kliniska framgångar återstår det ett brådskande behov av säkra och effektiva behandlingar som skräddarsys individuella tumör immun profiler. Onkolytisk virus aktiverar induktion av anti-tumor immunsvar samt tumör begränsad genuttryck. Det här protokollet beskriver den generation och ex vivo analysen av immunmodulerande onkolytisk vektorer. Fokusera på mässling vaccinvirus kodning bispecific T cell engagers som ett exempel, kan allmän metod anpassas till andra virus arter och transgener. Presenterade arbetsflödet innehåller design, kloning, räddning, och förökningen av rekombinanta virus. Analyser att analysera replikering kinetik och lytisk aktivitet av vektor samt funktionaliteten i den isolerade immunmodulerande ex vivo ingår, vilket underlättar generationen av romanen agenter för vidareutveckling i prekliniska modeller och slutligen kliniska översättning.

Introduction

Onkolytisk virus (OVs) utvecklas som mot cancer therapeutics som specifikt replikera inom och döda tumörceller medan frisk vävnad intakt. Det har nu blivit vanligt förstå att onkolytisk virotherapy (ÖVT), i de flesta fall, förlitar sig inte enbart på komplett tumör lysis genom effektiv replikering och sprider viruset, men kräver ytterligare verkningsmekanismer för behandlingframgång, inklusive vaskulära och stromal inriktning och allt immun stimulering1,2,3,4. Medan många tidiga OV studier används omodifierade virus, har aktuell forskning gynnats av en förbättrad biologisk förståelse, virus biobanker som potentiellt innehåller roman OVs, och de möjligheter som erbjuds av genteknik för att skapa avancerade OV plattformar5,6,7.

Med tanke på den senaste tidens framgången immunterapi, är immunmodulerande transgener av särskilt intresse när det gäller gentekniken av OVs. Riktade uttryck för sådana genprodukter av OV-infekterad tumörceller minskar toxicitet jämfört med systemisk administrering. Inriktning uppnås antingen genom att använda virus med inneboende oncoselectivity eller genom att ändra viral tropism8. Lokala immunmodulering förbättrar OVT mångfacetterade anti-tumor mekanismer. Denna strategi är dessutom instrumental i förhör samspelet mellan virus, tumörceller och värd immunsystemet. Därför ger detta protokoll ett tillämpligt och justerbar arbetsflöde för att designa, klona, rädda, propagera och validera onkolytisk paramyxovirus (specifikt mässlingvirus) vektorer kodning sådan transgener.

Modulering av immunsvaret kan uppnås genom ett brett utbud av transgenens produkter inriktning olika steg av cancer-immunitet cykel9, inklusive förbättra tumör antigen erkännande [t.ex. tumör-associerade antigener (TAAs) eller inducerare av stora histocompatibility komplex (MHC) klass I molekyler] över stödja dendritiska cellen mognad för effektiv antigen-presentation (cytokiner); rekrytera och aktivera önskad immunceller som cytotoxiska och helper T-celler [chemokiner, bispecific T cell engagers (bö)]; inriktning suppressiv celler regulatoriska T-celler, myeloid-derived suppressor, tumör-associerad makrofager, och cancer-associerade fibroblaster (antikroppar, bö, cytokiner); och förhindra effektor celler hämning och utmattning (checkpoint-hämmare). Således finns en uppsjö av biologiska agens. Det är nödvändigt att förbättra cancerbehandling utvärdering av sådana virus-kodade immunomodulatorer angående terapeutisk effekt och eventuella synergieffekter samt förståelse av respektive mekanismer.

Negativ bemärkelse enkelsträngat RNA-virus av familjen Paramyxoviridae kännetecknas av flera funktioner bidrar till deras användning som onkolytisk vektorer. Dessa inkluderar en naturlig oncotropism, stor genomisk kapacitet för transgener (mer än 5 kb)10,11, effektiv spridning inklusive syncytia bildning och hög immunogenicitet12. Därför OV plattformar baserade på valpsjuka virus13, påssjuka virus14, Newcastle sjukdom virus15, Sendai virus16,17, simian virus 518och Tupaia paramyxovirus19 har utvecklats. Mest framträdande, levande försvagat mässlingvirusvaccin stammar (MV) har utvecklats i preklinisk och klinisk utveckling20,21. Dessa virusstammar har använts i decennier för rutin immunisering med en utmärkt säkerhet rekord22. Dessutom finns det ingen risk för insertionsmutationer på grund av strikt cytosoliska replikering av paramyxovirus. En mångsidig omvänd genetik system baserat på anti genomisk cDNA som möjliggör införande av transgener i ytterligare transkription enheter (ATUs) är tillgängliga11,23,24. MV vektorer kodning natriumjodid symporter (MV-NIS) för imaging och strålbehandling eller lösliga carcinoembryonalt antigen (MV-CEA) som surrogatmarkör för viral genuttryck utvärderas för närvarande i kliniska prövningar (NCT02962167, NCT02068794, NCT02192775, NCT01846091, NCT02364713, NCT00450814, NCT02700230, NCT03456908, NCT00408590 och NCT00408590). Säker administration har bekräftats och anti-tumör effekt har rapporterats i tidigare studier25,26,27,28,29, 30 (granskas av Msaouel et al.31), bana väg för ytterligare onkolytisk mässlingvirus som har utvecklats och testats prekliniskt. MV kodning immunmodulerande molekyler inriktning olika steg av cancer-immunitet cykeln har visat sig fördröja tumörens tillväxt och/eller förlänga överlevnaden hos möss, med bevis för immunmedierade effekt och långsiktiga skyddande immunologiskt minne i syngena mus-modeller. Vektor-kodade transgener inkluderar granulocyt-makrofag kolonistimulerande faktor (GM-CSF)32,33, H. pylori neutrofiler-aktiverande protein34, immun checkpoint-hämmare35, interleukin-12 (IL-12)36, TAAs37och BTEs38, som tvärbinda en tumör ytantigen med CD3 och därmed framkalla antitumöraktivitet av polyklonala T-celler, oavsett T-cell receptor specificitet och samtidig stimulering ( (Se figur 1). Lovande prekliniska resultaten för dessa konstruktioner efterfrågan ytterligare translationell insatser.

Talimogen laherparepvek (T-VEC), en typ jag herpes simplex-virus kodning GM-CSF, är den enda onkolytisk terapeutiska godkänd av amerikanska Food och Drug Administration (FDA) och Europeiska läkemedelsmyndigheten (EMA). I fas III-studie som leder till godkännanden i slutet av 2015 har inte bara visat effekt på platsen för intra-tumoral injektion, men även abscopal effekter (dvs remissioner av icke-injicerade lesioner) i avancerat melanom39. T-VEC har sedan dess trätt ytterligare prövningar för tillämpning i andra tumör enheter (t.ex., icke-melanom hudcancer, NCT03458117, pankreascancer, NCT03086642) och för utvärdering av kombinationsbehandlingar, särskilt med immun checkpoint hämmare (NCT02978625, NCT03256344, NCT02509507, NCT02263508, NCT02965716, NCT02626000, NCT03069378, NCT01740297 och Ribas et al.40).

Detta visar inte bara potentialen i onkolytisk immunterapi men också behovet av ytterligare forskning för att identifiera överlägsen kombinationer av OVT och immunmodulering. Rationell design ytterligare vektorer och utveckling för preklinisk testning är nyckeln till detta åtagande. Detta kommer också förväg förståelse för bakomliggande mekanismer och konsekvenser för utvecklingen mot mer personlig cancerbehandling. Därför presenterar denna skrift en metod för en modifiering och utveckling av paramyxovirus för riktade cancer immunoterapi och mer specifikt av onkolytisk mässlingvirus kodning T cell-engagerande antikroppar (figur 2).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Obs: [O], [P], och [M] ange underavsnitt gäller: OVs i allmänhet, (de flesta) paramyxovirus, eller MV endast, respektive. [B] anger sektioner som är specifika för BTE transgener.

1 kloning av immunmodulerande-encoding transgener i mässling virusvektorer

  1. [O] design infoga sekvens.
    1. [O] besluta om en immunmodulerande av intresse utifrån litteraturforskning eller explorativa data såsom genetiska skärmar41 och härleda relevanta cDNA sekvensen från lämpliga databaser såsom GenBank, Europeiska Nucleotide arkivet, eller internationella immunogenetik informationssystem (IMGT).
    2. [O] lägga till ytterligare funktioner till transgenens sekvensen (figur 3). En föregående Kozak sekvens och artspecifika kodon optimering kan förbättra uttryck. Signal-sekvenser som krävs för sekretion. Omfatta sekvenser kodning N- eller C-terminal protein taggar för upptäckt och rening42. Inkludera begränsning platser för insättning i vektorn.
      Obs: [M] ytterligare transkription enheter (ATUs) härbärgerat MV polymerase gene start och stopp signaler är nödvändiga för transgenens uttryck från rekombinant MV genomen. Lämplig anti genomisk cDNA vektorer, kontrolleras av CMV initiativtagare och innehållande ATUs med unik begränsning platser för införandet av positiv bemärkelse transgener på definierade positioner, har utvecklats tidigare11. [P] lämplig placering av transgenens är avgörande, eftersom det påverkar viral replikation och transgenens uttryck på grund av uttrycket övertoningen typiska för paramyxovirus43. Införsel till en ATU nära 3' ände anti genomet (i.e., i ledande position eller nedströms av P genen) resulterar i hög transgenens uttryck på bekostnad av minskad virusreplikation. Ökad replikering och lägre nivåer av transgenens uttryck kan förväntas när du använder ATU nedströms av H -genen. Förpackningar av genomet hos flera paramyxovirus, inklusive mässlingvirus, kräver bindning av sex nukleotider av varje nucleocapsid protein44. För införande av transgener i sådana virus, se till att antalet nukleotider komplett genomets blir delbart med sex. Detta kallas också att ”regeln sex”45,46. Om det behövs anger du ytterligare nukleotider i Infoga (uppströms Kozak sekvensen eller nedströms den stop kodon) utan att införa ram Skift eller förtida stop kodon. [M] Undvik särskilt sekvenser i transgen som liknar MV gen start (AGGRNCMARGW) och stoppa (RTTAWANAAAA) signaler och RNA redigering sekvenser (AAAAAGGG). Sådan enighet sekvenser har publicerats (t.ex. se parker et al.47).
    3. [O] köpa oligonukleotid av önskad sekvensen eller montera från tillgängliga sekvenser med standard molekylär kloning48.
      Obs: [O] för PCR-amplifiering av transgenens, designa en forward primer inklusive webbplatsen uppströms begränsning och de första 15-20 nukleotiderna av insatsen och en omvänd primer inklusive de senaste 15-20 nukleotider av skäret följt av nedströms begränsningen webbplats.
  2. [O] klon in i DNA-kodning genomet virus (anti-).
    1. [O] klona skäret i DNA vektorer eller DNA anti genomen hos RNA-virus av standard molekylär kloning tekniker48 (dvs., enzymatisk begränsning följt av DNA-ligering).
      1. [O] förhindra förnyad ligering av vektorn med hjälp av icke-kompatibla begränsning webbplatser eller genom de phosphorylation före ligering.
      2. [O] isolera ligering produkten av agaros gel-elektrofores och efterföljande gel rening med kommersiellt tillgängliga kits. Optimal ligering effektivitet uppnås i allmänhet på en 3:1 molar förhållandet av Infoga till vektor.
    2. [O] transform ligering produkten till behöriga bakterier lämpad för effektiv återvinning av stora plasmider (dvs., utför värme chock av E. coli49) och identifiera bakteriell kloner härbärgerat rätt DNA av kolonin PCR50 .
    3. [O] isolatet förstärks DNA från en enda bakterie klon med kommersiellt tillgängliga DNA förberedelse kits. Bekräfta genomisk integritet genom kontroll digest med lämplig begränsning enzymer (t.ex., HindIII för MV genomen [M]). Bekräfta rätt införande och integriteten hos transgenens genom sekvensering.
      Obs: [M] för transgener som infogas i den MV H- ATU, utföra Sanger sekvensering med följande grundfärger: H-9018 [forward primer, binder till MV genomet position 9018 i H öppen läsa frame (ORF)]: 5' GTGTGCTTGCGGACTCAGAATC 3'; L-9249 + (reverse primer, binder till MV genomet position 9249 i L ORF): 5' CAGATAGCGAGTCCATAACGG 3'.

2. undsättning rekombinant mässling viruspartiklar kodning immunmodulerande

  1. [O] generera rekombinant viruspartiklar från (anti-) genomisk DNA via transfection virus producent celler enligt standardprotokollet för respektive viruset. Följ riktlinjerna för att arbeta under sterila förhållanden. Utföra cellkultur under huvor, i synnerhet alla steg som omfattar virus i klass II biologiska säkerhetsbänkar.
    1. [M] för räddning av mässlingvirus från cDNA23,24, tallrik MV producent (afrikanska green monkey njure-härlett Vero) celler jämnt på en 6-väl tallrik 24 h innan transfection. Utsäde 2 x 105 celler i 2 mL Dulbeccos modifierade örnens Medium (DMEM) innehållande 10% fetalt bovint serum (FBS) per brunn att uppnå 65 – 75% konfluens vid tidpunkten för transfection.
      Obs: [P] minska cell nummer om cellerna växa över före virus-inducerad syncytia bildning.
    2. [P] Transfect celler med DNA kodning viral anti genomet, obligatoriska helper plasmidsna, och, om så önskas, en plasmid kodning en fluorescerande reporter att bedöma transfection effektivitet.
      1. [M] Mix 5 µg av rekombinant DNA-kodning mässling virus anti genomet, 500 ng varje av däggdjur uttryck plasmider kodning mässlingvirus N och L proteiner och 100 ng varje av plasmider kodning P protein och fluorescerande reporter i en total volym på 200 µL DMEM.
      2. Tillsätt 18,6 µL av liposomalt transfection reagens, omedelbart blanda genom att snärta röret och inkubera i 25 min i rumstemperatur (RT).
      3. [P] ersätta mediet med 1,8 mL DMEM, 2% FBS, 50 µg/mL kanamycin (eller andra antibiotika att förhindra kontaminering) per brunn, och sedan lägga till transfection mixen droppvis till brunnen och snurra försiktigt. Inkubera cellerna över natten vid 37 ° C, 5% CO2. Ersätta mediet med 2 mL färsk DMEM, 2% FBS och 50 µg/mL kanamycin nästa dag; Upprepa detta när medium blir sura.
        Varning: [O] hantera celler och material enligt biosäkerhet förordningar, eftersom virus kan finnas från transfection igenom följande steg. Kassera (potentiellt) smittförande avfall på rätt sätt.
  2. [P] samla och sprida viruspartiklar.
    1. [P] respektera celler dagligen genom mikroskopi för reporter gen uttryck och syncytia (figur 4). Skörda virus när stora syncytia, som består av 20 eller fler celler, är synliga, eller när celler blir alltför tät (i.e., när de börjar växa i flera lager, vanligen efter 7-9 dagar).
      Obs: [P] om ingen syncytia observeras för en given vektor konstruktion, betyder detta nödvändigtvis inte att rädda har misslyckats. Som infektiöst virus kan ändå vara i provet, överföra till färska producent celler för passaging.
    2. [P] utsäde ungefär 1,5 x 106 producent celler i 12 mL DMEM med 10% FBS, på 10 cm rätter 24 h innan den förvänta skörden eller 2,5 x 106 celler per tallrik 4 – 6 h före passaging av viruset att uppnå 65-75% konfluens vid tidpunkten för virus inoculat Ion.
    3. [P] för att samla in virus avkomman, försiktigt skrapa vidhäftande producent celler från plattan med hjälp av en cell-skrapa och överför supernatanten innehållande celler i ett centrifugrör. Ta bort cellfragment genom centrifugering för 5 min vid 2 500 x g och 4 ° C.
      Obs: Skrapade celler kan överföras direkt utan centrifugering att maximera virus överföring på bekostnad av suboptimal odlingsbetingelser och potentiella mikroskopi artefakter.
      Försiktighet: [O] Undvik spill media när skrapning celler. Minimera aerosolbildning.
    4. [P] förbereda inokulum genom att blanda cellfria supernatanten från steg 2.2.3 med serumfritt medium till en slutlig volym av 4 mL. Ersätta mediet på producenten celler med inokulatet och inkubera cellerna för i minst 2 timmar vid 37 ° C och 5% CO2. Tillsätt 6 mL DMEM med 10% FBS och inkubera cellerna över natten innan du ändrar mediet till 12 mL färsk DMEM med 10% FBS.
    5. [P] iaktta celler minst två gånger dagligen och skörden virus innan burst-syncytia (dvs., när membranet störningar blir synlig). För att skörda första passagen av virus, ta bort supernatanten från plattan, tillsätt 600 µL av serumfritt medium, skrapa celler med en cell lyftare och överför till en ren röret.
      Obs: [M] beroende på virus stam51,52 och progression av infektion, överföra plattor med infekterade celler till 32 ° C att underlätta virusreplikation och spridning. Generellt sprida MV Schwarz stammar väl vid 37 ° C, medan överföring av celler som smittats med Edmonston B stam virus till 32 ° C leder till långsammare syncytia bildning men högre titrar.
      Obs: [P] Tillåt inte det cell-lagret torka under skörden, eftersom detta kommer att resultera i minskad smittsamhet av viruspartiklar. Även om vissa virus går förlorad när kasta bort supernatanten av infekterade celler, kan högre titrar erhållas från det cell-lagret.
    6. [P] omedelbart frysa virussuspension i flytande kväve. Förvaras vid-80 ° C under minst 24 h att säkerställa noggrann frysning. Utöka till flera dagar att avbryta förfarandet, om det behövs.
    7. Släppa viruspartiklar av upptining vid 37 ° C. Homogenisera genom vortexa och Centrifugera i 5 min vid 2 500 x g och 4 ° C. Överföra supernatanterna till märkta frysrör och förvaras vid-80 ° C.
      Obs: [O] lagra virus i alikvotens storlekar lämpliga för senare experiment, som de prioriterat tinas endast en gång och används omedelbart. [P] ytterligare frysning-tining cykler eller lagring vid 4 ° C över flera dagar resultatet betydande minskning av viral titrar.
    8. [P] en dag före ytterligare passaging för att uppnå erforderliga beloppet och titer, utsäde 4 x 106 producent celler i 12 mL DMEM med 10% FBS på 15 cm rätter. Inokulera med virus på en multiplicity av infektion (MOI) 0,03. Smitta i 8 mL serumfritt medium per platta och ändra medium till DMEM med 10% FBS efter inkubation celler för minst 2 h. skala upp med hjälp av flera plattor.
    9. Skörd som beskrivs i steg 2.2.5, när syncytia har spridit sig över hela cellen lagret. Poolen de erhållna suspensioner i 50 mL rör och processen som beskrivs i steg 2.2.6–2.2.7.
      Obs: [O] det är viktigt att kontrollera alla plattor visuellt för bakterie- och svampinfektioner kontaminering före skörd. I allmänhet, kontrollera alla cellinjer regelbundet för kontaminering med mykoplasma eller oavsiktlig virus med multiplex PCR.
  3. [P] utvärdera viral titrar. Bestämma titrar av virus bestånd i octuplicates per alikvot med 96 brunnar. Utföra titrering av tre enskilda portioner per virus räddning och använda det genomsnittliga värdet för att beräkna mängden virussuspension som ska användas i experiment.
    1. [P] pool producenten celler, räkna, och justera till 1,5 x 105 celler per mL i DMEM med 10% FBS.
    2. [P] Pipettera 90 µL DMEM med 10% FBS i varje brunn av en plattan med 96 brunnar.
    3. [P] Lägg till 10 µL från en alikvot av virus beståndet till alla 8 brunnar i den första kolumnen av plattan och blanda omsorgsfullt genom pipettering upp och ner minst 10 gånger.
    4. [P] utför 10-faldig seriespädningar av viruset. Överför 10 µL av varje brunn från först till den andra kolumnen använda en flerkanalig Pipettera. Blanda omsorgsfullt genom pipettering upp och ner och använder färska Pipettera tips för varje utspädningssteg. Kassera 10 μl från varje brunn på den sista kolumnen.
      Obs: Varje plattan med 96 brunnar möjliggör 12 seriell utspädning stammen. [M] för MV vektorer, 8 steg 10-faldig utspädningar är vanligtvis tillräckligt, som titrar ovan 1 x 109 cell infektiösa enheter (ciu) /mL erhålls sällan av metoden för förökning beskrivs i steg 2.2. [P] kontrollbrunnar utan virus kan användas för jämförelse och att övervaka kontaminering.
    5. [P] Tillsätt 100 µL cellsuspension till varje brunn och inkubera vid 37 ° C, 5% CO2 för 48 h. se till att avsaknad av cell klumpar i suspensionen att uppnå homogen fördelning av celler.
    6. [P] Kontrollera för syncytia med ett ljusmikroskop. Räkna syncytia i varje brunn i kolumnen med högsta utspädningsfaktorn innehållande synliga syncytia.
    7. [P] beräkna det genomsnittliga antalet syncytia per brunn i kolumnen genom att dividera det totala antalet syncytia med åtta. Multiplicera det Genomsnittligt med utspädningsfaktorn för kolumnen respektive börjar vid 102 fondföretaget per mL för den första kolumnen53 (se diagram 5 som ett exempel).

3. bestämma replikationsförmåga och cytotoxiska kapacitetarna av virala vektorer kodning immunmodulerande

  1. [O] jämför replikering kinetik av den genererade rekombinanta viruset och omodifierad vektorn med one-step eller flerstegs tillväxtkurvor (GCs). För one-step GCs bedöms viral avkomma efter samtidig infektion i alla celler (teoretiskt 100% infektion). Flera steg GCs börjar på en låg andel infekterade celler att följa flera rundor av virusreplikation.
    1. [M] för analys av mässling virus replikering kinetik, utsäde 1 x 105 Vero-celler i 1 mL DMEM med 10% FBS per brunn på 12 brunnar en dag före infektion. Tallrik minst två brunnar för varje tidpunkt sevärdheter som tekniska replikat.
    2. [O] infektera cellerna med virus på låg MOI för flera steg eller på hög MOI för one-step GCs [M] (0,03 och 3 för MV replikering på Vero celler, respektive). Ersätta mediet med 300 µL av serumfritt medium som innehåller respektive mängden virus och inkubera vid 37 ° C och 5% CO2 för minst 2 h. ta bort inokulum, tillsätt 1 mL DMEM med 10% FBS, och fortsätta inkubation.
    3. [P] vid relevanta tidpunkter såsom 12 skörda 24, 36, 48, 72 och 96 timmar efter infektion, viral avkomma genom direkt skrapa celler till medium. Överför innehållet från varje brunn till en individuell tube, snapin-frysa i flytande kväve och förvaras vid-80 ° C tills titrering.
      Obs: [P] identiska prover kan poolas i detta steg för analys av genomsnittliga titrar.
    4. [P] samla in prover från alla tidpunkter. Tina samtidigt vid 37 ° C för bedömning av viral avkomma. Vortex och pellet cellfragment genom centrifugering för 5 min 2 500 x g och 4 ° C.
    5. [P] beräkna genomsnittliga titrar av varje konstruera och tidpunkt som beskrivs ovan. Rita titrar över tid. Jämföra tillväxtkurvor av vektorer med och utan infogade transgener, med olika transgener eller med transgener infogas vid olika positioner (se figur 6A).
  2. [O] jämför lytisk aktiviteter av immunmodulerande-kodning och oförändrad virus.
    1. [O] Välj från möjliga metoder inklusive impedans mätningar, laktatdehydrogenas (LDH) release assay eller metabolism-baserade kolorimetriska cellviabilitet analyser [t.ex., 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium (MTT ) och 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) analyser].
      1. [M] för att analysera cytotoxicitet av mässling assay virusvektorer med XTT, utsäde Vero-celler som beskrivs i steg 3.1.1. Inkludera replikat av en icke-infekterade kontroll för varje tidpunkt.
        Obs: [O] utföra XTT analysen vid olika tidpunkter på samma prov kan begränsa tekniska fel, men upprepade tvättar och exponering för XTT reagens påverkar antalet livskraftiga celler. Impedans erbjuder en alternativ avläsning för kontinuerliga mätningar.
    2. [M] infektera Vero-celler på ett MOI 1 som beskrivs i steg 3.1.2.
      Obs: [M] för infektion av mindre tillåtande målceller såsom vissa murina tumör cellinjer, kan det behövas en högre MOI av 3 eller 5.
    3. [O] vid tidpunkter av intresse (t.ex.., 12, 24, 36, 48, 72 och 96 timmar efter infektion) förbereda den nödvändiga mängden XTT reagens (i.e., 300 µL per brunn plus 10% överskott). Undvika ljusexponering.
    4. [M] vid varje tidpunkt, ta bort mediet från respektive brunnar. Ersätta med 300 µL XTT reagens och inkubera vid 37 ° C i mörker. Samla supernatanterna när reagenset i kontrollbrunnarna har blivit djupt röd, vilket vanligtvis tar mellan 15 minuter och 2 h, och fryser vid-20 ° C.
      Obs: [O] inkubationstider beror på virus konstruera, celltyp, densitet och cytopatisk effekt.
    5. [O] efter att samla alla prover, Tina samtidigt. Överför 100 µL av varje prov till en plattan med 96 brunnar och mäta optiska absorbans vid 450 nm, med 630 nm som en referens våglängd.
    6. [O] Rita tidpunkter (x-axeln) vs. optiska absorbansen av prover i förhållande till kontroller, som indikerar metabolisk aktivitet som ett surrogat för cellernas viabilitet (y-axeln). Minskande relativa absorbansen över tiden förutsätter viral cytotoxicitet (se figur 6B).

4. analysera aktiviteten av Virus-kodade immunomodulatorer utsöndras från infekterade celler

  1. [O] isolera utsöndrade transgenens produkter uttryckt av virusinfekterade målceller.
    1. [P] Låt virus producent cellerna att växa till 70% konfluens i T175 kolvar.
    2. [P] ta bort mediet från celler och tvätta två gånger med 12 mL PBS ta bort serum. Inokulera cellerna med virus på en MOI av 0,03 i 12 mL serumfritt medium och inkubera vid 37 ° C och 5% CO2 över natten. Ersätta mediet med 12 mL färsk serumfritt medium.
      1. [M] för Edmonston B virus, överföra celler från 37 till 32 ° C efter 40 h för en annan 24 h inkubation att underlätta infektion och förhindra för tidig bristningen av syncytia. Beroende på virusstam kan51,52 och syncytia progression, inkubation temperaturer och tider justeras för optimal protein avkastning och renhet.
    3. [P] omsorgsfullt samla supernatanterna utan demontering celler innan syncytia sprack. Syncytia har optimalt, spridda över hela cellen lagret. Pool supernatanterna i 50 mL rör.
      Obs: [P] för effektiv rening av produktens transgenens, undvika bristningen av syncytia och minimera cellfragment när skörden supernatanterna av infekterade celler.
    4. [P] ta bort cellfragment supernatanten genom centrifugering för 5 min 2 500 x g och 4 ° C och som passerar genom 0,22 µm filter. Beroende på den totala volymen av filtratet, kan detta utföras med hjälp av en spruta eller en vakuumpump.
    5. [O] isolera transgenens produkt använder en lämplig reningsmetod. Rena proteiner med en hexa-histidin (hans) tag genom exchange affinitetskromatografi använder Ni-NTA mini spin kolumner38 som beskrivs här i korthet (steg 4.1.5.1–4.1.5.4).
      Obs: [O] utföra alla steg snabbt och på is. Pre chill buffertar och pre cool centrifug till 4 ° C.
      1. [O] bereda 100 mL varje buffert med PBS, 200 mM natriumklorid och Imidazol i slutliga koncentrationer på 10 mM (tvätt buffert 1, WB1), 20 mM (duschmöjlighet buffert 2, WB2) och 500 mM (eluering buffert, EB). Justera pH WB1 och WB2 8.0 och EB till 7.0. Beroende på proteinet som skall renas, kan Imidazol koncentrationer behöva justeras.
      2. [O] jämvikta kolumner med 600 µL av WB1 och centrifugera vid 800 x g under 2 minuter med öppet lock.
      3. [O] belastning 600 µL av filtrerade supernatanterna på kolumner. Tillåta bindning av hans-taggade proteiner i kolumnen matrisen genom centrifugering vid 200 x g för 5 min med stängt lock. Lastning och bindande kan upprepas upp till totalt 300 µg hans-taggade protein per kolumn.
      4. [O] tvätta tre gånger med WB1 och en gång med WB2, eller tills genomströmmande är färglös. Tillsätt 600 µL buffert och snurra vid 800 x g i 2 min med öppet lock.
      5. [O] eluera protein i en färsk röret genom att utföra två eluering steg med 300 µL av EB och centrifugering i 2 min på 800 x g.
      6. [O] avsalta och koncentrera sig produkten med centrifugal filter enligt produktens storlek. Lägg till PBS till 15 mL och filtrera via centrifugering i 10 min vid 4000 x gvolym. Upprepa tills önskad renhet och koncentration uppnås. För att öka proteinkoncentration, minska den slutliga volymen till ca 200 µL genom centrifugering för 40 min vid 4000 x g.
  2. [O] bekräfta renhet och produktens identitet.
    1. [O] kvantifiera mängden totalprotein i isolaten använder kolorimetriska standardanalyser såsom bicinchoninic syra (BCA) eller Bradford assay54,55. [M] typiska värden kan variera från 1 – 3 µg transgenens produkt per mL supernatanten av infekterade celler.
    2. [O] för relativ kvantifiering av protein isolat, separat via sodium dodecyl sulfate polyakrylamid gelelektrofores (SDS-PAGE) och utföra Coomassie färgning56.
    3. [O] bekräfta identitet av renat produkter av immunoblotting med specifika antikroppar inriktade på proteinet eller en associerad peptid tagg57.
    4. [O] analysera protein bindande specificitet med hjälp av lämplig teknik som kan omfatta enzyme-linked immunosorbent assay (ELISA) eller flödescytometri (se figur 7). Cell bindande kan bekräftas med hjälp av en nyligen beskriven magnetiska pulldown assay38.
      Obs: [O] Använd lämpliga kontroller. I cell bindande analyser, inkludera negativa kontroller med celler som inte uttrycker den riktade molekylen (som i figur 9) och icke-targeting protein surrogat (figur 8). I flödet flödescytometri experiment, inkluderar positiva, negativa och isotypen kontroller (figur 7).
      1. [O] Co Inkubera målet celler och protein isolera för att tillåta bindning. [B] för bindande analys av BTEs till perifera mononukleära blodceller (PBMC) isolerade från humanblod58, inkubera 2,5 x 106 celler med 200 ng av BTE i 100 µL av PBS med 1% FBS (bindande buffert, BB) för 1 h på is.
      2. [B] tvätta cellerna med 1 mL av BB ta bort obundna protein. Centrifugera vid 300 x g i 5 min, Kassera supernatanten och återsuspendera pelleten i 100 µL av BB. Tillsätt biotinylerade antikropp inriktning antingen proteinet av intresse eller en associerad peptid-tagg och inkubera på is i 30 min. För BTEs med influensa hemagglutinin (HA) tag, Använd 100 ng av anti-HA-Biotin (klon 3F10).
      3. [B] tvätta cellerna två gånger med 1 mL av BB och återsuspendera i 80 µL av BB. Tillsätt 20 µL av streptividin-kopplad magnetisk mikrokulor och inkubera i 15 minuter vid 4 ° C.
      4. [B] tvätta en gång för att ta bort överflödig pärlor och återsuspendera pelleten i 500 µL av BB kompletteras med 2 mM EDTA (kolumn buffert, CB).
      5. [B] isolera cellerna med kolumner och en magnetisk stå enligt leverantörens manual.
        1. [B] jämvikta genom att tillåta 500 µL av CB att passera genom kolonnen genom gravitation flöde.
          Obs: [B] kolumnen får aldrig köras torr. Pipettera omsorgsfullt och degas buffertar för att undvika bubblor.
        2. [B] Placera en ren röret under kolumnen och gälla kolumnen cellen/pärla suspensionen. Tvätta kolonnen tre gånger med CB 500 µL per tvätt. Samla genomflöde prov av fjädringen och åtminstone det första tvätt steget i röret och sedan lagra på is.
        3. [B] eluera pärla-bundna celler behålls av magnetfältet. I detta syfte ta bort kolumnen från magnetiska stativet, placera den över en ren slang, tillsätt 1 mL av CB och snabbt driva bufferten genom kolonnen i röret med hjälp av en kolv. Håll röret på is.
      6. [B] centrifug rör innehållande genomflöde och eluering prover för 20 min på 16 000 x g och 4 ° C till pellet celler. Kassera supernatanterna och lysera celler i en radioimmunoprecipitation-analysbuffert (RIPA) (förslag: 75 µL). Utföra SDS-PAGE56.
      7. [B] utföra immunoblotting med hjälp av en lämplig primär antikropp. Antikroppar kan rikta transgenens produkt eller en cellulär protein (e.g., β-aktin, figur 8) att bedöma BTE-cell bindande.
  3. [O] bedöma immunologiska funktioner av isolerade immunomodulatorer.
    1. [O] identifiera relevanta analyser enligt de kodade immunmodulerande egenskaper. Angående den förväntade immunmodulerande aktiviteten, kan metoder att bedöma cellproliferation, migration, mognad, aktivering eller cytotoxicitet tillämpas.
      Obs: [O] cellproliferation kan analyseras med CFSE59 märkning eller Ki67 färgning60. Transwell eller repa experiment finns att analysera cell migration61. Mognad och aktivering av cellerna kan bedömas med hjälp av lämpliga färgprotokollen för respektive markörer. [B] tillgängliga tekniker för att bedöma BTE-medierad cellmedierad cytotoxicitet omfattar impedans mätningar och krom release assay. Om att välja krom release assay, iaktta korrekt säkerhetsåtgärder vid hantering av radioaktivt material.
    2. [B] som en icke-radioaktiva alternativ beskriver följande i detalj hur man utvärderar BTE-inducerad, cellmedierad cytotoxicitet av LDH release assay (beskrivs tidigare kort38).
      1. [B] bestämma villkor ska testas under experimentet (se figur 9 som ett exempel). Tidpunkter (timmar till dagar), koncentrationer av immunmodulerande (pg/mL till µg/mL) och effektor till målet cellen (E:T) nyckeltal (mellan 1:50 och 50: 1, till exempel) kan varieras. Alltid förbereda prover i exemplar.
      2. [B] inkluderar prover utan protein och utan effektor celler, kontroller för spontana LDH släppa de enda celltyper (Tsp och Esp), en cell maximal lysis målkontrollen (Tmax) med diskmedel före avläsning, ett medium endast kontroll och en volymkontroll för Tmax.
        Obs: [B] krävs antal målceller och inkubationstider kan variera. Utföra första testkörningar utan effektor celler och immunmodulerande medel att identifiera optimala parametrar. Inkludera Tsp och Tmax prover och motsvarande kontroller att bedöma olika cell nummer och tidpunkter.
      3. [B] isolera immun effektor celler t.ex. genom (täthet lutning centrifugering av humanblod att erhålla PBMC58 ) eller negativt urval av murina T-celler från mus splenocytes62.
      4. [B] utsäde rikta celler enligt steg 4.3.2 (t.ex., 5 x 10³ per brunn) i en U-botten 96 brunnar tallrik.
      5. [B] lägga till isolerade proteinet vid önskad koncentrationer till respektive proverna. Lägg till immun effektor celler på önskat nyckeltal. Lägg till medium till en total volym av 100 µL per brunn.
      6. [B] Inkubera för tidsramen som fastställts i steg 4.3.2, normalt mellan 4 och 48 h (24 h för ostimulerade PBMC och 48 h för färska isolerade murina T celler; kortare inkubationstider kan ansöka om prestimulated immunceller), vid 37 ° C och 5% CO2.
      7. [B] 45 minuter före insamling av prover, tillsätt 10 µL 10 x lysis lösning brunnar innehållande Tmax prover och motsvarande medium kontroller. Fortsätt inkuberingen.
      8. [B] snurra ner cellerna på 250 x g för 4 min. Transfer 50 µL av varje supernatanten till en platt-bottenplatta med 96 brunnar. Över inte celler för att undvika cell-bundna LDH.
      9. [B] förbereda substratlösningen enligt tillverkaren. Tillsätt 50 μl till varje brunn och inkubera vid RT i mörkret i 30 min eller tills Tmax prover vända djuprött.
      10. [B] Tillsätt 50 µL stopplösning till varje brunn. Avlägsna luftbubblor genom centrifugering för 1 min vid 4000 x g, och manuellt med en ihålig nål. Mäta optiska absorbansen vid 490 nm.
      11. [B] beräkna % specifika lysis värden för varje prov.
        1. [B] beräkna medelvärden för replikat av medelstora kontroller med och utan lysis lösning. Subtrahera erhållna värden från experimentprover och Tmax och spontana release kontroller, respektive. Använda dessa bakgrundskorrigerade värden för ytterligare beräkningar.
        2. [B] beräkna medelvärden för bakgrundskorrigerade T-max, Tspoch Esp kontroller. Följande ekvation använder dessa genomsnittliga värden, och ger procentandelen av specifika lysis för varje prov:

          Equation 1
        3. [B] Rita E:T förhållandet eller % specifika lysis värden vs. proteinkoncentration och jämför med de icke-targeting kontrollproverna.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Figur 1 illustrerar verkningsmekanismen av onkolytisk mässlingvirus kodning bispecific T cell engagers. Ett flödesschema som skildrar arbetsflödet i detta protokoll presenteras i figur 2. Figur 3 visar ett exempel på en modifierad onkolytisk mässling virus arvsmassa. Detta ger en visuell representation av de specifika ändringar tillämpas på mässling virus anti genomet och särskilda funktioner i infogade transgener. Typiska mässling virus-inducerad syncytia avbildas i figur 4. Observera den höga cell densiteten vid tidpunkt för skörd undsättning (A, B), som anger att antalet cell kan reduceras när upprepa experimentet. Inkubation temperaturer och -tider kan optimeras för passaging på Vero-celler (C, D) för att uppnå förbättrad spridning av syncytia över plattan. Figur 5 utgör resultatet av en typisk titrering test. I figur 6, one-step tillväxtkurvor (A) och relativ cellviabilitet (B) efter inokulering med omodifierade (MV) och BTE-kodning visas onkolytisk mässlingvirus (MV-H-mCD3xhCD20). Samtidigt tillväxtkurvor jämfört vektorer på veroceller visas liknande, släpar lytisk aktivitet av transgenens-encoding viruset efter i murina tumör cell linje. Flödescytometri data av antigen-uttryckande målceller inkuberas med BTEs på fem olika spädningar finns i figur 7, som visar BTE bindande av celler i ett koncentrationsberoende sätt. Figur 8 representerar en exemplarisk immunoblot efter magnetiska pulldown BTE-associerade celler. PULLDOWN med icke-targeting BTEs (n1, n2) avkastning inte detekterbara mängder av celler, medan band i eluering fraktionen, vägledande av bundna celler, observerades för inriktning BTE prover (t1, t2). BTE-medierad, target antigen-specifika och koncentrationsberoende cytotoxicitet av murina T-celler indikeras av en representativ LDH release assay i figur 9.

Figure 1
Figur 1 : Verkningsmekanismen för onkolytisk mässlingvirus kodning en bispecific T cell agera (MV-BTE). Infektion i en tumör cell (infekterade: grå, oinfekterade: Ljusblå) med MV-BTE följs av virusreplikation och spridning i hela tumören, vilket resulterar i tumör cell lysis och immun stimulering. Samtidigt, bö [bestående av två inre kedjor härrör från antikroppar riktade CD3 på T-celler (gul) och en tumör ytantigen (blå)] produceras och utsöndras lokalt av virusinfekterade celler. BTE-medierad cross-linking med tumörceller inducerar aktivering av vilande, polyklonala T-celler, vilket resulterar i ytterligare tumör cell dödande. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2 : Flödesschema som beskriver arbetsflödet utforma, skapa och utvärdera nya virala vektorer kodning immunmodulerande transgener. Steg 1 till 4 speglar i respektive avsnitt i protokollet. Punktform ange relevanta överväganden och delsteg. Empiriska pågrund av förfarandet, kan justeringar eller förbättringar bli nödvändigt vid varje steg i arbetsflödet. Experimentella fynd kan dessutom leda till nya hypoteser och inspirera utvecklingen av ytterligare vektorer eller kombinationsbehandlingar. Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3 : Schematisk bild av en mässling virus arvsmassa. Förbättrad grönt fluorescerande protein (andra) är kodade i en ytterligare transkription enhet nedströms sekvensen ledare (ld). N, P, M, F, H och L utse gener som kodar den mässling virus strukturella proteiner nucleoprotein, P protein, matrix protein, fusionsprotein, hemagglutinin protein och stora protein (polymeras), respektive, som uttrycks differentially som visualiseras ovan. En bispecific T cell agera (BTE) transgenens infogas i en ytterligare transkription enhet (ATU) nedströms ramen H öppen läsning. Transgenens kodar en Igκ ledare peptid för effektiv utsöndring samt influensa hemagglutinin (HA) och hexa-histidin (hans) protein taggar för upptäckt och rening. Gener som kodar för variabel tung (VH) och lätt kedja (VL) domäner av antikroppar riktade mot CD3 och CD20, respektive, är anslutna via peptid linker sekvenser som innehåller glycin (G) och rester av serine (S). Sekvensen transgenens föregås av en Kozak sekvens. Nedströms kodningen region, ytterligare nukleotider inkluderats exemplarily att följa regeln om sex. Infoga kassett flankeras av två begränsning webbplatser möjliggör införande i de respektive ATU. Klicka här för att se en större version av denna siffra.

Figure 4
Figur 4 : Mässling virus-inducerad syncytia. (A, B) Vero-celler var transfekterade med cDNA för räddning av rekombinant mässlingvirus kodning förbättrade grönt fluorescerande protein (andra) och en bispecific T cell agera (BTE) riktade mot murina CD3 och mänskliga CD20. Närvaron av en fluorescerande syncytium (vita pilar) indikerar lyckad räddning av infektiöst virus. (C, D) Mässlingvirus var skördas efter räddning och sprids på Vero-celler (passage 1). Stora syncytia har bildats och redan börjar brista (gula pilar). Bilder förvärvades av faskontrast (B, D) och fluorescensmikroskopi efter magnetisering för 80 ms (A) och 100 ms (C). Klicka här för att se en större version av denna siffra.

Figure 5
Figur 5 : Representativa resultat av en titrering assay. Titrering av ett tredje-passage parti av MV-H-mCD3xhCD20, en BTE-kodning onkolytisk mässlingvirus, på Vero-celler. En 10-faldig seriell utspädning utfördes på en plattan med 96 brunnar, börjar med 10 µL av virussuspension i varje brunn av kolumn 1. ingen syncytia var synliga i kolumn 7, indikerat av nollor. För nästa lägsta utspädning av virussuspension i kolumn 6 observerades genomsnitt sex syncytia per brunn, vilket resulterar i en slutlig titer av cirka 6 x 107 cell infektiösa enheter (ciu) per mL virussuspension. Klicka här för att se en större version av denna siffra.

Figure 6
Figur 6 : Replikering kinetik och lytisk aktivitet av rekombinant mässlingvirus. (A) One-step tillväxtkurvor genererades efter infektion i Vero-celler med oförändrad onkolytisk mässlingvirus (MV) eller mässlingvirus kodning en bispecific T cell agera (MV-H-mCD3xhCD20) på en MOI 1. Titrar viral Progeny utvärderades vid bestämda tidpunkter efter infektion, som visar liknande virus replikering kinetik. Medelvärden och standardavvikelser av åtta prover (fyra tekniska replikeras varje två biologiska replikat per tidpunkt) visas. (B) Cell lönsamhet bedömdes på MC38 murina kolorektal carcinom celler stabilt uttrycka mänskliga carcinoembryonalt antigen och MV receptorn CD46 (MC38-CEA-CD46) efter inokulering med medellång bara (mock) eller angivna virus på en MOI 1. XTT cell lönsamhet analysen utfördes vid angivna tidpunkter. Cellernas viabilitet observerades vid tidigare tidpunkter för omodifierade vektorn. Värden på över 100%, beräknat för MV-H-mCD3xhCD20 vid tidpunkt för 12 h, observeras ofta strax efter infektion, vilket kan bero på cellulär stress eller cell-derived faktorer förekommer i virussuspension. Medelvärden och standardavvikelser för tre tekniska replikat visas för varje tidpunkt. Klicka här för att se en större version av denna siffra.

Figure 7
Figur 7 : Målet cellen bindning av bispecific T cell engagers (bö) uttryckt från mässling virus-infekterade celler. Mänskliga mantelcellslymfom celler endogenously uttrycker CD20 (Granta-519) inkuberades med humant immunglobulin G blockera Fc-receptorer, följt av inkubation med 2, 4, 6, 8 eller 10 µL (A) renat mCD3xhCD20 BTE lösning, respektive. BTE-bundna celler som hittades med fykoerytrin (PE)-konjugerad antikropp inriktning BTE-associerade HA-etiketten. Procentandelar av färgade celler korrelerade med BTE koncentrationer. (B) kontroller för selektivitet och specificitet av bindande. Här visas kontroller från ett oberoende experiment, inklusive ett prov varje celler inte inkuberas med BTE men BTE-targeting antikroppen endast (kontroll för ospecifik bindning av antikroppen till celler) eller en BTE som är känd för att binda till cellerna av intresse , följt av inkubation med antingen BTE-targeting antikroppen (positiv kontroll) eller en isotypen antikropp. Om tillgängligt, syngena celler som inte uttrycker målet antigenet val kan användas för att ytterligare kontrollera bindande selektivitet. Klicka här för att se en större version av denna siffra.

Figure 8
Figur 8 : Magnetiska pulldown i humana perifera mononukleära celler blod (PBMC bunden av mässling virus-kodade BTEs). Celler inkuberades med två olika satser med human T cell-inriktning (t1, t2) eller icke-targeting kontroll BTEs (n1, n2), respektive. BTE-bundna celler var kvar på kolumner med hjälp av magnetiska pärlor, pelleterat och lyserat. Β-aktin i lysates upptäcktes av immunoblotting. Intensiteter av banden i eluering proverna visar relativa BTE-cell bindande. Genomströmmande prover bekräfta närvaron av celler i alla prover. Klicka här för att se en större version av denna siffra.

Figure 9
Figur 9 : Cytotoxisk aktivitet av mässling virus-kodade BTEs. Målet tumörceller (5 x 10³ B16-CD20-CD46 celler per brunn) inkuberades med murin T-celler i förhållandet 1:50. BTEs tidigare renats från supernatanten av MV-H-mCD3xhCD20-infekterade celler lades vid angivna koncentrationer. Relativa lys av målceller bedömdes av LDH release assay efter 48 h. celler saknar BTE rikta antigen (B16-CD46) tjänstgjorde som referens att utvärdera antigen-specifika cytotoxicitet. Medel plus standardavvikelser av tre tekniska replikat per prov visas. Antigen-uttryckande målceller var specifikt lyserat i en BTE koncentrationsberoende sätt. Renhet av BTE produkt och målet antigen uttryck nivåer inflytande cell dödandet. I det aktuella exemplet uppnåddes 15% viss cell dödande vid en relativt hög koncentration av BTE 1 µg/ml. Detta är ett typiskt värde för sådan en experimentell setup med lång samtidig inkubationstider och suboptimala T cell odlingsbetingelser. I andra inställningar uppnås upp till 60% specifika dödande med hjälp av BTEs renats från MV-infekterade supernatanterna, når en platå på BTE koncentrationer av 100 ng/mL och högre38. Detta indikerar att kontraintuitivt, gränsen för denna analys är mindre än 100% specifika avlivning, som kan förklaras av olika tillväxt kinetics i Tmax kontroller jämfört med samtidig kultur prover. Klicka här för att se en större version av denna siffra.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Onkolytisk immunterapi (i.e., OVT i kombination med immunmodulering) innehar stort löfte för cancerbehandling, kräver ytterligare utveckling och optimering av onkolytisk virus kodning immunmodulerande proteiner. Det här protokollet beskriver metoder för att generera och verifiera sådana vektorer för efterföljande testning i relevanta prekliniska modeller och potentiella framtida kliniska översättning till romanen mot cancer therapeutics.

Många olika onkolytisk virus plattformar med distinkta fördelar är tillgängliga63. Förutom cancer specificitet, vektor säkerhet, krav för tillverkning, effekt i tumör cell lysis och induktion av immunsvar är kloning kapacitet avgörande för framgångsrik vektorisering av immunmodulerande medel med hjälp av en specifik onkolytisk. Tyvärr direkta jämförelser av olika OVs för närvarande saknas och bör eftersträvas för att identifiera optimal behandlingsalternativ för enskilda patienter. Detta kan underlättas genom att främja en rationell utveckling och provning av romanen transgenens-encoding vektorer, som exemplifieras här för MV-bö. Med tanke på de välgörande egenskaperna hos MV (dvs., oncotropism, säkerhet, fusogenicity, immunogenicitet, genomförbarheten av genetisk modifiering) fokuserar detta protokoll på denna onkolytisk vektor, som kan generaliseras för andra OV, särskilt paramyxovirus .

För ett rationellt val av potentiellt relevanta immunomodulatorer som kandidat transgener (steg 1.1.1) är en grundlig förståelse av cancer-immunitet cykeln viktigt, att göra systematiska litteratursökning oumbärlig. Dessutom stora skärmar, men kostsamma, kan vara värdefulla att identifiera nya mål (t.ex. se Patel et al.41).

För utformningen av rekombinant OVs övervägas önskat uttryck profiler. När det gäller RNA virus styrs genuttrycket på RNA-nivå respektive polymerasen. När du utformar transgenens kassetter för insättning i MV genomen (steg 1.1.2), är undvika sekvenser som liknar MV polymerase gene start/stopp signaler och RNA redigering platser och följd av sex styre avgörande för framgångsrik vektor utveckling. Dessutom motsvarar paramyxovirus gen uttrycksnivåerna positionering inom genomet, följd av ett uttryck gradient43. I allmänhet ökar positionering av transgenens i en överordnad position uttryck på bekostnad av minskad replikering. Dessa parametrar beror dock också på den storlek, struktur och sekvens av den respektive transgenens. En begränsning av den metod som beskrivs i detta protokoll är följaktligen behovet av empirisk testning av romanen vektor mönster. I särskilda fall, justeringar till transgenens sekvensen eller positionering kan vara nödvändigt för att uppnå önskad vektor egenskaper (figur 2). Systematisk jämförelse av olika positioner för checkpoint antikropp skär visade optimalt resultat för den H- ATU (opublicerade data). Som BTE skär har jämförbara egenskaper (storlek och immunglobulin domäner), MV-BTE vektorer var klonade analogt38.

Räddning av infektiös partiklar från virus cDNA (steg 2.1) kan kräva flera försök för vissa konstruktioner. Justera cell nummer kan optimera cell densiteten för syncytia bildas. Medan en viss densitet är nödvändiga för effektiv cell till cell spridning och fusion av cellmembran, minskar kontakt hämning virusreplikation. Ytterligare, antalet smittsamma partiklar kanske inte tillräckliga för att framkalla synliga Cellfusion. Emellertid, eftersom virus kan finnas i avsaknad av syncytia, rescue prover kan ändå skördas och överförs till färska producent celler för potentiell förökning. Ineffektiva transfection på grund av dålig DNA kvalitet eller olämpliga eller försämrat transfection reagenser representerar typiska problem som är relativt lätta att bedöma och åtgärda genom att generera nya DNA preparat och testa olika reagenser, respektive.

Framgångsrika virus förökning (steg 2.2) är ytterst beroende av villkoren att fastställa virusreplikation och cellys. Rekommenderas använda låg passage antal producent celler och infekterade celler behöver kontrolleras regelbundet för syncytia progression. Justera cell nummer, krävas temperaturer och inkubationstider att balansera viral spridning vs. cellproliferation.

En avgörande begränsning av den beskrivna metoden av virus produktion är utarbetandet av virus suspensioner från rå cell lysates. Forskare bör vara medvetna om det faktum att viruset suspensionen innehåller cellulära faktorer. Viruspartiklar kan vara koncentrerad via täthet lutning/sackaros kudde ultracentrifugering på bekostnad av totala antalet smittsamma partiklar och också potentiellt ökande koncentrationer av cellulära rester. Virus kan också vara koncentrerad från infekterade cellen supernatanterna, öka renhet men minska totala avkastning. GMP och storskalig produktion av paramyxovirus utförs normalt med hjälp av flera lager av producenten celler seedade på en glödtråd som netto i bioreaktorer för ökad titer ge63. Noggrann övervakning, kontinuerlig media exchange, serumfritt villkor och efterföljande filtrering steg säkerställa hög renhet av producerade virus.

Utvärdering av viral titrar (steg 2.3 och 3.1) via de beskrivna syncytia räknande metod är inte exakt, men det är enkelt att utföra och tillräckligt korrekt när du använder ett tillräckligt antal tekniska replikerar. När du utvärderar OV-medierad cytotoxicitet (steg 3,2), måste begränsningar av tillgängliga analyser beaktas. Metaboliska analyser skiljer inte mellan cytostatika och cytolytisk effekter av experimentella behandlingar. För att mäta cytolys, kan ett LDH release test utföras. Båda typerna av analyser kan dock påverkas av innehållet i virus preparat från rå cell lysates (figur 6).

Isolering av proteiner som uttrycks av virusinfekterade celler (steg 4.1) kan variera kraftigt i avkastning och renhet, beroende på respektive transgenens och virus som används samt om tekniska precision. Kvalitetskontroll av protein rening är således avgörande för utvärdering av relaterade experimentella resultat.

En uttömmande beskrivning av potentiella funktionella analyser som omfattar en stor mängd möjliga immunomodulatorer är utanför ramen för denna publikation, fokuserar detta protokoll på ex vivo metodik att mäta cellmedierad cytotoxicitet (steg 4,3). Cellmedierad cytotoxicitet, särskilt av CD8 + T-celler, är en viktig mediator av immunologiska tumör kontroll i framgångsrika immunterapier64. Detta har stor betydelse för nuvarande immunterapi metoder använder antikroppar för att förbättra anti-tumor immunsvar i allmänhet och bispecific T-cell engagers i synnerhet. Lokala BTE uttryck av onkolytisk vektorer har gett lovande resultat i flera prekliniska studier, inklusive RNA38 och DNA virus65,66,67,68.

På grund av de komplexa interaktioner av tumör, virus, transgenens produkt och värd immunsystemet i levande organismer, validering av immunmodulerande-kodning onkolytisk vektorer i cellodling som visas här inte är tillräcklig för att förutsäga terapeutiska resultat. Ännu viktigare, föreslagna isolerade bedömningen av vektor- och immunmodulerande funktioner, respektive, är nödvändigt för provmiljö men misslyckas att beskriva potentiella synergieffekter och komplexa interaktioner inom den tumör mikromiljö. Testning för både toxicitet och effekt i relevanta in vivo modeller är avgörande för ytterligare utveckling av romanen rekombinant vektor konstruerar men är inte lätt åstadkommas. Immunologiska säkerheten kontrolleras regelbundet i icke-mänskliga primater såsom makaker, och musmodeller används för biodistribution och effekt analyserar20,69. Men många av dessa modeller har begränsningar vad gäller uttrycket av virus receptorer i värd vävnader och värd släpphänthet och några endast otillräckligt efterlikna det komplexa samspelet OV, tumör och den immun mikromiljö. Noggrant övervägande av lämpliga modeller är alltså tvingande.

MV-BTE behandling har tidigare utvärderats i mänskliga xenograft och syngena musmodeller. Ingen BTE transgenens produkter var detekterbart i serum hos möss som behandlats med BTE-encoding MV38, som anger framgångsrikt förebyggande av systemisk exponering även utan ytterligare försvagning av den naturligt oncotropic stam vaccinvirus. Lokala uttryck är avgörande för OV-kodade immunomodulatorer som är giftiga vid administrering av systemiskt. Om nödvändigt, kan tumör specificitet förbättras genom Omriktning till cell yta markörer av val70,71,72 och mikroRNA-baserade de inriktning för förbättrad oncotropism73,74 ( Recenserad av Ruiz och Russell75). Ytterligare ändringar kan införas för att optimera vektorer för specifika terapeutiska användningar (granskas av Miest och Cattaneo76), inbegripet införande av transgener för diagnostiska ändamål77,78 eller prodrug konvertering till minimera biverkningar av kemoterapi79,80, införandet av säkerhet växlar81och målinrikta tumör stroma eller vaskulatur (t.ex. via bispecific antikroppar82).

Förutom genetisk modifiering av vektorn som viral, kombinationsregimer med chimära antigen receptorn (bil) T-cell överföra83, kemoterapi84,85,86eller strålbehandling87, 88 , 89 vidare utöka repertoaren av OVT. MV immunitet är mycket utbrett, strategier för att kringgå antikropp neutralisering har utarbetats, inklusive utbyte av kuvertet glykoproteiner för relaterade paramyxovirus90, polymerbeläggning partiklar, använder cell transportörer att leverera virus och övergående immunsuppression (Recenserad av Russell et al.6). Vidareutveckling av avancerade OV immunterapi regimer kräver provning av säkerhet och terapeutiska effekt i lämpliga djurmodeller, med patientmaterial, och i slutändan i kontrollerade kliniska prövningar.

Med tanke på uppsjö av möjliga kombinationer, är omfattande tester inte genomförbart. Matematisk modellering kan stöd i prioriteringen av potentiella kombinationsregimer samt deras respektive dosering och schemaläggning genom att förutsäga behandlingsresultat i silico (Recenserad av Santiago et al.91). När testning efficacies roman, rationellt designade vektorer, ljud medföljer translationell forskning är avgörande för en djupare förståelse av underliggande virologiska och immunologiska processer. Detta är avgörande för generering av lämpliga modeller, information om ytterligare potentiella mål och avancemang i fältet i allmänhet. Sammanfattningsvis, kommer att förstahandsinformation inblick i relevanta metoder för vektor design, generation och karakterisering i detta arbete påskynda utvecklingen och stödja utforskning av romanen therapeutics för framtida kliniska översättning.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

C.E. Engeland är listad som meduppfinnare av ett patent avseende RNA-virus för Cancer Immunovirotherapy ägs av Heidelbergs universitet. J.P.W. Heidbuechel har ingenting att avslöja.

Acknowledgments

Dessa metoder var etablerade i gruppen Virotherapy som leds av Prof. Dr. Dr. Guy Ungerechts vid National Center för tumörsjukdomar i Heidelberg. Vi står i skuld till honom och alla medlemmar i laboratoriet laget, särskilt Dr Tobias Speck, Dr Rūta Veinalde, Judith Förster, Birgit Hoyler, och Jessica Albert. Detta arbete fick stöd av den annan Kröner-Fresenius-Stiftung (Grant 2015_A78 till C.E. Engeland) och tyska National Science Foundation (DFG, bevilja C.E. Engeland sv 1119/2-1). J.P.W. Heidbuechel får ett stipendium av Helmholtz internationella forskarskolan för cancerforskning.

Materials

Name Company Catalog Number Comments
Rapid DNA Dephos & Ligation Kit Roche Life Science, Mannheim, Germany 4898117001
CloneJET PCR Cloning Kit Thermo Fisher Scientific, St. Leon-Rot K1231
Agarose Sigma-Aldrich, Taufkirchen, Germany A9539-500G
QIAquick Gel Extraction Kit QIAGEN, Hilden, Germany 28704
NEB 10-beta Competent E. coli New England Biolabs (NEB), Frankfurt/Main, Germany C3019I
LB medium after Lennox Carl Roth, Karlsruhe, Germany X964.1
Ampicillin Carl Roth, Karlsruhe, Germany HP62.1
QIAquick Miniprep Kit QIAGEN, Hilden, Germany 27104
Restriction enzyme HindIII-HF New England Biolabs (NEB), Frankfurt/Main, Germany R3104S
Dulbecco's Modified Eagle's Medium (DMEM) Invitrogen, Darmstadt, Germany 31966-021
Fetal bovine serum (FBS) Biosera, Boussens, France FB-1280/500
FugeneHD Promega, Mannheim, Germany E2311 may be replaced by transfection reagent of choice
Kanamycin Sigma-Aldrich, Taufkirchen, Germany K0129
Vero cells ATCC, Manassas, VA, USA CCL81
B16-CD46/ B16-CD20-CD46 J. Heidbuechel, DKFZ Heidelberg available upon request
Granta-519 DSMZ, Braunschweig, Germany ACC 342
Opti-MEM (serum-free medium) Gibco Life Technologies, Darmstadt, Germany 31985070
Colorimetric Cell Viability Kit III (XTT) PromoKine, Heidelberg, Germany PK-CA20-300-1000 includes XTT reagent
Dulbecco's Phosphate-Buffered Saline (PBS) Gibco Life Technologies, Darmstadt, Germany 14190-094
QIAquick Ni-NTA Spin Columns QIAGEN, Hilden, Germany 31014
Sodium chloride Carl Roth, Karlsruhe, Germany 3957.3
Imidazole Carl Roth, Karlsruhe, Germany I5513-25G
Amicon Ultra-15, PLGC Ultracel-PL Membran, 10 kDa Merck, Darmstadt, Germany UFC901024
BCA Protein Assay Kit Merck Milipore 71285-3
IgG from human serum Sigma-Aldrich, Taufkirchen, Germany I4506
Anti-HA-PE Miltenyi Biotech, Bergisch Gladbach, Germany 130-092-257 RRID: AB_871939
Mouse IgG1, kappa Isotype Control, Phycoerythrin Conjugated, Clone MOPC-21 antibody BD Biosciences, Heidelberg, Germany 555749 RRID: AB_396091
Anti-HA-biotin antibody, clone 3F10 Sigma-Aldrich, Taufkirchen, Germany 12158167001 RRID: AB_390915
Anti-Biotin MicroBeads Miltenyi Biotech, Bergisch Gladbach, Germany 130-090-485
MS Columns Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-201
MiniMACS Separator Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-102
MACS MultiStand Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-303
RIPA buffer Rockland Immunochemicals, Gilbertsville, PA, USA MB-030-0050
CytoTox 96 Non-Radioactive Cytotoxicity Assay Promega, Mannheim, Germany G1780 includes 10x lysis solution, substrate solution (substrate mix and assay buffer), and stop solution
Cell lifter Corning, Reynosa, Mexico 3008
10 cm dishes Corning, Oneonta, NY, USA 430167
15 cm dishes Greiner Bio-One, Frickenhausen, Germany 639160
96-well plates, U-bottom TPP, Trasadingen, Switzerland 92097
96-well plates, flat bottom Neolab, Heidelberg, Germany 353072
6-well plates Neolab, Heidelberg, Germany 353046
12-well plates Neolab, Heidelberg, Germany 353043
50 mL tubes nerbe plus, Winsen/Luhe, Germany 02-572-3001
T175 cell culture flasks Thermo Fisher Scientific, St. Leon-Rot 159910
0.22 µm filters Merck, Darmstadt, Germany SLGPM33RS

DOWNLOAD MATERIALS LIST

References

  1. Lichty, B. D., Breitbach, C. J., Stojdl, D. F., Bell, J. C. Going viral with cancer immunotherapy. Nature Reviews Cancer. 14, (8), 559-567 (2014).
  2. Cassady, K. A., Haworth, K. B., Jackson, J., Markert, J. M., Cripe, T. P. To Infection and Beyond: The Multi-Pronged Anti-Cancer Mechanisms of Oncolytic Viruses. Viruses. 8, (2), (2016).
  3. Twumasi-Boateng, K., Pettigrew, J. L., Kwok, Y. Y. E., Bell, J. C. Oncolytic viruses as engineering platforms for combination immunotherapy. Nature Reviews Cancer. (2018).
  4. Achard, C., et al. Lighting a Fire in the Tumor Microenvironment Using Oncolytic Immunotherapy. EBioMedicine. 31, 17-24 (2018).
  5. Kelly, E., Russell, S. J. History of oncolytic viruses: genesis to genetic engineering. Molecular Therapy. The Journal of the American Society of Gene Therapy. 15, (4), 651-659 (2007).
  6. Russell, S. J., Peng, K. W., Bell, J. C. Oncolytic virotherapy. Nature Biotechnology. 30, (7), 658-670 (2012).
  7. Russell, S. J., Peng, K. W. Oncolytic Virotherapy: A Contest between Apples and Oranges. Molecular Therapy: The Journal of the American Society of Gene Therapy. 25, (5), 1107-1116 (2017).
  8. Seymour, L. W., Fisher, K. D. Oncolytic viruses: finally delivering. British Journal of Cancer. 114, (4), 357-361 (2016).
  9. Chen, D. S., Mellman, I. Oncology meets immunology: the cancer-immunity cycle. Immunity. 39, (1), 1-10 (2013).
  10. Gao, Q., Park, M. S., Palese, P. Expression of transgenes from newcastle disease virus with a segmented genome. Journal of Virology. 82, (6), 2692-2698 (2008).
  11. Billeter, M. A., Naim, H. Y., Udem, S. A. Reverse genetics of measles virus and resulting multivalent recombinant vaccines: applications of recombinant measles viruses. Current Topics in Microbiology and Immunology. 329, 129-162 (2009).
  12. Matveeva, O. V., Guo, Z. S., Shabalina, S. A., Chumakov, P. M. Oncolysis by paramyxoviruses: multiple mechanisms contribute to therapeutic efficiency. Molecular Therapy Oncolytics. 2, (2015).
  13. Suter, S. E., et al. In vitro canine distemper virus infection of canine lymphoid cells: a prelude to oncolytic therapy for lymphoma. Clinical Cancer Research. 11, (4), 1579-1587 (2005).
  14. Ammayappan, A., Russell, S. J., Federspiel, M. J. Recombinant mumps virus as a cancer therapeutic agent. Molecular Therapy Oncolytics. 3, 16019 (2016).
  15. Schirrmacher, V. Oncolytic Newcastle disease virus as a prospective anti-cancer therapy. A biologic agent with potential to break therapy resistance. Expert Opinion on Biological Therapy. 15, (12), 1757-1771 (2015).
  16. Saga, K., Kaneda, Y. Oncolytic Sendai virus-based virotherapy for cancer: recent advances. Oncolytic Virotherapy. 4, 141-147 (2015).
  17. Matveeva, O. V., Kochneva, G. V., Netesov, S. V., Onikienko, S. B., Chumakov, P. M. Mechanisms of Oncolysis by Paramyxovirus Sendai. Acta Naturae. 7, (2), 6-16 (2015).
  18. Gainey, M. D., Manuse, M. J., Parks, G. D. A hyperfusogenic F protein enhances the oncolytic potency of a paramyxovirus simian virus 5 P/V mutant without compromising sensitivity to type I interferon. Journal of Virology. 82, (19), 9369-9380 (2008).
  19. Engeland, C. E., et al. A Tupaia paramyxovirus vector system for targeting and transgene expression. The Journal of General Virology. 98, (9), 2248-2257 (2017).
  20. Russell, S. J., Peng, K. W. Measles virus for cancer therapy. Current Topics in Microbiology and Immunology. 330, 213-241 (2009).
  21. Aref, S., Bailey, K., Fielding, A. Measles to the Rescue: A Review of Oncolytic Measles Virus. Viruses. 8, (10), (2016).
  22. Demicheli, V., Rivetti, A., Debalini, M. G., Di Pietrantonj, C. Vaccines for measles, mumps and rubella in children. The Cochrane Database of Systematic Reviews. (2), 004407 (2012).
  23. Radecke, F., et al. Rescue of measles viruses from cloned DNA. The EMBO Journal. 14, (23), 5773-5784 (1995).
  24. Martin, A., Staeheli, P., Schneider, U. RNA polymerase II-controlled expression of antigenomic RNA enhances the rescue efficacies of two different members of the Mononegavirales independently of the site of viral genome replication. Journal of Virology. 80, (12), 5708-5715 (2006).
  25. Russell, S. J., et al. Remission of disseminated cancer after systemic oncolytic virotherapy. Mayo Clinic Proceedings. 89, (7), 926-933 (2014).
  26. Hardcastle, J., et al. Immunovirotherapy with measles virus strains in combination with anti-PD-1 antibody blockade enhances antitumor activity in glioblastoma treatment. Neuro-Oncology. 19, (4), 493-502 (2017).
  27. Dispenzieri, A., et al. Phase I trial of systemic administration of Edmonston strain of measles virus genetically engineered to express the sodium iodide symporter in patients with recurrent or refractory multiple myeloma. Leukemia. 31, (12), 2791-2798 (2017).
  28. Galanis, E., et al. Phase I trial of intraperitoneal administration of an oncolytic measles virus strain engineered to express carcinoembryonic antigen for recurrent ovarian cancer. Cancer Research. 70, (3), 875-882 (2010).
  29. Galanis, E., et al. Oncolytic measles virus expressing the sodium iodide symporter to treat drug-resistant ovarian cancer. Cancer Research. 75, (1), 22-30 (2015).
  30. Kurokawa, C., et al. Constitutive Interferon Pathway Activation in Tumors as an Efficacy Determinant Following Oncolytic Virotherapy. Journal of the National Cancer Institute. (2018).
  31. Msaouel, P., et al. Clinical Trials with Oncolytic Measles Virus: Current Status and Future Prospects. Current Cancer Drug Targets. 18, (2), 177-187 (2018).
  32. Grote, D., Cattaneo, R., Fielding, A. K. Neutrophils contribute to the measles virus-induced antitumor effect: enhancement by granulocyte macrophage colony-stimulating factor expression. Cancer Research. 63, (19), 6463-6468 (2003).
  33. Grossardt, C., et al. Granulocyte-macrophage colony-stimulating factor-armed oncolytic measles virus is an effective therapeutic cancer vaccine. Human Gene Therapy. 24, (7), 644-654 (2013).
  34. Iankov, I. D., et al. Expression of immunomodulatory neutrophil-activating protein of Helicobacter pylori enhances the antitumor activity of oncolytic measles virus. Molecular Therapy: The Journal of the American Society of Gene Therapy. 20, (6), 1139-1147 (2012).
  35. Engeland, C. E., et al. CTLA-4 and PD-L1 Checkpoint Blockade Enhances Oncolytic Measles Virus Therapy. Molecular Therapy: The Journal of the American Society of Gene Therapy. 22, (11), 1949-1959 (2014).
  36. Veinalde, R., et al. Oncolytic measles virus encoding interleukin-12 mediates potent antitumor effects through T cell activation. Oncoimmunology. 6, (4), 1285992 (2017).
  37. Hutzler, S., et al. Antigen-specific oncolytic MV-based tumor vaccines through presentation of selected tumor-associated antigens on infected cells or virus-like particles. Scientific Reports. 7, (1), 16892 (2017).
  38. Speck, T., et al. Targeted BiTE expression by an oncolytic vector augments therapeutic efficacy against solid tumors. Clinical Cancer Research. (2018).
  39. Andtbacka, R. H., et al. Talimogene Laherparepvec Improves Durable Response Rate in Patients With Advanced Melanoma. Journal of Clinical Oncology: Official Journal of the American Society of Clinical Oncology. 33, (25), 2780-2788 (2015).
  40. Ribas, A., et al. Oncolytic Virotherapy Promotes Intratumoral T Cell Infiltration and Improves Anti-PD-1 Immunotherapy. Cell. 170, (6), 1109-1119 (2017).
  41. Patel, S. J., et al. Identification of essential genes for cancer immunotherapy. Nature. 548, (7669), 537-542 (2017).
  42. Kimple, M. E., Brill, A. L., Pasker, R. L. Overview of affinity tags for protein purification. Current Protocols in Protein Science. 73, Unit 9.9 (2013).
  43. Cattaneo, R., Rebmann, G., Baczko, K., ter Meulen, V., Billeter, M. A. Altered ratios of measles virus transcripts in diseased human brains. Virology. 160, (2), 523-526 (1987).
  44. Gutsche, I., et al. Structural virology. Near-atomic cryo-EM structure of the helical measles virus nucleocapsid. Science. 348, (6235), New York, N.Y. 704-707 (2015).
  45. Kolakofsky, D., et al. Paramyxovirus RNA synthesis and the requirement for hexamer genome length: the rule of six revisited. Journal of Virology. 72, (2), 891-899 (1998).
  46. Kolakofsky, D., Roux, L., Garcin, D., Ruigrok, R. W. Paramyxovirus mRNA editing, the "rule of six" and error catastrophe: a hypothesis. The Journal of General Virology. 86, Pt 7 1869-1877 (2005).
  47. Parks, C. L., et al. Analysis of the noncoding regions of measles virus strains in the Edmonston vaccine lineage. Journal of Virology. 75, (2), 921-933 (2001).
  48. JoVE Science Education Database. Molecular Cloning. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  49. JoVE Science Education Database. Bacterial Transformation: The Heat Shock Method. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  50. Bergkessel, M., Guthrie, C. Colony PCR. Methods in Enzymology. 529, 299-309 (2013).
  51. Rota, J. S., Wang, Z. D., Rota, P. A., Bellini, W. J. Comparison of sequences of the H, F, and N coding genes of measles virus vaccine strains. Virus Research. 31, (3), 317-330 (1994).
  52. Bankamp, B., Takeda, M., Zhang, Y., Xu, W., Rota, P. A. Genetic characterization of measles vaccine strains. The Journal of Infectious Diseases. 204, Suppl 1 533-548 (2011).
  53. Dulbecco, R., Vogt, M. Plaque formation and isolation of pure lines with poliomyelitis viruses. The Journal of Experimental Medicine. 99, (2), 167-182 (1954).
  54. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical Biochemistry. 150, (1), 76-85 (1985).
  55. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry. 72, 248-254 (1976).
  56. JoVE Science Education Database. Separating Protein with SDS-PAGE. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  57. JoVE Science Education Database. The Western Blot. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  58. Menck, K., et al. Isolation of human monocytes by double gradient centrifugation and their differentiation to macrophages in teflon-coated cell culture bags. Journal of Visualized Experiments. (91), e51554 (2014).
  59. Quah, B. J., Parish, C. R. The use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to monitor lymphocyte proliferation. Journal of Visualized Experiments. (44), (2010).
  60. Gerdes, J. Ki-67 and other proliferation markers useful for immunohistological diagnostic and prognostic evaluations in human malignancies. Seminars in Cancer Biology. 1, (3), 199-206 (1990).
  61. JoVE Science Education Database. The Transwell Migration Assay. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  62. Lim, J. F., Berger, H., Su, I. H. Isolation and Activation of Murine Lymphocytes. Journal of Visualized Experiments. (116), e54596 (2016).
  63. Ungerechts, G., et al. Moving oncolytic viruses into the clinic: clinical-grade production, purification, and characterization of diverse oncolytic viruses. Molecular Therapy Methods & Clinical Development. 3, 16018 (2016).
  64. Fridman, W. H., Zitvogel, L., Sautes-Fridman, C., Kroemer, G. The immune contexture in cancer prognosis and treatment. Nature Reviews Clinical Oncology. 14, (12), 717-734 (2017).
  65. Yu, F., et al. T-cell engager-armed oncolytic vaccinia virus significantly enhances antitumor therapy. Molecular Therapy: The Journal of the American Society of Gene Therapy. 22, (1), 102-111 (2014).
  66. Fajardo, C. A., et al. Oncolytic Adenoviral Delivery of an EGFR-Targeting T-cell Engager Improves Antitumor Efficacy. Cancer Research. 77, (8), 2052-2063 (2017).
  67. Freedman, J. D., et al. Oncolytic adenovirus expressing bispecific antibody targets T-cell cytotoxicity in cancer biopsies. EMBO Molecular Medicine. 9, (8), 1067-1087 (2017).
  68. Wing, A., et al. Improving CART-Cell Therapy of Solid Tumors with Oncolytic Virus-Driven Production of a Bispecific T-cell Engager. Cancer Immunology Research. 6, (5), 605-616 (2018).
  69. Myers, R. M., et al. Preclinical pharmacology and toxicology of intravenous MV-NIS, an oncolytic measles virus administered with or without cyclophosphamide. Clinical Pharmacology and Therapeutics. 82, (6), 700-710 (2007).
  70. Rittner, K., Schreiber, V., Erbs, P., Lusky, M. Targeting of adenovirus vectors carrying a tumor cell-specific peptide: in vitro and in vivo studies. Cancer Gene Therapy. 14, (5), 509-518 (2007).
  71. Nakamura, T., et al. Rescue and propagation of fully retargeted oncolytic measles viruses. Nature Biotechnology. 23, (2), 209-214 (2005).
  72. Campadelli-Fiume, G., et al. Retargeting Strategies for Oncolytic Herpes Simplex Viruses. Viruses. 8, (3), 63 (2016).
  73. Leber, M. F., et al. MicroRNA-sensitive oncolytic measles viruses for cancer-specific vector tropism. Molecular Therapy: The Journal of the American Society of Gene Therapy. 19, (6), 1097-1106 (2011).
  74. Baertsch, M. A., et al. MicroRNA-mediated multi-tissue detargeting of oncolytic measles virus. Cancer Gene Therapy. 21, (9), 373-380 (2014).
  75. Ruiz, A. J., Russell, S. J. MicroRNAs and oncolytic viruses. Current Opinion in Virology. 13, 40-48 (2015).
  76. Miest, T. S., Cattaneo, R. New viruses for cancer therapy: meeting clinical needs. Nature Reviews Microbiology. 12, (1), 23-34 (2014).
  77. Phuong, L. K., et al. Use of a vaccine strain of measles virus genetically engineered to produce carcinoembryonic antigen as a novel therapeutic agent against glioblastoma multiforme. Cancer Research. 63, (10), 2462-2469 (2003).
  78. Dingli, D., et al. Image-guided radiovirotherapy for multiple myeloma using a recombinant measles virus expressing the thyroidal sodium iodide symporter. Blood. 103, (5), 1641-1646 (2004).
  79. Abate-Daga, D., et al. Oncolytic adenoviruses armed with thymidine kinase can be traced by PET imaging and show potent antitumoural effects by ganciclovir dosing. PLoS One. 6, (10), 26142 (2011).
  80. Ungerechts, G., et al. Lymphoma chemovirotherapy: CD20-targeted and convertase-armed measles virus can synergize with fludarabine. Cancer Research. 67, (22), 10939-10947 (2007).
  81. Ketzer, P., et al. Artificial riboswitches for gene expression and replication control of DNA and RNA viruses. Proceedings of the National Academy of Sciences of the United States of America. 111, (5), 554-562 (2014).
  82. Freedman, J., et al. Targeting T-cells to human cancer associated fibroblasts using an oncolytic virus expressing a FAP-specific T-cell engager. Keystone Symposia & Digitell, Inc. (2018).
  83. Nishio, N., et al. Armed oncolytic virus enhances immune functions of chimeric antigen receptor-modified T cells in solid tumors. Cancer Research. 74, (18), 5195-5205 (2014).
  84. Bressy, C., Benihoud, K. Association of oncolytic adenoviruses with chemotherapies: an overview and future directions. Biochemical Pharmacology. 90, (2), 97-106 (2014).
  85. Wennier, S. T., Liu, J., McFadden, G. Bugs and drugs: oncolytic virotherapy in combination with chemotherapy. Current Pharmaceutical Biotechnology. 13, (9), 1817-1833 (2012).
  86. Fillat, C., Maliandi, M. V., Mato-Berciano, A., Alemany, R. Combining oncolytic virotherapy and cytotoxic therapies to fight cancer. Current Pharmaceutical Design. 20, (42), 6513-6521 (2014).
  87. Li, H., Peng, K. W., Russell, S. J. Oncolytic measles virus encoding thyroidal sodium iodide symporter for squamous cell cancer of the head and neck radiovirotherapy. Human Gene Therapy. 23, (3), 295-301 (2012).
  88. Opyrchal, M., et al. Effective radiovirotherapy for malignant gliomas by using oncolytic measles virus strains encoding the sodium iodide symporter (MV-NIS). Human Gene Therapy. 23, (4), 419-427 (2012).
  89. Mansfield, D., et al. Oncolytic Vaccinia virus and radiotherapy in head and neck cancer. Oral Oncology. 49, (2), 108-118 (2013).
  90. Miest, T. S., et al. Envelope-chimeric entry-targeted measles virus escapes neutralization and achieves oncolysis. Molecular Therapy: The Journal of the American Society of Gene Therapy. 19, (10), 1813-1820 (2011).
  91. Santiago, D. N., et al. Fighting Cancer with Mathematics and Viruses. Viruses. 9, (9), (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics