Paramyxoviruses per l'immunomodulazione mirata tumore: progettazione e valutazione Ex Vivo

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Questo protocollo descrive un flusso di lavoro dettagliato per la generazione ed ex vivo caratterizzazione dei virus oncolytic per espressione di immunomodulatori, usando i virus di morbillo codifica anticorpo cellula T ager come esempio. Applicazione e adattamento ad altre piattaforme di vettore e transgeni accelererà lo sviluppo di nuovi immunovirotherapeutics per la traduzione clinica.

Cite this Article

Copy Citation | Download Citations

Heidbuechel, J. P., Engeland, C. E. Paramyxoviruses for Tumor-targeted Immunomodulation: Design and Evaluation Ex Vivo. J. Vis. Exp. (143), e58651, doi:10.3791/58651 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Immunoterapia del cancro di successo ha il potenziale per raggiungere il controllo a lungo termine del tumore. Nonostante recenti successi clinici, ci rimane un urgente bisogno di terapie sicure ed efficaci su misura per profili immune tumore specifico. Virus oncolitici abilitare l'induzione delle risposte immunitarie antitumorali come pure l'espressione genica del tumore limitato. Questo protocollo descrive la generazione ed ex vivo analisi di immunomodulatori oncolytic vettori. Concentrandosi sui virus vaccino morbillo codifica anticorpo cellula T ager come esempio, la metodologia generale può essere adattata ad altre specie del virus e transgeni. Il flusso di lavoro presentato comprende la progettazione, clonazione, salvataggio e propagazione di virus ricombinanti. Saggi per analizzare la cinetica di replica e l'attività litica del vettore così come funzionalità dell'immunomodulatore isolato ex vivo sono inclusi, facilitando così la generazione di nuovi agenti per un ulteriore sviluppo in modelli preclinici e, infine, traduzione clinica.

Introduction

Virus oncolitici (OVs) stanno sviluppandi come terapie anti-cancro che specificamente replicano all'interno e uccidere le cellule tumorali mantenendo intatti i tessuti sani. Esso è ormai diventato comune comprensione che Oncolitica oncolytic (OVT), nella maggior parte dei casi, non affidarsi esclusivamente alla lisi completa del tumore replica efficiente e la diffusione del virus, ma richiede ulteriori meccanismi di azione per il successo del trattamento, tra cui vascolare e stromal di targeting e, soprattutto, stimolazione immune1,2,3,4. Mentre molti primi OV studi utilizzati virus non modificato, la ricerca attuale ha beneficiato di un biologico una migliore comprensione, biobanche di virus potenzialmente contenenti romanzo OVs e le possibilità offerte dall'ingegneria genetica al fine di creare avanzati OV piattaforme5,6,7.

Dato il recente successo di immunoterapia, immunomodulatori transgeni sono di particolare interesse per quanto riguarda l'ingegneria genetica di OVs. Espressione di tali prodotti genici dalle cellule del tumore OV-infetti riduce la tossicità rispetto alla somministrazione sistemica. Targeting è ottenuto utilizzando virus con oncoselectivity inerente o modificando tropismo virale8. Immunomodulazione locale migliora i meccanismi anti-tumorali multi-sfaccettati di OVT. Inoltre, questa strategia è fondamentale per interrogare l'interazione tra virus, le cellule del tumore e il sistema immunitario dell'ospite. A tal fine, questo protocollo fornisce un flusso di lavoro applicabile e regolabile per progettare, clonare, salvataggio, propagare e convalidare oncolytic vettori di paramixovirus (specificamente il virus del morbillo) codifica tali transgeni.

Modulazione della risposta immunitaria può essere raggiunto da un'ampia varietà di prodotti di transgene targeting diverse fasi del cancro-immunità ciclo9, tra cui migliorare il riconoscimento dell'antigene tumorale [ad es., antigeni tumore-associati (TAA) o induttori del complesso maggiore di istocompatibilità (MHC) di classe I molecole] sopra la maturazione delle cellule dendritiche di supporto per la presentazione dell'antigene efficiente (citochine); reclutamento e l'attivazione di cellule immunitarie desiderate come citotossici e cellule helper T [chemochine, anticorpo cellula T Ager (retroauricolari)]; targeting soppressive cellule come cellule T regolatorie, cellule mieloidi-derivato del soppressore, macrofagi associati al tumore e cancro-collegati di fibroblasti (anticorpi, retroauricolari, citochine); e prevenire l'inibizione delle cellule effettrici ed esaurimento (inibitori di checkpoint). Così, una pletora di agenti biologici è disponibile. Valutazione di tali immunomodulatori virus-messo per quanto riguarda l'efficacia terapeutica e possibili sinergie, nonché la comprensione dei rispettivi meccanismi è necessaria per migliorare la terapia del cancro.

Virus del RNA singolo filamento senso negativo della famiglia Paramyxoviridae sono caratterizzati da diverse caratteristiche favorevoli al loro uso come vettori oncolytic. Questi includono un oncotropism naturale, di grande capacità genomico per transgeni (più di 5 kb)10,11, efficiente diffusione compreso formazione di sincizi e alta immunogenicità12. Di conseguenza, le piattaforme OV basate sul cimurro virus13, parotite virus14, Newcastle malattia virus15, Sendai virus16,17, simian virus 518e Tupaia paramyxovirus19 sono stati sviluppati. Più visibile, attenuato vaccino vivo del morbillo virus ceppi (MV) hanno progredito in sviluppo preclinico e clinico20,21. Questi ceppi sono stati utilizzati per decenni per immunizzazione di routine con un record di sicurezza eccellente22. Inoltre, non c'è nessun rischio di mutagenesi inserzionale dovuto la replica rigorosamente citosolica di paramyxoviruses. Un sistema versatile di genetica inversa basato su cDNA anti-genomico che consente per l'inserimento dei transgeni in unità trascrizionali aggiuntive (ATUs) è disponibili11,23,24. Vettori di MV codifica symporter ioduro di sodio (MV-NIS) per imaging e radioterapia o antigene carcinoembrionario solubile (MV-CEA) come un indicatore sostitutivo per l'espressione genica virale sono attualmente in fase di valutazione in studi clinici (NCT02962167, NCT02068794, NCT02192775, NCT01846091, NCT02364713, NCT00450814, NCT02700230, NCT03456908, NCT00408590 e NCT00408590). Amministrazione provvisoria è stata confermata e sono stati segnalati casi di efficacia anti-tumorale in precedenti studi25,26,27,28,29, 30 (Recensito da Msaouel et altri.31), spianando la strada alla ricerca di virus di morbillo oncolytic aggiuntivi che sono stati sviluppati e testati preclinically. MV codifica immunomodulatori molecole targeting diverse fasi del ciclo del cancro-immunità hanno dimostrati di rallentare la crescita del tumore e/o prolungare la sopravvivenza in topi, con prova per efficacia di immune-mediata e memoria immunitaria protettiva a lungo termine in syngeneic modelli murini. Vettore-codificato transgeni includono fattore (GM-CSF)32,33, H. pylori neutrofilo-attivazione proteina34, checkpoint immuni inibitori35, di stimolazione della Colonia del granulocyte-macrofago interleukin-12 (IL-12)36, TAAs37e retroauricolari38, che legame incrociato un antigene di superficie del tumore con CD3 e indurre così attività anti-tumorale di cellule T policlonali, indipendentemente dalla T cell receptor specificità e co-stimolazione ( Figura 1). I risultati preclinici promettenti ottenuti per questi costrutti ulteriori sforzi traslazionale domanda.

Talimogene laherparepvec (T-VEC), un tipo ho herpes simplex virus codifica GM-CSF, è l'unico oncolytic terapeutico approvato dalla United States Food e Drug Administration (FDA) e Agenzia europea dei medicinali (EMA). Studio di fase III che conduce a omologazioni in fine del 2015 non ha solo dimostrato efficacia al luogo dell'iniezione intra-tumorali, ma anche effetti abscopal (cioè, le remissioni delle lesioni non-iniettato) nel melanoma avanzato39. T-VEC da allora è entrato prove supplementari per applicazione in altre entità del tumore (ad esempio tumori cutanei non-melanoma di, , NCT03458117; cancro del pancreas, NCT03086642) e per la valutazione delle terapie di combinazione, specialmente con checkpoint immuni inibitori (NCT02978625, NCT03256344, NCT02509507, NCT02263508, NCT02965716, NCT02626000, NCT03069378, NCT01740297 e Ribas et altri.40).

Ciò dimostra non solo il potenziale di immunoterapia oncolytic, ma anche la necessità di ulteriori ricerche identificare le combinazioni superiori di OVT e immunomodulazione. Progettazione razionale di ulteriori vettori e loro sviluppo per test preclinici è chiave per questa impresa. Questo avanzerà anche la comprensione dei meccanismi di fondo e ha implicazioni per la progressione verso il trattamento del cancro più personalizzata. A tal fine, questa pubblicazione presenta la metodologia per la modifica e lo sviluppo del paramyxoviruses per immunoterapia del cancro mirate e, più in particolare, del virus di morbillo oncolitici codifica anticorpi impegnandosi a cellula T (Figura 2).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Nota: [O], [P] e [M] indicare applicabili alle sottosezioni: OVs in generale, paramyxoviruses (la maggior parte) o MV solo, rispettivamente. [B] indica le sezioni specifiche per BTE transgeni.

1 clonazione dei transgeni immunomodulatore-codifica in vettori del Virus di morbillo

  1. [O] design inserire sequenza.
    1. [O] decidere un immunomodulatore di interesse basato su ricerca di letteratura o esplorativa dei dati quali schermi genetici41 e derivare la sequenza del cDNA pertinenti dal database appropriati quali GenBank, l'archivio europeo di Nucleotide, o il sistema di informazione internazionale ImMunoGeneTics (IMGT).
    2. [O] aggiungere funzionalità aggiuntive per la sequenza del transgene (Figura 3). Una sequenza di Kozak precedente e specie-codone ottimizzazione può migliorare espressione. Sequenze di segnale sono necessarie per la secrezione. Includere sequenze codificanti tag di proteina N - o C-terminale per rilevazione e purificazione42. Sono siti di restrizione per l'inserimento nel vettore.
      Nota: [M] avviare unità trascrizionali ulteriori (ATUs) che harboring gene della polimerasi di sistemi MV e segnali di stop sono necessari per l'espressione del transgene ricombinante genomi di MV. Vettori di cDNA anti-genomica adatto, controllati dai promotori di CMV e contenenti ATUs con siti di restrizione unici per introduzione di transgeni senso positivo alle posizioni definite, sono stati sviluppati in precedenza11. [P] adeguato posizionamento del transgene è fondamentale, in quanto colpisce l'espressione virale replica e transgene dovuto la pendenza di espressione tipica per paramyxoviruses43. Introduzione in un ATU vicino all'estremità 3' del anti-genoma (vale a dire., alla posizione di leader, o a valle del gene P ) provoca generalmente l'espressione del transgene alta a costo ridotto replicazione virale. Replica di una maggiore e più bassi livelli di espressione del transgene possono essere previsto quando si utilizza l'ATU a valle del gene H . Imballaggio del genoma di diversi paramyxoviruses, tra cui il virus del morbillo, richiede l'associazione di sei nucleotidi di ogni di proteina nucleocapsidica44. Per l'inserimento di transgeni in tali virus, assicurarsi che il numero di nucleotidi del genoma completo sarà divisibile per sei. Questa è anche detta "regola di sei"45,46. Se necessario, è possibile includere ulteriori nucleotidi nell'inserto (a Monte della sequenza Kozak o a valle del codone di arresto) senza introdurre turni di telaio o codoni di stop prematuri. [M] evitare sequenze particolare nel transgene che sono simile a MV gene iniziale (AGGRNCMARGW) e smettere di segnali (RTTAWANAAAA) e RNA editing di sequenze (AAAAAGGG). Tali sequenze di consenso sono stati pubblicati (ad es., Vedi parchi et al.47).
    3. [O] acquisto del oligonucleotide della sequenza desiderata o assemblare da sequenze disponibili utilizzando la clonazione molecolare standard48.
      Nota: [O] per l'amplificazione di PCR del transgene, progettare un primer avanti tra cui il sito di restrizione a Monte e i primi 15-20 nucleotidi dell'inserto e un primer inverso tra cui gli ultimi 15-20 nucleotidi dell'inserto seguite dalla limitazione a valle sito.
  2. [O] inserto di clone in DNA codificante del genoma virale (anti-).
    1. [O] clonare l'inserto in vettori di DNA o il anti-genoma DNA dei virus del RNA da standard molecolare clonazione tecniche48 (cioè restrizione di enzimatica di, seguita da legatura del DNA).
      1. [O] evitare ri-legatura del vettore utilizzando siti di restrizione non compatibili o defosforilazione prima della legatura.
      2. [O] isolare il prodotto di legatura di elettroforesi su gel di agarosio e purificazione del gel successivi utilizzando i kit disponibili in commercio. In generale, la legatura ottimale efficienza si ottiene con un rapporto molare 3:1 dell'inserto a vector.
    2. [O] trasforma il prodotto di legatura in batteri competenti adatto per recupero efficiente di grandi plasmidi (cioè, eseguire shock termico di e. coli49) e identificare cloni batterici che harboring il DNA corretto da Colonia PCR50 .
    3. [O] isolato ha amplificato il DNA da un singolo clone batterico utilizzando disponibili in commercio kit di preparazione del DNA. Confermare l'integrità genomica di digest di controllo con enzimi di restrizione appropriati (ad esempio, HindIII per genomi MV [M]). Confermare il corretto inserimento e integrità del transgene mediante sequenziamento.
      Nota: [M] per eseguire transgeni inseriti nel MV H- ATU, Sanger sequenziamento con i seguenti primer: H-9018 [forward primer, si lega alla posizione di genoma MV 9018 nella H open reading frame (ORF)]: 5' GTGTGCTTGCGGACTCAGAATC 3'; L-9249 + (reverse primer, si lega alla posizione del genoma di MV 9249 nel ORF L ): 5' CAGATAGCGAGTCCATAACGG 3'.

2. salvataggio di particelle del Virus di morbillo ricombinante codifica immunomodulatori

  1. [O] generano particelle di virus ricombinante da (anti-) genomic del DNA tramite transfezione delle virus produttore celle secondo il protocollo standard per i rispettivi virus. Seguire le linee guida per lavorare in condizioni di sterilità. Eseguire coltura cellulare sotto i cappucci, in particolare tutti i passaggi che coinvolgono virus in cabine di sicurezza biologica di classe II.
    1. [M] per il salvataggio di virus di morbillo da cDNA23,24, piastra produttore MV (cercopiteco africano del rene-derivato Vero) cellule uniformemente su una piastra a 6 pozzetti 24 h prima di transfezione. Semi 2 x 105 cellule in 2 mL Medium (DMEM per volta Eagle di Dulbecco) contenente 10% siero bovino fetale (FBS) per pozzetto per raggiungere confluency di 65 – 75% al momento della trasfezione.
      Nota: [P] se le cellule Erbaiuto prima formazione di sincizi indotta da virus, ridurre il numero di cellulare.
    2. [P] Transfect le cellule con DNA codifica i plasmidi virali supporto anti-genoma, necessaria, e, se lo si desidera, un plasmide codifica un reporter fluorescente per valutare l'efficienza di trasfezione.
      1. [M] Mix 5 µ g di DNA ricombinante codifica il anti-genoma virus del morbillo, 500 ng ogni dei plasmidi di espressione mammifera codifica il virus del morbillo N e L proteine e 100 ng ogni di plasmidi che codificano proteine P e un reporter fluorescente in un volume totale di 200 µ l DMEM.
      2. 18,6 µ l di reagente di transfezione liposomiale, miscelare immediatamente, spostando il tubo e incubare per 25 min a temperatura ambiente (TA).
      3. [P] sostituire il mezzo con 1,8 mL di DMEM, 2% FBS, 50 µ g/mL kanamicina (o altri antibiotici per prevenire la contaminazione) per pozzetto, poi aggiungere il mix di transfezione goccia a goccia e agitare accuratamente. Incubare le cellule durante la notte a 37 ° C, 5% CO2. Sostituire il mezzo con 2 mL di DMEM fresco, 2% FBS e kanamicina 50 µ g/mL il giorno successivo; Ripetere questa operazione quando il mezzo diventa acida.
        Attenzione: [O] gestire le cellule e materiali secondo le norme di biosicurezza, come virus può essere presente dalla transfezione attraverso le seguenti fasi. Smaltire rifiuti infettivi (potenzialmente) in modo appropriato.
  2. [P] raccogliere e propagare le particelle del virus.
    1. [P] osservare cellule quotidianamente da microscopia per formazione di reporter gene espressione e sincizi (Figura 4). Raccogliere il virus quando sincizi grande, composto da 20 o più celle, sono visibili, o quando le cellule diventano troppo dense (vale a dire., quando cominciano a crescere in strati multipli, in genere dopo 7-9 giorni).
      Nota: [P] se non sincizi sono osservati per un costrutto di vettore indicato, questo non significa necessariamente che il salvataggio non è riuscita. Come virus contagioso possono tuttavia essere presenti nel campione, trasferimento alle cellule fresche produttore per passaggio.
    2. [P] seme circa 1.5 x 106 cellule di produttore in 12 mL di DMEM con 10% FBS, su 10 cm piatti 24 h prima la raccolta anticipata o 2.5 x 106 cellule per piastra 4 – 6 h prima del passaggio del virus per raggiungere confluency di 65-75% al momento della inoculat virus ione.
    3. [P] per raccogliere progenie di virus, accuratamente raschiare le cellule aderenti produttore dalla piastra con un raschietto in cella e trasferire il surnatante contenente cellule in una provetta da centrifuga. Rimuovere i detriti cellulari mediante centrifugazione per 5 min a 2.500 x g a 4 ° C.
      Nota: Raschiate le cellule possono essere trasferite direttamente senza centrifugazione per massimizzare il riporto di virus al costo di condizioni di coltura non ottimali e potenziali artefatti di microscopia.
      Attenzione: evitare di [O] che si rovesciano media quando raschiando le cellule. Minimizzare la formazione di aerosol.
    4. [P] preparare l'inoculo mescolando il supernatante senza cellula dal punto 2.2.3 con medium senza siero ad un volume finale di 4 mL. Sostituire il mezzo sulle cellule di produttore di inoculo e incubare le cellule per almeno 2 ore a 37 ° C e 5% CO2. Aggiungere 6 mL di DMEM con 10% FBS e incubare le cellule durante la notte prima di cambiare il mezzo a 12 mL di fresco DMEM con 10% FBS.
    5. [P] osservare le cellule almeno due volte al giorno e virus raccolto prima raffica di sincizi (cioè, quando la rottura della membrana diventa visibile). Per raccogliere il primo passaggio del virus, rimuovere il surnatante dalla piastra, aggiungere 600 µ l di terreno privo di siero, raschiare le cellule con un sollevatore di cella e trasferire in una provetta pulita.
      Nota: [M] a seconda del virus ceppo51,52 e progressione dell'infezione, piastre con cellule infettate di trasferimento a 32 ° C per facilitare la diffusione e replicazione virale. In generale, ceppi di MV Schwarz propagano anche a 37 ° C, mentre trasferimento delle cellule infettate con il virus di ceppo Edmonston B a 32 ° C comporta la formazione di sincizi più lento ma più alti titoli.
      Nota: [P] non consentono lo strato di cellule ad asciugare durante la vendemmia, come questo si tradurrà in ridotta infettività delle particelle virali. Anche se alcuni virus viene perso quando scartare il surnatante delle cellule infettate, più alti titoli possono essere ricavati lo strato delle cellule.
    6. [P] immediatamente congelare la sospensione di virus in azoto liquido. Conservare a-80 ° C per almeno 24 h garantire completa di congelamento. Si estendono per diversi giorni per interrompere la procedura, se necessario.
    7. Rilascio di particelle virali di scongelamento a 37 ° C. Omogeneizzare mediante Vortex e centrifugare per 5 min a 2.500 x g a 4 ° C. Trasferire i surnatanti etichettati provette per criogenia e conservare a-80 ° C.
      Nota: [O] memorizzare virus in aliquotare misure adeguate per esperimenti successivi, come sono preferenzialmente scongelati solo una volta e utilizzati immediatamente. [P] Ulteriori gelo-disgelo cicli o conservazione a 4 ° C sopra parecchi giorni risultato riduzione significativa di titoli virali.
    8. [P] un giorno prima dell'ulteriore passaggio per raggiungere la quantità necessaria e titolo, semi 4 x 106 cellule produttore in 12 mL di DMEM con 10% FBS su piatti di 15 cm. Inoculare con virus ad una molteplicità di infezione (MOI) di 0,03. Infettare in 8 mL di medium senza siero per piastra e sostituire il terreno a DMEM con 10% FBS dopo incubando le cellule per almeno 2 h. scala fino utilizzando piastre multiple.
    9. Raccolto come descritto nel passo 2.2.5, quando sincizi sono diffusi attraverso lo strato di cellule intere. Piscina le sospensioni ottenute in provette da 50 mL e processo come descritto nella procedura 2.2.6–2.2.7.
      Nota: [O] è fondamentale controllare tutte le piastre visivamente per contaminazione batterica e fungina prima della raccolta. In generale, verificare tutte le linee cellulari regolarmente per contaminazione del micoplasma o virus avventizi mediante PCR multiplex.
  3. Titoli virali Evaluate [P]. Determinare i titoli delle scorte di virus in octuplicates per aliquota utilizzando piastre da 96 pozzetti. Eseguire la titolazione delle tre aliquote individuali al salvataggio di virus e utilizzare il valore medio per calcolare la quantità di sospensione di virus da utilizzare negli esperimenti.
    1. [P] piscina il produttore di celle, conteggio e regolare a 1,5 x 105 cellule per mL in DMEM con 10% FBS.
    2. [P] dispensare 90 µ l di DMEM con 10% FBS in ciascun pozzetto di una piastra a 96 pozzetti.
    3. [P] aggiungere 10 µ l da un'aliquota dello stock di virus in tutti i 8 pozzetti nella prima colonna della piastra e mescolare accuratamente pipettando su e giù almeno 10 volte.
    4. [P] eseguire diluizioni seriali 10 volte del virus. Trasferire 10 µ l di ciascun pozzetto dalla prima alla seconda colonna utilizzando una pipetta multicanale. Mescolare accuratamente pipettando su e giù e per ogni passaggio di diluizione usare puntali per pipetta fresco. Scartare 10 µ l di ciascun pozzetto dell'ultima colonna.
      Nota: Ogni piastra a 96 pozzetti consente 12 passaggi di diluizione seriale. [M] per i vettori di MV, 8 passi di 10 volte diluizioni sono in genere sufficienti, come i titoli sopra unità infettive di 1 x 109 cellulare/ml (ciu) raramente sono ottenuti con il metodo di propagazione descritto al punto 2.2. [P] controllo pozzi senza virus possono essere utilizzati per il confronto e per il monitoraggio della contaminazione.
    5. [P] aggiungere 100 µ l di sospensione cellulare in ogni pozzetto e incubare a 37 ° C, 5% CO2 per 48 h. verificare l'assenza di grumi di cellule in sospensione per ottenere una distribuzione omogenea delle cellule.
    6. [P] cerca di sincizi utilizzando un microscopio ottico. Contare sincizi in ciascun pozzetto della colonna con il più alto fattore di diluizione contenente sincizi visibile.
    7. [P] calcolare il numero medio di sincizi per pozzetto in tale colonna dividendo il numero totale di sincizi per otto. Moltiplicare tale media con il fattore di diluizione della rispettiva colonna, a partire da 102 ciu / mL per la prima colonna53 (vedere la Figura 5 come esempio).

3. determinazione della capacità replicativa e citotossica dei vettori virali codifica immunomodulatori

  1. [O] confrontare la cinetica della replica del virus ricombinante generato e il vettore non modificato con curve di crescita di passaggio singolo o multi-step (GCs). One-Step GCs, progenie virale sono valutati seguendo l'infezione simultanea di tutte le cellule (teoricamente, 100% infezione). Inizio di GCs multi-step a una bassa percentuale di cellule infette da seguire diversi cicli di replicazione del virus.
    1. [M] per l'analisi della cinetica di morbillo virus replica, seme 1 x 105 cellule Vero in 1 mL di DMEM con 10% FBS per pozzetto su 12 pozzetti un giorno prima dell'infezione. Piastra almeno due pozzetti per ciascun timepoint di interesse come tecnici replicati.
    2. [O] infettare le cellule con virus a basso MOI per multi-step o alto MOI per una tappa GCs [M] (cellule 0,03 e 3 per la replica di MV su Vero, rispettivamente). Sostituire il mezzo con 300 µ l di terreno privo di siero contenente le rispettive quantità di virus e incubare a 37 ° C e 5% di CO2 per almeno 2 h. Remove inoculo, aggiungere 1 mL di DMEM con 10% FBS e continuare l'incubazione.
    3. [P] timepoints pertinenti ad esempio 12, 24, 36, 48, 72 e 96 ore dopo l'infezione, vendemmia progenie virale raschiando direttamente le cellule nel mezzo. Trasferire il contenuto da ogni pozzetto per un singolo tubo, snap-congelamento in azoto liquido e conservare a-80 ° C fino alla titolazione.
      Nota: [P] campioni replicati possono essere riuniti in questa fase per l'analisi dei titoli medio.
    4. [P] raccogliere campioni da tutti i punti temporali. Scongelare contemporaneamente a 37 ° C per la valutazione della progenie virale. Vortice e pellet detriti cellulari mediante centrifugazione per 5 min a 2.500 x g e a 4 ° C.
    5. [P] calcolare medio titoli di ogni costrutto e timepoint come descritto sopra. Tracciare i titoli nel tempo. Confrontare le curve di crescita dei vettori con e senza transgeni inserito, con diversi transgeni o con transgeni inserito in posizioni diverse (Vedi Figura 6A).
  2. [O] confrontare attività litica del virus codifica immunomodulatore e non modificato.
    1. [O] select da possibili metodologie tra cui misure di impedenza, lattato deidrogenasi (LDH) rilasciare saggio o dosaggi di attuabilità delle cellule colorimetrico basato su metabolismo [es., 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium (MTT ) e 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) saggi].
      1. [M] per analizzare la citotossicità del morbillo di dosaggio vettori di virus utilizzando XTT, cellule di Vero seme come descritto al punto 3.1.1. Sono repliche di un controllo per ogni timepoint non infetti.
        Nota: [O] esecuzione di analisi di XTT timepoints differenti sullo stesso campione può limitare errori tecnici, ma ripetuti lavaggi e l'esposizione al reagente XTT colpisce un numero di cellule vitali. Impedenza fornisce una lettura alternativa per misurazioni continue.
    2. [M] infettare cellule Vero presso un MOI di 1 come descritto al punto 3.1.2.
      Nota: [M] per l'infezione delle cellule bersaglio meno permissive come alcune linee cellulari di tumore murino, un più alto MOI di 3 o 5 può essere necessario.
    3. [O] timepoints di interesse (ad es.., 12, 24, 36, 48, 72 e 96 ore dopo l'infezione) preparare la quantità necessaria di reagente XTT (cioè., 300 µ l per pozzetto maggiorato del 10% in eccesso). Evitare l'esposizione alla luce.
    4. [M] a ogni timepoint, rimuovere medie da relativi pozzetti. Sostituire con 300 µ l di reagente XTT e incubare a 37 ° C al buio. Raccogliere i surnatanti quando il reagente nei pozzetti di controllo ha trasformato profondo rosso, che in genere dura tra i 15 min e 2 h, e congelare a-20 ° C.
      Nota: [O] incubazione volte dipendono dal costrutto di virus, tipo cellulare, densità e l'effetto citopatico.
    5. [O] dopo aver raccolto tutti i campioni, scongelare simultaneamente. Trasferire 100 µ l di ciascun campione in una piastra a 96 pozzetti e ottico assorbanza a 450 nm, con 630 nm come lunghezza d'onda di riferimento.
    6. [O] tracciare punti temporali (asse x) vs. ottico assorbanza dei campioni rispetto ai controlli, indicando attività metabolica come un surrogato per la vitalità cellulare (asse y). Diminuzione di assorbanza relativa nel tempo implica citotossicità virale (Vedi Figura 6B).

4. analisi dell'attività di Virus-messo immunomodulatori secernuti da cellule infette

  1. [O] isolare transgene secernuto prodotti espresso da cellule bersaglio infettate da virus.
    1. [P] let produttore virus cellule crescono al confluency di 70% in T175 boccette.
    2. [P] rimuovere medie dalle cellule e lavare due volte con 12 mL di PBS per rimuovere siero. Inoculare cellule con virus a un MOI di 0,03 in 12 mL di medium senza siero e incubare a 37 ° C e 5% CO2 durante la notte. Sostituire medio con 12 mL di medium privo di siero fresco.
      1. [M] per virus Edmonston B, trasferire le cellule da 37 a 32 ° C dopo 40 h per altre 24 ore di incubazione per facilitare l'infezione e prevenire la rottura prematura di sincizi. A seconda del ceppo virale progressione52 e sincizi51,, temperature d'incubazione e volte possono essere regolate per la purezza e la resa ottimale della proteina.
    3. [P] raccogliere con cura i surnatanti senza staccare cellule prima raffica di sincizi. In modo ottimale, sincizi sono diffusi attraverso lo strato di intera cella. Surnatanti piscina in provette da 50 mL.
      Nota: [P] per purificazione efficiente del prodotto transgene, evitare la rottura di sincizi e minimizzare detriti cellulari quando raccogliendo i surnatanti delle cellule infettate.
    4. [P] rimuovere detriti cellulari dal surnatante mediante centrifugazione per 5 min a 2.500 x g e 4 ° C e passa attraverso filtri di 0,22 µm. A seconda del volume totale del filtrato, questa può essere eseguita utilizzando una siringa o una pompa a vuoto.
    5. [O] isolare transgene prodotto utilizzando un metodo di purificazione appropriata. Purificare le proteine con un tag di hexa-istidina (sua) mediante cromatografia a scambio affinità utilizzando Ni-NTA mini spin colonne38 come descritto qui in breve (passi 4.1.5.1–4.1.5.4).
      Nota: [O] eseguire tutti i passaggi veloci e su ghiaccio. Pre-chill buffer e centrifuga pre-raffreddare a 4 ° C.
      1. [O] preparare 100 mL di tampone PBS, 200 mM di cloruro di sodio e imidazolo alle concentrazioni finali di 10mm (tampone di lavaggio 1, WB1), 20 mM (lavaggio tampone 2, WB2) e 500 mM (tampone di eluizione, EB). Regolare il pH di WB1 e WB2 a 8.0 e di EB a 7.0. A seconda della proteina per essere purificati, imidazolo concentrazioni possono avere essere regolato.
      2. [O] equilibrare colonne con 600 µ l di WB1 e centrifugare a 800 x g per 2 minuti con un coperchio aperto.
      3. [O] carico 600 µ l di filtrato surnatanti sulle colonne. Consentire il legame delle proteine His-tag alla matrice colonna mediante centrifugazione a 200 x g per 5 minuti con il coperchio chiuso. Caricamento e l'associazione può essere ripetute fino a un totale di 300 µ g proteina His-tag per ogni colonna.
      4. [O] lavare tre volte con WB1 e una volta con WB2, o fino a quando il flusso continuo è incolore. Aggiungere 600 µ l di tampone e spin a 800 x g per 2 minuti con il coperchio aperto.
      5. [O] eluire la proteina in una nuova provetta eseguendo due passaggi di eluizione con 300 µ l di EB e centrifugazione per 2 min a 800 x g.
      6. [O] desalificare e concentrato prodotto utilizzando Filtro centrifugo secondo il formato del prodotto. Aggiungere un volume di 15 mL e filtro tramite centrifugazione per 10 min a 4.000 x gPBS. Ripetere fino a quando la purezza desiderata e si raggiunge la concentrazione. Per aumentare la concentrazione nella proteina, ridurre il volume finale a circa 200 µ l di centrifugazione per 40 min a 4.000 x g.
  2. [O] confermano la purezza e l'identità del prodotto.
    1. [O] quantificare la quantità di proteine totali negli isolati utilizzando saggi colorimetrici standard quali acido bicinconinico (BCA) o Bradford saggio54,55. [M] tipici valori possono variare da 1 – 3 µ g transgene prodotto surnatante mL delle cellule infettate.
    2. [O] per quantificazione relativa delle proteine isolate, separata tramite sodio dodecil solfato elettroforesi del gel di poliacrilammide (SDS-PAGE) ed eseguire Coomassie macchiatura56.
    3. [O] confermare l'identità dei prodotti purificati dall'immunoblotting utilizzando anticorpi specifici targeting della proteina o un peptide associato tag57.
    4. [O] analizzare la specificità di legame della proteina utilizzando tecniche appropriate che possono includere analisi enzima-collegata dell'immunosorbente (ELISA) o citometria a flusso (vedere la Figura 7). Associazione delle cellule possa essere confermati mediante un pulldown magnetico recentemente descritto saggio38.
      Nota: [O] utilizzare controlli appropriati. Nelle analisi di associazione delle cellule, è necessario includere controlli negativi con le cellule che non esprimono la molecola mirata (come in Figura 9) e non-targeting di surrogati di proteina (Figura 8). In esperimenti di citometria a flusso, sono positivi, negativi e isotype controlli (Figura 7).
      1. [O] co-Incubare la destinazione isolare cellule e proteine per consentire l'associazione. [B] per l'associazione analisi di retroauricolari a sangue periferico cellule mononucleari (PBMCs) isolate da sangue umano58, incubare 2,5 x 106 celle con 200 ng di BTE in 100 µ l di PBS con 1% FBS (buffer di associazione, BB) per 1 h sul ghiaccio.
      2. [B] cellule di lavare con 1 mL di BB per rimuovere proteine non associata. Centrifugare a 300 x g per 5 min, eliminare il surnatante e risospendere il pellet in 100 µ l di BB. Aggiungere anticorpo biotinilato targeting o la proteina di interesse o un tag associato del peptide e incubare in ghiaccio per 30 min. Per retroauricolari con tag emoagglutinina (HA) di riossidazione, uso 100 ng di anti-HA-biotina (clone 3F10).
      3. [B] lavare le cellule due volte con 1 mL di BB e risospendere in 80 µ l di BB. Aggiungere 20 µ l di microperle magnetiche streptavidina-accoppiato e incubare per 15 min a 4 ° C.
      4. [B] lavare una volta per rimuovere l'eccesso perline e risospendere il pellet in 500 µ l di BB completati con 2 mM EDTA (buffer di colonna, CB).
      5. [B] isolare cellule con colonne e un supporto magnetico secondo manuale del provider.
        1. [B] equilibrare consentendo 500 µ l di CB per passare attraverso la colonna di scarico per gravità.
          Nota: [B] la colonna non deve mai funzionare a secca. Pipettare attentamente e degassare i buffer per evitare bolle.
        2. [B] mettere un tubo pulito sotto la colonna e applicare la sospensione cellulare/tallone alla colonna. Lavare la colonna tre volte con 500 µ l di CB a lavaggio. Raccogliere campioni di flusso continuo della sospensione e di almeno la prima fase di lavaggio nel tubo, quindi memorizzare sul ghiaccio.
        3. [B] eluire associato a perlina cellule mantenute dal campo magnetico. A tal fine, rimuovere la colonna dal supporto magnetico, posto sopra una provetta pulita, aggiungere 1 mL di CB e spingere rapidamente il buffer attraverso la colonna nel tubo utilizzando uno stantuffo. Tenere il tubo sul ghiaccio.
      6. [B] Centrifugare le provette di campioni di flusso continuo ed eluizione per 20 min a 16.000 x g e a 4 ° C per agglomerare le cellule. Scartare i surnatanti e lisare cellule in un tampone di radioimmunoprecipitation (RIPA) (consigliata: 75 µ l). Eseguire SDS-pagina56.
      7. [B] eseguire immunoblotting usando un anticorpo primario adatto. Anticorpi possono indirizzare il prodotto transgene o una proteina cellulare (ad es.., β-actina, Figura 8) per valutare l'associazione BTE-cella.
  3. [O] valutare funzionalità immunologica di immunomodulatori isolati.
    1. [O] identificare le analisi pertinenti secondo le caratteristiche dell'immunomodulatore codificato. Per quanto riguarda l'attività immunomodulatoria previsto, metodi valutazione proliferazione, migrazione, maturazione, attivazione o citotossicità può essere applicata.
      Nota: [O] proliferazione può essere analizzata da CFSE59 etichettatura o Ki67 colorazione60. Esperimenti di Transwell o graffio sono disponibili per l'analisi di migrazione delle cellule61. Maturazione e l'attivazione delle cellule può essere valutate utilizzando appropriati protocolli di colorazione per i rispettivi marcatori. [B] disponibili tecniche per valutare la citotossicità cellulare mediata da BTE includono impedenza misurazioni e cromo rilasciare saggio. Se optare per test di rilascio di cromo, osservare misure di sicurezza adeguate durante la manipolazione di materiale radioattivo.
    2. [B] come alternativa non radioattivo, quanto segue descrive in dettaglio come valutare la citotossicità indotta da BTE, cellulo-mediata da analisi del rilascio LDH (descritto in precedenza in breve38).
      1. [B] decidere sulle condizioni di essere testato durante l'esperimento (Vedi Figura 9 come esempio). Punti temporali delle concentrazioni (da ore a giorni), di immunomodulatore (pg/mL a µ g/mL) e realizzatore al bersaglio (t) delle celle (tra le 01:50 e 50: 1, per esempio) può essere variata. Sempre preparare campioni in triplici copie.
      2. [B] includono campioni senza proteine e senza cellule effettrici, controlli per spontanea LDH rilasciare dei tipi di singola cellula (Tsp ed Esp), un controllo di massima lisi cellulare di destinazione (Tmax) con detergente aggiunto prima della lettura, un mezzo solo controllo e un controllo del volume per Tmax.
        Nota: [B] richiede numeri di cellule bersaglio e tempi di incubazione possono variare. Eseguire esecuzioni dei test iniziali senza cellule effettrici e immunomodulatori per identificare i parametri ottimali. Sono Tsp e Tmax campioni e controlli corrispondenti per valutare punti temporali e numeri di cellulari diversi.
      3. [B] isolare cellule effettrici immuni ad esempio da (centrifugazione in gradiente di densità del sangue umano per ottenere PBMCs58 ) o selezione negativa delle cellule di T murine da mouse splenocytes62.
      4. [B] seme cellule secondo punto 4.3.2 del bersaglio (ad es., 5 x 10³ per pozzetto) in un piatto fondo U 96 pozzetti.
      5. [B] aggiungere la proteina isolata alle concentrazioni desiderate per i rispettivi campioni. Aggiungere le cellule immunitarie effettrici a rapporti di desiderata. Aggiungere il terreno per un volume totale di 100 µ l per pozzetto.
      6. [B] Incubare per il lasso di tempo determinato step 4.3.2, tipicamente tra i 4 e 48 ore (24 ore per non stimolate PBMCs e 48h per appena isolate cellule T murine; tempi di incubazione possono candidarsi per prestimulated cellule immunitarie), a 37 ° C e 5% CO2.
      7. [B] 45 minuti prima di raccogliere i campioni, aggiungere 10 µ l di soluzione di lisi x 10 pozzetti contenenti i campionimax T e i corrispondenti controlli medi. Continuare l'incubazione.
      8. [B] rotazione verso il basso le cellule a 250 x g per 4 min. trasferire 50 µ l di ciascun supernatante di una piastra a 96 pozzetti a fondo piatto. Non trasferire cellule per evitare associato a cella LDH.
      9. [B] preparare la soluzione di substrato in base al produttore. Aggiungere 50 µ l in ogni pozzetto e incubare a temperatura ambiente al buio per 30 minuti o fino a quandomax campioni T girare profondo rosso.
      10. [B] aggiungere 50 µ l di soluzione bloccante in ciascun pozzetto. Rimuovere le bolle d'aria mediante centrifugazione per 1 minuto a 4.000 x ge manualmente con un ago vuoto. Misurare l'assorbanza ottica a 490 nm.
      11. [B] calcolare valori specifici Lisi % per ogni campione.
        1. [B] calcolare medie per repliche di medi controlli con e senza soluzione di lisi. Sottrarre i valori ottenuti da campioni sperimentali e da Tmax e controlli di rilascio spontaneo, rispettivamente. Utilizzare questi valori di sottofondo-rettificato per ulteriori calcoli.
        2. [B] calcolare medie per sottofondo-rettificato Tmax, Tspesp E i controlli. Utilizzando questi valori medi, l'equazione seguente restituisce la percentuale di lisi specifiche per ogni campione:

          Equation 1
        3. [B] trama % Lisi specifici valori vs concentrazione nella proteina o E:T ratio e confrontare i campioni di controllo non-targeting.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

La figura 1 illustra il meccanismo di azione del virus di morbillo oncolitici codifica anticorpo cellula T ager. Un diagramma di flusso che descrive il flusso di lavoro del presente protocollo è presentato nella Figura 2. Figura 3 Mostra un esempio di un genoma di virus di morbillo oncolytic modificate. Questo fornisce una rappresentazione visiva dei cambiamenti specifici applicati per il morbillo virus anti-genoma e sulle caratteristiche particolari di transgeni inserito. Sincizi indotta da virus di morbillo tipici sono rappresentati in Figura 4. Nota la densità alta cella al timepoint di raccolta il salvataggio (A, B), che indica che il numero di cella può essere ridotto quando si ripete l'esperimento. Volte e - temperature di incubazione possono essere ottimizzati per passaggio su cellule Vero (C, D) per raggiungere una migliore diffusione di sincizi su tutta la piastra. Figura 5 rappresenta il risultato di un test di titolazione tipica. In Figura 6, curve di crescita di One-Step (A) e vitalità cellulare relativa (B) dopo l'inoculazione con BTE-codifica e non modificato (MV) sono mostrati virus oncolitici morbillo (MV-H-mCD3xhCD20). Mentre le curve di crescita dei vettori rispetto su cellule Vero appaiono simili, l'attività litica del virus transgene-codifica un ritardo nella linea cellulare tumore murino. Dati di citometria a flusso delle cellule che esprimono l'antigene bersaglio incubati con retroauricolari a cinque differenti diluizioni sono forniti in Figura 7, che indica l'associazione di BTE dalle cellule in un modo dipendente dalla concentrazione. Figura 8 rappresenta un esemplare immunoblot dopo pulldown magnetica delle cellule BTE-collegata. Pulldown con non-targeting retroauricolari (n1, n2) non ha dato gli importi rilevabili di cellule, mentre bande nella frazione di eluizione, indicativa di cellule associate, sono stati osservati per il targeting campioni BTE (t1, t2). BTE-mediata, citotossicità di antigene-specifiche e dipendente dalla concentrazione di destinazione delle cellule T murine è indicata da una rappresentativa analisi del rilascio LDH in Figura 9.

Figure 1
Figura 1 : Meccanismo di azione del virus di morbillo oncolitici codifica un anticorpo cellula T engager (MV-BTE). Infezione di una cellula tumorale (infettati: grigio, non infetti: blu chiaro) con MV-BTE è seguita dalla replicazione virale e diffusione in tutto il tumore, con conseguente stimolazione di lisi e immunitario delle cellule del tumore. Contemporaneamente, retroauricolari [che consiste di due catene a singole derivate da anticorpi targeting CD3 sulle cellule di T (gialle) e un antigene di superficie del tumore (blu)] sono prodotti e secreti localmente dalle cellule infettate da virus. BTE-mediata reticolazione con le cellule del tumore induce l'attivazione del riposo, cellule T policlonali, con conseguente ulteriore uccisione delle cellule di tumore. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2 : Diagramma di flusso che descrive il flusso di lavoro di progettazione, generazione e la valutazione di nuovi vettori virali codifica immunomodulatori transgeni. I passaggi da 1 a 4 riflettono le rispettive sezioni del protocollo. Punti elenco indicano passaggi secondari e considerazioni pertinenti. A causa della natura empirica della procedura, regolazioni o perfezionamenti possono diventare necessari in ogni fase del flusso di lavoro. Inoltre, i risultati sperimentali possono portare a nuove ipotesi e ispirare lo sviluppo di ulteriori vettori o trattamenti di combinazione. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3 : Rappresentazione schematica di un genoma del virus di morbillo. Proteina fluorescente verde avanzata (eGFP) è codificata in un'unità di trascrizione ulteriori a valle della sequenza leader (ld). N, P, M, F, H e L designare geni che codificano la nucleoproteina di proteine strutturali del virus di morbillo, P proteina, proteina della matrice, proteina di fusione, proteina emoagglutinina e grande proteina (polimerasi), rispettivamente, che sono differenzialmente espressi come visualizzato di sopra. Un anticorpo cellula T engager (BTE) transgene è inserito in un'unità di trascrizione ulteriori (ATU) a valle della open reading frame del H . Il transgene codifica per un peptide di capo Igκ per secrezione efficiente nonché emoagglutinina (HA) di riossidazione e tag di proteina hexa-istidina (sua) per rilevazione e purificazione. Geni che codificano per pesanti variabile (VH) e catena chiara domini (VL) degli anticorpi targeting CD3 e CD20, rispettivamente, sono collegati tramite sequenze del linker peptide contenente residui di serina (S) e glicina (G). La sequenza del transgene è preceduta da una sequenza di Kozak. A valle della codifica regione, nucleotidi supplementari sono state incluse esemplarmente a rispettare la regola di sei. La cassetta di inserto è affiancata da due siti di restrizione abilitazione inserimento l'ATU rispettivo. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 4
Figura 4 : Sincizi indotta da virus di morbillo. (A, B) Cellule vero transfected con il cDNA per salvataggio di virus di morbillo ricombinante codifica migliorata della proteina fluorescente verde (eGFP) e un anticorpo cellula T engager (BTE) targeting murino CD3 e CD20 umano. Presenza di un sincizio fluorescente (frecce bianche) indica successo salvataggio del virus contagioso. (C, D) Virus di morbillo sono state raccolte dopo il salvataggio e propagato in cellule Vero (passaggio 1). Grande sincizi sono formate e stanno già cominciando a raffica (frecce gialle). Immagini sono state acquisite da microscopia di fluorescenza e contrasto di fase (B, D) dopo l'eccitazione per 80 ms (A) e 100 ms (C). Clicca qui per visualizzare una versione più grande di questa figura.

Figure 5
Figura 5 : Risultato rappresentativo di un dosaggio di titolazione. Titolazione di un batch di terzo-passaggio di MV-H-mCD3xhCD20, un virus morbillo oncolytic BTE-codifica, su cellule Vero. È stata eseguita una diluizione seriale 10 volte su una piastra a 96 pozzetti, a partire da 10 µ l di sospensione di virus in ciascun pozzetto della colonna 1. nessun sincizi erano visibili nella colonna 7, come indicato da zeri. Per la successiva diluizione minima di sospensione di virus nella colonna 6, è stata osservata una media di sei sincizi per pozzetto, risultante in un titolo finale di circa 6 x 107 unità infettive cellulare (ciu) per mL di sospensione di virus. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 6
Figura 6 : Cinetica di replica e l'attività litica del virus di morbillo ricombinante. One-Step (A) curve di crescita sono state generate dopo l'infezione delle cellule Vero con oncolytic invariato il virus del morbillo (MV) o il virus del morbillo codifica un anticorpo cellula T engager (MV-H-mCD3xhCD20) presso un MOI di 1. I titoli della progenie virale sono stati valutati timepoints designato dopo l'infezione, che indica la cinetica di replica virus simili. Medie e deviazioni standard di 8 campioni (tecnico quattro repliche di due ripetizioni biologici per timepoint) vengono visualizzate. (B) cella attuabilità è stata valutata su carcinoma colorettale murino MC38 cellule che esprimono l'antigene carcinoembrionario umano e il recettore MV CD46 (MC38-CEA-CD46) dopo l'inoculazione con media solo (finto) o virus indicato a un MOI di 1. Analisi di attuabilità delle cellule XTT è stato effettuato timepoints indicato. Riduzione nell'attuabilità delle cellule è stata osservata timepoints precedenti per il vettore non modificato. Valori di oltre il 100%, calcolata per MV-H-mCD3xhCD20 al timepoint 12h, sono osservati frequentemente poco dopo l'infezione, che può essere a causa di stress cellulare o fattori derivati da cellule presenti nella sospensione di virus. Valori medi e deviazioni standard di tre replicati tecnici sono indicate per ogni timepoint. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 7
Figura 7 : Associazione delle cellule bersaglio di anticorpo cellula T Ager (retroauricolari) espresso da morbillo cellule infettate da virus. Linfoma mantellare umano cellule in modo endogeno che esprimono CD20 (Granta-519) sono stati incubati con immunoglobulina umana G di bloccare i recettori Fc, seguiti da incubazione con 2, 4, 6, 8 o 10 µ l (A) di soluzione BTE mCD3xhCD20 purificata, rispettivamente. BTE-associazione cellule sono state rilevate utilizzando ficoeritrina (PE)-anticorpo coniugato che mira il BTE-collegata HA-tag. Percentuale di cellule marcate correlato con le concentrazioni BTE. (B) controlli per selettività e specificità del legame. Qui riportati sono i controlli da un esperimento indipendente, non compreso un campione ogni di cellule incubate con BTE ma con il targeting per BTE anticorpo solo (controllo per legame non specifico dell'anticorpo alle cellule) o con un BTE che è conosciuto per associare le celle di interesse , seguita da incubazione con l'anticorpo targeting per BTE (controllo positivo) o un isotipo dell'anticorpo. Se disponibile, cellule isogeniche non esprimono l'antigene bersaglio di scelta possono essere utilizzate per verificare ulteriormente la selettività di associazione. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 8
Figura 8 : Magnetico pulldown del periferico umano cellule mononucleari (PBMCs) vincolate retroauricolari morbillo virus-messo del sangue. Le cellule sono state incubate con due diversi lotti di umano delle cellule T-targeting (t1, t2) o non-targeting controllo retroauricolari (n1, n2), rispettivamente. BTE-associazione cellule erano mantenute su colonne utilizzando biglie magnetiche, pellettate e lisate. Β-actina nei lysates è stato rilevato dall'immunoblotting. Intensità delle bande nei campioni di eluizione indicare obbligatoria BTE-cella relativa. Flusso continuo campioni confermano la presenza di cellule in tutti i campioni. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 9
Figura 9 : Attività citotossica di morbillo virus-messo retroauricolari. Bersaglio le cellule del tumore (5 x 10³ B16-CD20-CD46 cellule per pozzetto) sono state incubate con cellule murine di T con un rapporto di 01:50. Retroauricolari precedentemente purificate dal surnatante delle cellule MV-H-mCD3xhCD20-infettate sono state aggiunte alle concentrazioni indicate. Relativa lisi delle cellule bersaglio è stata valutata tramite analisi del rilascio LDH dopo 48 h. cellule manca la BTE antigene (B16-CD46) servito come riferimento per valutare la citotossicità di antigene-specifiche di destinazione. Mezzi più deviazioni standard della tecniche tre ripetizioni per campione sono mostrate. Cellule che esprimono l'antigene bersaglio specificamente sono state lisate in un modo dipendente dalla concentrazione di BTE. Purezza dell'espressione dell'antigene BTE obiettivo e del prodotto livelli di uccisione delle cellule di influenza. Nell'esempio, uccisione di cella specifica del 15% è stato raggiunto ad una concentrazione relativamente alta di BTE 1 µ g/ml. Questo è un valore tipico per un esperimento con tempi lunghi co-incubazione e condizioni di coltura non ottimale delle cellule T. In altri contesti, fino al 60% specifiche uccisione è stata ottenuta utilizzando retroauricolari purificati da surnatanti MV-infettati, raggiungendo un plateau a concentrazioni BTE di 100 ng/mL e più alto38. Questo indica che, stranamente, il limite di questo test è inferiore al 100% abbattimento specifico, che può essere spiegato dalla cinetica di crescita differenti in Tmax controlli rispetto ai campioni di co-coltura. Clicca qui per visualizzare una versione più grande di questa figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

L'immunoterapia oncolytic (vale a dire., OVT in combinazione con immunomodulazione) rappresenta una grande promessa per il trattamento del cancro, chiedendo ulteriori sviluppo e ottimizzazione di virus oncolitici codifica proteine immunomodulatori. Questo protocollo descrive i metodi per generare e convalidare tali vettori per la prova successiva in modelli preclinici rilevanti e potenziale futuro traduzione clinica in nuove terapie anti-cancro.

Numerose piattaforme di virus oncolytic differenti con vantaggi distinti sono disponibili63. Oltre alla specificità di cancro, vettoriale sicurezza, requisiti per la produzione, l'efficacia nella lisi delle cellule del tumore e l'induzione della risposta immunitaria, clonazione di capacità è chiave per successo vettorizzazione di immunomodulatori utilizzando un oncolytic specifici. Purtroppo, i confronti diretti di OVs diversi attualmente mancano e dovrebbero essere perseguiti al fine di individuare le opzioni di trattamento ottimale per i singoli pazienti. Questo può essere facilitato promuovendo uno sviluppo razionale e test di nuovi vettori transgene-codifica, come esemplificato qui per MV-BTE. Date le proprietà benefiche del MV (cioè, oncotropism, sicurezza, fusogenicity, immunogenicità, fattibilità di modificazione genetica) questo protocollo si concentra su questo vettore oncolytic, che può essere generalizzato per altri OV, soprattutto paramyxoviruses .

Per una scelta razionale di immunomodulatori potenzialmente rilevanti come candidato transgeni (punto 1.1.1), una conoscenza approfondita del ciclo del cancro-immunità è essenziale, rendendo indispensabile la ricerca sistematica della letteratura. Inoltre, grandi schermi, anche se costosa, possono dimostrare il valuable per identificare nuovi bersagli (Vedi ad es., Patel et al.41).

Per la progettazione di OVs ricombinante, profili di espressione desiderata dovrebbero essere considerati. Nel caso di virus del RNA, espressione genica è controllata a livello di RNA da parte della polimerasi rispettivi. Quando si progetta il transgene cassette per l'inserimento nel genoma di MV (punto 1.1.2), evitare sequenze che ricordano MV segnali di avvio/arresto del gene della polimerasi e RNA editing siti e seguendo la regola di sei è cruciale per lo sviluppo di successo vettoriale. Inoltre, i livelli di espressione genica di paramixovirus corrispondono al posizionamento all'interno del genoma, derivando da un gradiente di espressione43. In generale, posizionamento del transgene in posizione a Monte aumenta l'espressione a scapito di replica ridotta. Tuttavia, questi parametri dipendono anche le dimensioni, la struttura e la sequenza del transgene rispettivo. Di conseguenza, una limitazione della metodologia descritta in questo protocollo è la necessità di prove empiriche di disegni vettoriali romanzo. In casi specifici, regolazioni per la sequenza di transgene o posizionamento può essere necessario per raggiungere caratteristiche vettoriale desiderato (Figura 2). Confronto sistematico delle posizioni differenti per l'anticorpo di checkpoint inserti hanno mostrati risultati ottimali per l'H- ATU (dati non pubblicati). Come BTE inserti hanno proprietà comparabili (dimensione e immunoglobulina domini), vettori di MV-BTE sono stati clonati Analogamente38.

Salvataggio di particelle infettive da virus cDNA (punto 2.1) può richiedere diversi tentativi per alcuni costrutti. Numeri delle cellule di regolazione può ottimizzare la densità delle cellule per la formazione di sincizi. Mentre una certa densità è necessaria per l'efficace diffusione di cellula--cellula e la fusione delle membrane cellulari, inibizione da contatto riduce la replicazione virale. Ulteriormente, il numero di particelle infettive può non essere sufficiente per indurre la fusione cellulare visibile. Tuttavia, come i virus possono essere presenti in assenza di sincizi, campioni di salvataggio però raccolto e trasferiti alle cellule fresche produttore per la propagazione di potenziali. Transfezione inefficiente a causa della scarsa qualità del DNA o reagenti di transfezione inadatto o degradate rappresentano i problemi tipici che sono relativamente facili da valutare e porre rimedio generando nuove preparazioni di DNA e test reagenti diversi, rispettivamente.

Propagazione di virus di successo (punto 2.2) è fondamentalmente dipendente le condizioni che determinano la replicazione virale e lisi cellulare. Si consiglia di utilizzare un numero basso passaggio di cellule di produttore, e cellule infettate devono essere controllati regolarmente per la progressione di sincizi. Numeri delle cellule di regolazione, temperature e tempi di incubazione possono essere necessari per bilanciare la proliferazione delle cellule di diffusione virale vs. .

Una limitazione fondamentale del metodo descritto produzione di virus è la preparazione di sospensioni di virus da lisati cellulari grezza. I ricercatori dovrebbero essere consapevoli del fatto che la sospensione di virus contiene fattori cellulari. Le particelle del virus possono essere concentrato tramite densità gradiente/saccarosio cuscino ultracentrifugazione a scapito del numero totale di particelle infettive e anche potenzialmente aumento delle concentrazioni di residui cellulari. Virus può anche essere concentrati da surnatanti della cellula infettata, aumentando la purezza, ma riducendo la resa generale. GMP e su larga scala produzione di paramyxoviruses viene in genere eseguita utilizzando più livelli di produttore cellule seminate su un filamento netto in bioreattori per titolo aumentato rendimento63. Accurato monitoraggio, supporto continuo scambio, circostanze senza siero e successiva filtrazione passi garantiranno elevata purezza del prodotto virus.

Valutazione di titoli virali (passaggi 2.3 e 3.1) tramite i sincizi descritti il metodo di conteggio non è preciso, ma è facile da eseguire e sufficientemente accurato quando si utilizza un numero adeguato di tecnico replica. Quando si valuta la citotossicità OV-mediata (punto 3.2), limitazioni delle analisi disponibili devono essere considerati. Analisi metaboliche non fanno distinzione tra effetti citostatici e citolitici di trattamenti sperimentali. Per misurare la citolisi, può essere eseguita un'analisi del rilascio LDH. Tuttavia, entrambi i tipi di analisi possono essere influenzati dal contenuto delle preparazioni di virus da lisati cellulari grezzo (Figura 6).

Isolamento di proteine espresse da cellule infettate da virus (punto 4.1) può variare notevolmente in resa e purezza, a seconda delle rispettivo transgene e virus usato nonché sulla precisione tecnica. Così, il controllo di qualità di purificazione della proteina è cruciale per la valutazione dei risultati sperimentali correlati.

Come una descrizione esaustiva di potenziali saggi funzionali che copre l'ampia varietà di possibili immunomodulatori esula dall'ambito della presente pubblicazione, questo protocollo si concentra sulla ex vivo metodologia per misurare la citotossicità cellulare (punto 4.3). Citotossicità cellulare, soprattutto dalle cellule di T di CD8 +, è un mediatore importante di controllo immunologico del tumore nel successo immunoterapie64. Questo ha implicazioni importanti per attuali approcci di immunoterapia usando gli anticorpi per migliorare in generale la risposta immunitaria anti-tumorale e anticorpo cellula T Ager in particolare. Espressione di BTE locale da vettori oncolytic ha dato risultati promettenti in parecchi studi preclinici, compreso38 di RNA e DNA virus65,66,67,68.

A causa di complesse interazioni di tumore, virus, prodotto del transgene e sistema immunitario ospite negli organismi viventi, convalida di immunomodulatore-codifica oncolytic vettori nella coltura cellulare, come dimostrato qui non è sufficiente a predire i risultati terapeutici. D'importanza, la valutazione proposta isolata delle funzioni vettoriali e immunomodulatore, rispettivamente, è essenziale per la prova di concetto ma non riesce a descrivere le potenziali sinergie e interazioni complesse all'interno del microambiente tumorale. Test di tossicità sia l'efficacia in modelli in vivo pertinenti è cruciale per ulteriore sviluppo del romanzo vettore ricombinante costruisce ma non è facilmente realizzabile. Sicurezza immunologica è regolarmente monitorato in primati non umani come macachi e modelli murini sono utilizzati per biodistribuzione e analizza l'efficacia20,69. Tuttavia, molti di questi modelli hanno dei limiti per quanto riguarda l'espressione dei recettori del virus nei tessuti dell'ospite e permissività di host, e alcuni soltanto insufficientemente imitare l'interazione complessa di OV, tumore e microambiente immune. Pertanto, un'attenta considerazione di appropriati modelli è obbligatoria.

Trattamento di MV-BTE precedentemente è stata valutata in xenotrapianto umano e modelli syngeneic del topo. Nessun transgene BTE prodotti erano rilevabili nel siero dei topi trattati con codifica BTE MV38, che indica la riuscita prevenzione dell'esposizione sistemica anche senza ulteriore attenuazione del virus oncotropic naturalmente ceppo del vaccino. Espressione locale è cruciale per gli immunomodulatori OV-codificati che sono tossici quando somministrato per via sistemica. Se necessario, specificità del tumore può essere migliorata da re-targeting per cellulari marcatori di superficie di scelta70,71,72 e basata su microRNA de-targeting per una maggiore oncotropism73,74 ( Recensito da Ruiz e Russell75). Ulteriori modifiche possono essere introdotte per ottimizzare vettori per specifici usi terapeutici (recensiti da Miest e Cattaneo76), incluso l'inserimento di transgeni per scopi diagnostici77,78 o profarmaco conversione per ridurre al minimo gli effetti collaterali della chemioterapia79,80, introduzione di sicurezza passa81e il targeting di stroma tumorale o sistema vascolare (ad esempio tramite anticorpo anticorpi82).

A parte la modificazione genetica del vettore virale, regimi di combinazione con chimerico antigene recettore (auto) T cell trasferiscono83, chemioterapia84,85,86o radioterapia87, 88 , 89 ulteriormente aumentare il repertorio di OVT. Come immunità MV è altamente prevalente, strategie per eludere la neutralizzazione dell'anticorpo sono state sviluppate, compreso lo scambio di glicoproteine busta per quelli di paramyxoviruses relative al90, rivestimento polimerico delle particelle, utilizzando i vettori delle cellule a consegnare il virus e immunosoppressione transitoria (Recensito da Russell et al.6). Ulteriore sviluppo di regimi di immunoterapia OV avanzati richiede il test di sicurezza e di efficacia terapeutica in modelli animali appropriati, con materiale paziente e, infine, negli studi clinici controllati.

Data la pletora di possibili combinazioni, serie completa di test non è fattibile. Modellazione matematica può aiutare nella prioritizzazione dei potenziali regimi di combinazione come pure loro rispettivo dosaggio e pianificazione di predire i risultati del trattamento in silico (Recensito da Santiago et al.91). Durante il test efficacies di romanzo, razionalmente progettati vettori, suono che accompagna la ricerca traslazionale è strumentale per una più profonda comprensione dei processi sottostanti virologici ed immunologici. Questo è fondamentale per la generazione di modelli adeguati, informazioni su ulteriori potenziali bersagli e l'avanzamento nel settore in generale. In conclusione, conoscenza di prima mano i pertinenti metodi di disegno vettoriale, generazione e caratterizzazione di questa linea di lavoro sarà accelerare lo sviluppo e supportare l'esplorazione di nuove terapie per traduzione clinica futura.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

C.E. Engeland è elencato come co-inventore di un brevetto per quanto riguarda virus del RNA per cancro Immunovirotherapy posseduto dall'Università di Heidelberg. J.P.W Heidbuechel non ha nulla a rivelare.

Acknowledgments

Questi metodi sono stati stabiliti nel gruppo Oncolitica guidato dal Prof. Dr. Dr. Guy Ungerechts presso il centro nazionale per patologie tumorali a Heidelberg. Siamo grati a lui e tutti i membri del team di laboratorio, soprattutto Dr. Tobias Speck, Dr. Rūta Veinalde, Judith Förster, Birgit Hoyler e Jessica Albert. Questo lavoro è stato supportato dall'altro Kröner-Fresenius-Stiftung (Grant 2015_A78 al C.E. Engeland) e la Fondazione di scienza nazionale tedesca (DFG, concedere EN 1119/2-1 al C.E. Engeland). J.P.W Heidbuechel riceve uno stipendio da Helmholtz International Graduate School for Cancer Research.

Materials

Name Company Catalog Number Comments
Rapid DNA Dephos & Ligation Kit Roche Life Science, Mannheim, Germany 4898117001
CloneJET PCR Cloning Kit Thermo Fisher Scientific, St. Leon-Rot K1231
Agarose Sigma-Aldrich, Taufkirchen, Germany A9539-500G
QIAquick Gel Extraction Kit QIAGEN, Hilden, Germany 28704
NEB 10-beta Competent E. coli New England Biolabs (NEB), Frankfurt/Main, Germany C3019I
LB medium after Lennox Carl Roth, Karlsruhe, Germany X964.1
Ampicillin Carl Roth, Karlsruhe, Germany HP62.1
QIAquick Miniprep Kit QIAGEN, Hilden, Germany 27104
Restriction enzyme HindIII-HF New England Biolabs (NEB), Frankfurt/Main, Germany R3104S
Dulbecco's Modified Eagle's Medium (DMEM) Invitrogen, Darmstadt, Germany 31966-021
Fetal bovine serum (FBS) Biosera, Boussens, France FB-1280/500
FugeneHD Promega, Mannheim, Germany E2311 may be replaced by transfection reagent of choice
Kanamycin Sigma-Aldrich, Taufkirchen, Germany K0129
Vero cells ATCC, Manassas, VA, USA CCL81
B16-CD46/ B16-CD20-CD46 J. Heidbuechel, DKFZ Heidelberg available upon request
Granta-519 DSMZ, Braunschweig, Germany ACC 342
Opti-MEM (serum-free medium) Gibco Life Technologies, Darmstadt, Germany 31985070
Colorimetric Cell Viability Kit III (XTT) PromoKine, Heidelberg, Germany PK-CA20-300-1000 includes XTT reagent
Dulbecco's Phosphate-Buffered Saline (PBS) Gibco Life Technologies, Darmstadt, Germany 14190-094
QIAquick Ni-NTA Spin Columns QIAGEN, Hilden, Germany 31014
Sodium chloride Carl Roth, Karlsruhe, Germany 3957.3
Imidazole Carl Roth, Karlsruhe, Germany I5513-25G
Amicon Ultra-15, PLGC Ultracel-PL Membran, 10 kDa Merck, Darmstadt, Germany UFC901024
BCA Protein Assay Kit Merck Milipore 71285-3
IgG from human serum Sigma-Aldrich, Taufkirchen, Germany I4506
Anti-HA-PE Miltenyi Biotech, Bergisch Gladbach, Germany 130-092-257 RRID: AB_871939
Mouse IgG1, kappa Isotype Control, Phycoerythrin Conjugated, Clone MOPC-21 antibody BD Biosciences, Heidelberg, Germany 555749 RRID: AB_396091
Anti-HA-biotin antibody, clone 3F10 Sigma-Aldrich, Taufkirchen, Germany 12158167001 RRID: AB_390915
Anti-Biotin MicroBeads Miltenyi Biotech, Bergisch Gladbach, Germany 130-090-485
MS Columns Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-201
MiniMACS Separator Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-102
MACS MultiStand Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-303
RIPA buffer Rockland Immunochemicals, Gilbertsville, PA, USA MB-030-0050
CytoTox 96 Non-Radioactive Cytotoxicity Assay Promega, Mannheim, Germany G1780 includes 10x lysis solution, substrate solution (substrate mix and assay buffer), and stop solution
Cell lifter Corning, Reynosa, Mexico 3008
10 cm dishes Corning, Oneonta, NY, USA 430167
15 cm dishes Greiner Bio-One, Frickenhausen, Germany 639160
96-well plates, U-bottom TPP, Trasadingen, Switzerland 92097
96-well plates, flat bottom Neolab, Heidelberg, Germany 353072
6-well plates Neolab, Heidelberg, Germany 353046
12-well plates Neolab, Heidelberg, Germany 353043
50 mL tubes nerbe plus, Winsen/Luhe, Germany 02-572-3001
T175 cell culture flasks Thermo Fisher Scientific, St. Leon-Rot 159910
0.22 µm filters Merck, Darmstadt, Germany SLGPM33RS

DOWNLOAD MATERIALS LIST

References

  1. Lichty, B. D., Breitbach, C. J., Stojdl, D. F., Bell, J. C. Going viral with cancer immunotherapy. Nature Reviews Cancer. 14, (8), 559-567 (2014).
  2. Cassady, K. A., Haworth, K. B., Jackson, J., Markert, J. M., Cripe, T. P. To Infection and Beyond: The Multi-Pronged Anti-Cancer Mechanisms of Oncolytic Viruses. Viruses. 8, (2), (2016).
  3. Twumasi-Boateng, K., Pettigrew, J. L., Kwok, Y. Y. E., Bell, J. C. Oncolytic viruses as engineering platforms for combination immunotherapy. Nature Reviews Cancer. (2018).
  4. Achard, C., et al. Lighting a Fire in the Tumor Microenvironment Using Oncolytic Immunotherapy. EBioMedicine. 31, 17-24 (2018).
  5. Kelly, E., Russell, S. J. History of oncolytic viruses: genesis to genetic engineering. Molecular Therapy. The Journal of the American Society of Gene Therapy. 15, (4), 651-659 (2007).
  6. Russell, S. J., Peng, K. W., Bell, J. C. Oncolytic virotherapy. Nature Biotechnology. 30, (7), 658-670 (2012).
  7. Russell, S. J., Peng, K. W. Oncolytic Virotherapy: A Contest between Apples and Oranges. Molecular Therapy: The Journal of the American Society of Gene Therapy. 25, (5), 1107-1116 (2017).
  8. Seymour, L. W., Fisher, K. D. Oncolytic viruses: finally delivering. British Journal of Cancer. 114, (4), 357-361 (2016).
  9. Chen, D. S., Mellman, I. Oncology meets immunology: the cancer-immunity cycle. Immunity. 39, (1), 1-10 (2013).
  10. Gao, Q., Park, M. S., Palese, P. Expression of transgenes from newcastle disease virus with a segmented genome. Journal of Virology. 82, (6), 2692-2698 (2008).
  11. Billeter, M. A., Naim, H. Y., Udem, S. A. Reverse genetics of measles virus and resulting multivalent recombinant vaccines: applications of recombinant measles viruses. Current Topics in Microbiology and Immunology. 329, 129-162 (2009).
  12. Matveeva, O. V., Guo, Z. S., Shabalina, S. A., Chumakov, P. M. Oncolysis by paramyxoviruses: multiple mechanisms contribute to therapeutic efficiency. Molecular Therapy Oncolytics. 2, (2015).
  13. Suter, S. E., et al. In vitro canine distemper virus infection of canine lymphoid cells: a prelude to oncolytic therapy for lymphoma. Clinical Cancer Research. 11, (4), 1579-1587 (2005).
  14. Ammayappan, A., Russell, S. J., Federspiel, M. J. Recombinant mumps virus as a cancer therapeutic agent. Molecular Therapy Oncolytics. 3, 16019 (2016).
  15. Schirrmacher, V. Oncolytic Newcastle disease virus as a prospective anti-cancer therapy. A biologic agent with potential to break therapy resistance. Expert Opinion on Biological Therapy. 15, (12), 1757-1771 (2015).
  16. Saga, K., Kaneda, Y. Oncolytic Sendai virus-based virotherapy for cancer: recent advances. Oncolytic Virotherapy. 4, 141-147 (2015).
  17. Matveeva, O. V., Kochneva, G. V., Netesov, S. V., Onikienko, S. B., Chumakov, P. M. Mechanisms of Oncolysis by Paramyxovirus Sendai. Acta Naturae. 7, (2), 6-16 (2015).
  18. Gainey, M. D., Manuse, M. J., Parks, G. D. A hyperfusogenic F protein enhances the oncolytic potency of a paramyxovirus simian virus 5 P/V mutant without compromising sensitivity to type I interferon. Journal of Virology. 82, (19), 9369-9380 (2008).
  19. Engeland, C. E., et al. A Tupaia paramyxovirus vector system for targeting and transgene expression. The Journal of General Virology. 98, (9), 2248-2257 (2017).
  20. Russell, S. J., Peng, K. W. Measles virus for cancer therapy. Current Topics in Microbiology and Immunology. 330, 213-241 (2009).
  21. Aref, S., Bailey, K., Fielding, A. Measles to the Rescue: A Review of Oncolytic Measles Virus. Viruses. 8, (10), (2016).
  22. Demicheli, V., Rivetti, A., Debalini, M. G., Di Pietrantonj, C. Vaccines for measles, mumps and rubella in children. The Cochrane Database of Systematic Reviews. (2), 004407 (2012).
  23. Radecke, F., et al. Rescue of measles viruses from cloned DNA. The EMBO Journal. 14, (23), 5773-5784 (1995).
  24. Martin, A., Staeheli, P., Schneider, U. RNA polymerase II-controlled expression of antigenomic RNA enhances the rescue efficacies of two different members of the Mononegavirales independently of the site of viral genome replication. Journal of Virology. 80, (12), 5708-5715 (2006).
  25. Russell, S. J., et al. Remission of disseminated cancer after systemic oncolytic virotherapy. Mayo Clinic Proceedings. 89, (7), 926-933 (2014).
  26. Hardcastle, J., et al. Immunovirotherapy with measles virus strains in combination with anti-PD-1 antibody blockade enhances antitumor activity in glioblastoma treatment. Neuro-Oncology. 19, (4), 493-502 (2017).
  27. Dispenzieri, A., et al. Phase I trial of systemic administration of Edmonston strain of measles virus genetically engineered to express the sodium iodide symporter in patients with recurrent or refractory multiple myeloma. Leukemia. 31, (12), 2791-2798 (2017).
  28. Galanis, E., et al. Phase I trial of intraperitoneal administration of an oncolytic measles virus strain engineered to express carcinoembryonic antigen for recurrent ovarian cancer. Cancer Research. 70, (3), 875-882 (2010).
  29. Galanis, E., et al. Oncolytic measles virus expressing the sodium iodide symporter to treat drug-resistant ovarian cancer. Cancer Research. 75, (1), 22-30 (2015).
  30. Kurokawa, C., et al. Constitutive Interferon Pathway Activation in Tumors as an Efficacy Determinant Following Oncolytic Virotherapy. Journal of the National Cancer Institute. (2018).
  31. Msaouel, P., et al. Clinical Trials with Oncolytic Measles Virus: Current Status and Future Prospects. Current Cancer Drug Targets. 18, (2), 177-187 (2018).
  32. Grote, D., Cattaneo, R., Fielding, A. K. Neutrophils contribute to the measles virus-induced antitumor effect: enhancement by granulocyte macrophage colony-stimulating factor expression. Cancer Research. 63, (19), 6463-6468 (2003).
  33. Grossardt, C., et al. Granulocyte-macrophage colony-stimulating factor-armed oncolytic measles virus is an effective therapeutic cancer vaccine. Human Gene Therapy. 24, (7), 644-654 (2013).
  34. Iankov, I. D., et al. Expression of immunomodulatory neutrophil-activating protein of Helicobacter pylori enhances the antitumor activity of oncolytic measles virus. Molecular Therapy: The Journal of the American Society of Gene Therapy. 20, (6), 1139-1147 (2012).
  35. Engeland, C. E., et al. CTLA-4 and PD-L1 Checkpoint Blockade Enhances Oncolytic Measles Virus Therapy. Molecular Therapy: The Journal of the American Society of Gene Therapy. 22, (11), 1949-1959 (2014).
  36. Veinalde, R., et al. Oncolytic measles virus encoding interleukin-12 mediates potent antitumor effects through T cell activation. Oncoimmunology. 6, (4), 1285992 (2017).
  37. Hutzler, S., et al. Antigen-specific oncolytic MV-based tumor vaccines through presentation of selected tumor-associated antigens on infected cells or virus-like particles. Scientific Reports. 7, (1), 16892 (2017).
  38. Speck, T., et al. Targeted BiTE expression by an oncolytic vector augments therapeutic efficacy against solid tumors. Clinical Cancer Research. (2018).
  39. Andtbacka, R. H., et al. Talimogene Laherparepvec Improves Durable Response Rate in Patients With Advanced Melanoma. Journal of Clinical Oncology: Official Journal of the American Society of Clinical Oncology. 33, (25), 2780-2788 (2015).
  40. Ribas, A., et al. Oncolytic Virotherapy Promotes Intratumoral T Cell Infiltration and Improves Anti-PD-1 Immunotherapy. Cell. 170, (6), 1109-1119 (2017).
  41. Patel, S. J., et al. Identification of essential genes for cancer immunotherapy. Nature. 548, (7669), 537-542 (2017).
  42. Kimple, M. E., Brill, A. L., Pasker, R. L. Overview of affinity tags for protein purification. Current Protocols in Protein Science. 73, Unit 9.9 (2013).
  43. Cattaneo, R., Rebmann, G., Baczko, K., ter Meulen, V., Billeter, M. A. Altered ratios of measles virus transcripts in diseased human brains. Virology. 160, (2), 523-526 (1987).
  44. Gutsche, I., et al. Structural virology. Near-atomic cryo-EM structure of the helical measles virus nucleocapsid. Science. 348, (6235), New York, N.Y. 704-707 (2015).
  45. Kolakofsky, D., et al. Paramyxovirus RNA synthesis and the requirement for hexamer genome length: the rule of six revisited. Journal of Virology. 72, (2), 891-899 (1998).
  46. Kolakofsky, D., Roux, L., Garcin, D., Ruigrok, R. W. Paramyxovirus mRNA editing, the "rule of six" and error catastrophe: a hypothesis. The Journal of General Virology. 86, Pt 7 1869-1877 (2005).
  47. Parks, C. L., et al. Analysis of the noncoding regions of measles virus strains in the Edmonston vaccine lineage. Journal of Virology. 75, (2), 921-933 (2001).
  48. JoVE Science Education Database. Molecular Cloning. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  49. JoVE Science Education Database. Bacterial Transformation: The Heat Shock Method. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  50. Bergkessel, M., Guthrie, C. Colony PCR. Methods in Enzymology. 529, 299-309 (2013).
  51. Rota, J. S., Wang, Z. D., Rota, P. A., Bellini, W. J. Comparison of sequences of the H, F, and N coding genes of measles virus vaccine strains. Virus Research. 31, (3), 317-330 (1994).
  52. Bankamp, B., Takeda, M., Zhang, Y., Xu, W., Rota, P. A. Genetic characterization of measles vaccine strains. The Journal of Infectious Diseases. 204, Suppl 1 533-548 (2011).
  53. Dulbecco, R., Vogt, M. Plaque formation and isolation of pure lines with poliomyelitis viruses. The Journal of Experimental Medicine. 99, (2), 167-182 (1954).
  54. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical Biochemistry. 150, (1), 76-85 (1985).
  55. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry. 72, 248-254 (1976).
  56. JoVE Science Education Database. Separating Protein with SDS-PAGE. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  57. JoVE Science Education Database. The Western Blot. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  58. Menck, K., et al. Isolation of human monocytes by double gradient centrifugation and their differentiation to macrophages in teflon-coated cell culture bags. Journal of Visualized Experiments. (91), e51554 (2014).
  59. Quah, B. J., Parish, C. R. The use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to monitor lymphocyte proliferation. Journal of Visualized Experiments. (44), (2010).
  60. Gerdes, J. Ki-67 and other proliferation markers useful for immunohistological diagnostic and prognostic evaluations in human malignancies. Seminars in Cancer Biology. 1, (3), 199-206 (1990).
  61. JoVE Science Education Database. The Transwell Migration Assay. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  62. Lim, J. F., Berger, H., Su, I. H. Isolation and Activation of Murine Lymphocytes. Journal of Visualized Experiments. (116), e54596 (2016).
  63. Ungerechts, G., et al. Moving oncolytic viruses into the clinic: clinical-grade production, purification, and characterization of diverse oncolytic viruses. Molecular Therapy Methods & Clinical Development. 3, 16018 (2016).
  64. Fridman, W. H., Zitvogel, L., Sautes-Fridman, C., Kroemer, G. The immune contexture in cancer prognosis and treatment. Nature Reviews Clinical Oncology. 14, (12), 717-734 (2017).
  65. Yu, F., et al. T-cell engager-armed oncolytic vaccinia virus significantly enhances antitumor therapy. Molecular Therapy: The Journal of the American Society of Gene Therapy. 22, (1), 102-111 (2014).
  66. Fajardo, C. A., et al. Oncolytic Adenoviral Delivery of an EGFR-Targeting T-cell Engager Improves Antitumor Efficacy. Cancer Research. 77, (8), 2052-2063 (2017).
  67. Freedman, J. D., et al. Oncolytic adenovirus expressing bispecific antibody targets T-cell cytotoxicity in cancer biopsies. EMBO Molecular Medicine. 9, (8), 1067-1087 (2017).
  68. Wing, A., et al. Improving CART-Cell Therapy of Solid Tumors with Oncolytic Virus-Driven Production of a Bispecific T-cell Engager. Cancer Immunology Research. 6, (5), 605-616 (2018).
  69. Myers, R. M., et al. Preclinical pharmacology and toxicology of intravenous MV-NIS, an oncolytic measles virus administered with or without cyclophosphamide. Clinical Pharmacology and Therapeutics. 82, (6), 700-710 (2007).
  70. Rittner, K., Schreiber, V., Erbs, P., Lusky, M. Targeting of adenovirus vectors carrying a tumor cell-specific peptide: in vitro and in vivo studies. Cancer Gene Therapy. 14, (5), 509-518 (2007).
  71. Nakamura, T., et al. Rescue and propagation of fully retargeted oncolytic measles viruses. Nature Biotechnology. 23, (2), 209-214 (2005).
  72. Campadelli-Fiume, G., et al. Retargeting Strategies for Oncolytic Herpes Simplex Viruses. Viruses. 8, (3), 63 (2016).
  73. Leber, M. F., et al. MicroRNA-sensitive oncolytic measles viruses for cancer-specific vector tropism. Molecular Therapy: The Journal of the American Society of Gene Therapy. 19, (6), 1097-1106 (2011).
  74. Baertsch, M. A., et al. MicroRNA-mediated multi-tissue detargeting of oncolytic measles virus. Cancer Gene Therapy. 21, (9), 373-380 (2014).
  75. Ruiz, A. J., Russell, S. J. MicroRNAs and oncolytic viruses. Current Opinion in Virology. 13, 40-48 (2015).
  76. Miest, T. S., Cattaneo, R. New viruses for cancer therapy: meeting clinical needs. Nature Reviews Microbiology. 12, (1), 23-34 (2014).
  77. Phuong, L. K., et al. Use of a vaccine strain of measles virus genetically engineered to produce carcinoembryonic antigen as a novel therapeutic agent against glioblastoma multiforme. Cancer Research. 63, (10), 2462-2469 (2003).
  78. Dingli, D., et al. Image-guided radiovirotherapy for multiple myeloma using a recombinant measles virus expressing the thyroidal sodium iodide symporter. Blood. 103, (5), 1641-1646 (2004).
  79. Abate-Daga, D., et al. Oncolytic adenoviruses armed with thymidine kinase can be traced by PET imaging and show potent antitumoural effects by ganciclovir dosing. PLoS One. 6, (10), 26142 (2011).
  80. Ungerechts, G., et al. Lymphoma chemovirotherapy: CD20-targeted and convertase-armed measles virus can synergize with fludarabine. Cancer Research. 67, (22), 10939-10947 (2007).
  81. Ketzer, P., et al. Artificial riboswitches for gene expression and replication control of DNA and RNA viruses. Proceedings of the National Academy of Sciences of the United States of America. 111, (5), 554-562 (2014).
  82. Freedman, J., et al. Targeting T-cells to human cancer associated fibroblasts using an oncolytic virus expressing a FAP-specific T-cell engager. Keystone Symposia & Digitell, Inc. (2018).
  83. Nishio, N., et al. Armed oncolytic virus enhances immune functions of chimeric antigen receptor-modified T cells in solid tumors. Cancer Research. 74, (18), 5195-5205 (2014).
  84. Bressy, C., Benihoud, K. Association of oncolytic adenoviruses with chemotherapies: an overview and future directions. Biochemical Pharmacology. 90, (2), 97-106 (2014).
  85. Wennier, S. T., Liu, J., McFadden, G. Bugs and drugs: oncolytic virotherapy in combination with chemotherapy. Current Pharmaceutical Biotechnology. 13, (9), 1817-1833 (2012).
  86. Fillat, C., Maliandi, M. V., Mato-Berciano, A., Alemany, R. Combining oncolytic virotherapy and cytotoxic therapies to fight cancer. Current Pharmaceutical Design. 20, (42), 6513-6521 (2014).
  87. Li, H., Peng, K. W., Russell, S. J. Oncolytic measles virus encoding thyroidal sodium iodide symporter for squamous cell cancer of the head and neck radiovirotherapy. Human Gene Therapy. 23, (3), 295-301 (2012).
  88. Opyrchal, M., et al. Effective radiovirotherapy for malignant gliomas by using oncolytic measles virus strains encoding the sodium iodide symporter (MV-NIS). Human Gene Therapy. 23, (4), 419-427 (2012).
  89. Mansfield, D., et al. Oncolytic Vaccinia virus and radiotherapy in head and neck cancer. Oral Oncology. 49, (2), 108-118 (2013).
  90. Miest, T. S., et al. Envelope-chimeric entry-targeted measles virus escapes neutralization and achieves oncolysis. Molecular Therapy: The Journal of the American Society of Gene Therapy. 19, (10), 1813-1820 (2011).
  91. Santiago, D. N., et al. Fighting Cancer with Mathematics and Viruses. Viruses. 9, (9), (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics