Paramyxovirussen voor Tumor-gerichte immunomodulatie: ontwerp en evaluatie Ex Vivo

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Dit protocol beschrijft een gedetailleerde workflow voor de generatie en ex vivo karakterisering van oncolytische virussen voor expressie van immunomodulators, met behulp van mazelen virussen bispecifieke T cel engagers codering als een voorbeeld. Toepassing en aanpassing aan andere vector platforms en transgenen zal de ontwikkeling van nieuwe immunovirotherapeutics voor klinische vertaling versnellen.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Heidbuechel, J. P., Engeland, C. E. Paramyxoviruses for Tumor-targeted Immunomodulation: Design and Evaluation Ex Vivo. J. Vis. Exp. (143), e58651, doi:10.3791/58651 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Succesvolle kanker immunotherapie heeft het potentieel om op lange termijn tumor controle. Ondanks recente klinische successen blijft er een dringende behoefte aan veilige en effectieve therapieën die zijn toegesneden op individuele tumor immuun profielen. Oncolytische virussen kunnen de inductie van anti-tumor immuunresponsen evenals tumor-beperkte genexpressie. Dit protocol beschrijft de generatie en ex vivo analyse van immunomodulerende oncolytische vectoren. Focussen op mazelen vaccin virussen bispecifieke T cel engagers codering als een voorbeeld, kan de algemene methodologie worden aangepast aan andere soorten van het virus en de transgenen. De gepresenteerde workflow omvat het ontwerp, klonen, redding en verspreiding van recombinante virussen. Testen om replicatie kinetiek en lytische activiteit van de vector en de functionaliteit van de geïsoleerde immunomodulator ex vivo te analyseren zijn opgenomen, waardoor de generatie van nieuwe agenten voor de verdere ontwikkeling in preklinische modellen en uiteindelijk klinische vertaling.

Introduction

Oncolytische virussen (OVs) worden ontwikkeld als anti-kanker therapieën die specifiek repliceren binnen en doden tumorcellen terwijl gezonde weefsels intact blijven. Het is inmiddels gemeenschappelijk begrip dat oncolytische een (Overurentar), in de meeste gevallen, niet afhankelijk is van de lysis van de volledige tumor uitsluitend door efficiënte replicatie en verspreiding van het virus, maar vergt extra mechanismen van actie voor de behandeling succes, met inbegrip van vasculaire en stromale targeting en, belangrijker, immuun stimulatie1,,2,,3,4. Terwijl vele vroege OV studies ongewijzigde virussen gebruikt, heeft huidige onderzoek geprofiteerd van een verbeterde biologische begrip, virus biobanken die potentieel bevatten roman OVs, en de mogelijkheden aangeboden door genetische manipulatie om te maken van geavanceerde OV platformen5,6,7.

Gezien het recente succes van immunotherapie, zijn immunomodulerende transgenen van bijzonder belang met betrekking tot de genetische modificatie van OVs. Gerichte uitdrukking van dergelijke genproducten door OV-geïnfecteerde tumorcellen vermindert toxiciteit in vergelijking met systemische toediening. Gericht op wordt bereikt met behulp van virussen met inherente oncoselectivity of door aanpassing van virale tropisme8. Lokale immunomodulatie verbetert de veelzijdige anti-tumor mechanismen van Overurentar. Bovendien is deze strategie instrumenteel in het ondervragen van de wisselwerking tussen virussen, tumorcellen, en het immuunsysteem van de gastheer. Dit protocol biedt daartoe een toepasselijke en instelbare workflow te ontwerpen, kloon, redden, propageren, en valideren van oncolytische paramyxovirus (specifiek Mazelenvirus) vectoren codering van dergelijke transgenen.

Modulatie van de immuunrespons kan worden bereikt door een breed scala aan transgenic producten gericht op de verschillende stappen van de kanker-immuniteit cyclus9, waaronder verbetering van de tumor antigeen erkenning [bv. tumor-geassocieerde antigenen (TAAs) of inductoren van grote histocompatibility complex (MHC) klasse I moleculen] over ondersteuning van dendritische cel rijping voor efficiënte antigeen presentatie (cytokines); werven en activeren van gewenste immune cellen zoals cytotoxische en helper T cellen [chemokines, bispecifieke T cel engagers (BTEs)]; gericht op onderdrukkende cellen zoals regulatoire T-cellen, suppressor myeloïde-afgeleide cellen, tumor-geassocieerde macrofagen en fibroblasten kanker-geassocieerde (antilichamen, BTEs, cytokines); en het voorkomen van effector cel inhibitie en uitputting (checkpoint-remmers). Een overvloed aan biologische agentia is dus beschikbaar. Evaluatie van dergelijke immunomodulators virus-gecodeerd met betrekking tot de therapeutische werking en mogelijke synergie, evenals het begrip van de respectieve mechanismen is nodig ter verbetering van kankertherapie.

Negatieve zin single-stranded RNA virussen uit de familie van de Paramyxoviridae worden gekenmerkt door verschillende functies dat bevorderlijk is voor hun gebruik als oncolytische vectoren. Het gaat hierbij om een natuurlijke oncotropism, grote genomic capaciteit voor transgenen (meer dan 5 kb)10,11, efficiënte verspreiding met inbegrip van de vorming van syncytia en hoge immunogeniciteit12. Daarom OV platformen op basis van canine distemper virus13, bof virus14, Newcastle disease virus15, Sendai virus16,17, simian virus 518en Tupaia paramyxovirus19 zijn ontwikkeld. Meest prominent, levende verzwakte mazelen virus vaccin stammen (MV) vorderingen preklinische en klinische ontwikkeling20,21 gemaakt hebben. Deze virusstammen zijn gebruikt voor decennia voor routinematige immunisatie met een uitstekende veiligheid record22. Bovendien is er geen risico voor dat mutagenese als gevolg van de strikt cytosolische replicatie van paramyxovirussen. Een veelzijdige omgekeerde genetica-systeem op basis van anti-genomic cDNA dat voorziet in de invoeging van transgenen in extra transcriptie eenheden (ATUs) is beschikbaar11,23,24. MV vectoren Natriumjodide symporter (MV-NOS) codering voor beeldvorming en radiotherapie of oplosbare carcino antigeen (MV-CEA) als een surrogaat marker voor virale genexpressie zijn momenteel geëvalueerd in klinische proeven (NCT02962167, NCT02068794, NCT02192775, NCT01846091, NCT02364713, NCT00450814, NCT02700230, NCT03456908, NCT00408590 en NCT00408590). Veilige beheer is bevestigd en gevallen van anti-tumor werkzaamheid hebben gemeld in vorige studies25,26,27,28,29, 30 (herzien door Msaouel et al.31), de weg vrijmaakt voor extra oncolytische mazelen virussen die zijn ontwikkeld en getest preclinically. MV immunomodulerende moleculen gericht op de verschillende stappen van de cyclus voor kanker-immuniteit is aangetoond dat de vertraging van de tumorgroei en/of verlengen van overleven in muizen, met bewijs voor immuun-gemedieerde werkzaamheid en lange-termijn beschermende immuun geheugen in syngeneic codering Muismodellen. Vector-gecodeerde transgenen omvatten granulocyt-macrofaag kolonie stimulerende factor (GM-CSF)32,33, H. pylori neutrofiele-activeren eiwit34, immuun checkpoint remmers35, interleukine-12 (IL-12)36, TAAs37BTEs38, die een tumor cross-link oppervlakte-antigeen met CD3 en dus induceren anti-tumor activiteit door polyklonale T-cellen, ongeacht de T cel receptor specificiteit en co-stimulatie ( Figuur 1). De veelbelovende preklinische resultaten voor deze constructies vraag verder translationeel inspanningen.

Talimogene laherparepvec (T-VEC), een type ik herpes simplexvirus GM-CSF, codering is de enige oncolytische therapeutische goedgekeurd door de Amerikaanse Food en Drug Administration (FDA) and Europese geneesmiddelen Agentschap (EMA). De fase III studie leidt tot goedkeuringen in eind 2015 heeft alleen geen werkzaamheid op de site van intra-tumoral injectie, maar ook abscopal effecten (dwz, remissies van niet-geïnjecteerde laesies) in geavanceerde melanoom39getoond. T-VEC gekomen sindsdien bijkomende proeven voor toepassing in andere entiteiten van de tumor (bijvoorbeeld, niet-melanoom huidkanker, NCT03458117, alvleesklierkanker, NCT03086642) en voor de evaluatie van combinatie therapieën, vooral met immuun checkpoint remmers (NCT02978625, NCT03256344, NCT02509507, NCT02263508, NCT02965716, NCT02626000, NCT03069378, NCT01740297 en Ribas et al.40).

Hieruit blijkt dat niet alleen het potentieel van oncolytische immunotherapie, maar ook de noodzaak van verder onderzoek om te identificeren van superieure combinaties van Overurentar en immunomodulatie. Rationeel ontwerp van aanvullende vectoren en hun ontwikkeling voor preklinische testen is de sleutel tot deze onderneming. Dit zal ook verder inzicht in de onderliggende mechanismen en gevolgen heeft voor de progressie naar meer gepersonaliseerde behandeling van kanker. Te dien einde presenteert deze publicatie de methodologie voor de wijziging en de ontwikkeling van paramyxovirussen voor gerichte kanker immunotherapie en, meer in het bijzonder, oncolytische mazelen virussen codering van T-cel-boeiende antilichamen (Figuur 2).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Opmerking: [O], [P], en [M] subsecties toepassing op te geven: OVs in generaal, (de meeste) paramyxovirussen of MV alleen, respectievelijk. [B] geeft aan secties specifiek voor BTE transgenen.

1 klonen van Immunomodulator-encoding transgenen in mazelen Virus vectoren

  1. [O] ontwerp invoegen volgorde.
    1. [O] beslissen over een immunomodulator van belang gebaseerd op literatuuronderzoek of experimentele gegevens zoals genetische schermen41 en de volgorde van de relevante cDNA ontlenen geschikte databases zoals GenBank, het European Archive van de Nucleotide, of de internationale Immunogenetica informatiesysteem (IMGT).
    2. [O] extra functies toevoegen aan de reeks transgenic (Figuur 3). Een voorafgaande Kozak sequentie en soortspecifieke codon optimalisatie kunnen verbeteren expressie. Signaal-sequenties zijn vereist voor de secretie. Codering van N - en/of C-terminal eiwit tags voor detectie en zuivering42sequenties bevatten. Omvatten beperkingsplaatsen voor plaatsing in de vector.
      Opmerking: [M] extra transcriptie eenheden (ATUs) herbergen MV polymerase gene start en stop signalen nodig zijn voor transgenic expressie van recombinante MV genomen. Geschikt anti-genomic cDNA vectoren, bestuurd door CMV initiatiefnemers en met ATUs met unieke beperkingsplaatsen voor invoering van positieve zin transgenen op gedefinieerde posities, zijn ontwikkeld eerder11. [P] adequate positionering van de transgenic is van cruciaal belang, omdat het invloed heeft op de virale replicatie en transgenic expressie als gevolg van de expressie verloop typisch voor paramyxovirussen43. Binnenbrengen in een ATU dicht bij de 3'-eind van de anti-genoom (dwz., in de positie van de leider of stroomafwaarts van het P -gen) in het algemeen resulteert in hoge transgenic expressie ten koste van beperkte virale replicatie. Meer replicatie en lagere niveaus van transgenic expressie kunnen worden verwacht bij het gebruik van de ATU stroomafwaarts van het H -gen. Verpakking van het genoom van verschillende paramyxovirussen, met inbegrip van mazelenvirus, vereist binding van zes nucleotiden door elke nucleocapside eiwit44. Voor het inbrengen van transgenen in dergelijke virussen, zorgt ervoor dat het aantal nucleotiden van het volledige genoom deelbaar door zes. Dit wordt ook wel "regel van zes"45,46genoemd. Indien nodig, ook extra nucleotiden in de insert (van de Kozak sequentie stroomopwaarts of stroomafwaarts van de stop codon) zonder frame verschuivingen of voortijdige stop codonen. [M] vermijden bepaalde sequenties in de transgenic die vergelijkbaar zijn met MV gene start (AGGRNCMARGW) en stoppen (RTTAWANAAAA) signalen en RNA bewerken sequenties (AAAAAGGG). Dergelijke consensus sequenties zijn gepubliceerd (bijvoorbeeld Zie parken et al.47).
    3. [O] kopen oligonucleotide van de gewenste volgorde of samenstellen uit beschikbare reeksen met behulp van standaard moleculaire klonen48.
      Opmerking: [O] ontwerp voor PCR versterking van de transgenic, een voorwaartse primer met inbegrip van de upstream beperkingsplaats en de eerste 15-20 nucleotiden van het donormateriaal en een omgekeerde primer met inbegrip van de laatste 15-20 nucleotiden van het donormateriaal gevolgd door de stroomafwaartse beperking website.
  2. [O] kloon invoegen in DNA dat het genoom virale (anti-)-codering.
    1. [O] kloon de invoegen in DNA vectoren of DNA anti-genoom van RNA-virussen door standaard moleculaire klonen technieken48 (dwz, enzymatische restrictie gevolgd door DNA afbinding).
      1. [O] te voorkomen dat opnieuw Afbinding van de vector met behulp van niet-compatibele beperkingsplaatsen of ambtshalve fosforylatie vóór afbinding.
      2. [O] isoleren de afbinding product door agarose gelelektroforese en latere gel zuivering met behulp van commercieel beschikbare kits. In het algemeen, wordt optimale afbinding efficiëntie bereikt bij een verhouding 3:1 molair van invoegen op vector.
    2. [O] transformeren de afbinding product in bevoegde bacteriën voor efficiënt herstel van grote plasmiden geschikt (dwz, uitvoeren van warmte schok van E. coli49) en identificeren van bacteriële klonen herbergen de juiste DNA door PCR50 van de kolonie .
    3. [O] isolaat versterkt DNA van een enkele bacteriële kloon met behulp van commercieel beschikbare DNA voorbereiding kits. Genomic integriteit bevestigen door controle digest met geschikte restrictie-enzymen (b.v., HindIII voor MV genomen [M]). Juiste inbrengen en integriteit van de transgenic bevestigen door sequentiebepaling.
      Opmerking: [M] voor transgenen ingevoegd in de MV H- ATU, Sanger uitvoeren sequencing met de volgende inleidingen: H-9018 [voorwaartse primer, bindt naar MV genoom positie 9018 in de H open frame (ORF) lezen]: 5' GTGTGCTTGCGGACTCAGAATC 3'; L-9249 + (omgekeerde primer, bindt MV genoom standpunt 9249 in de L -ORF): 5' CAGATAGCGAGTCCATAACGG 3'.

2. het redden van recombinante mazelen virusdeeltjes Immunomodulators codering

  1. [O] recombinante virusdeeltjes uit (anti-) genomic DNA via transfectie van producent viruscellen volgens het standaardprotocol voor het respectieve virus genereren. Volg de richtlijnen voor het werken onder steriele omstandigheden. Cultuur van de cel onder afzuigkappen, in het bijzonder alle stappen uitvoeren waarbij virus in klasse II biologische veiligheid kasten.
    1. [M] voor redding van mazelen virussen van cDNA23,24, plaat MV producent (Afrikaanse groene aap nier-afgeleid Vero) cellen gelijkmatig op een 6-well plaat 24u voor Transfectie. Zaad 2 x 10,5 cellen in 2 mL Dulbecco van bewerkt Eagle's Medium (DMEM) met 10% foetale runderserum (FBS) per putje te bereiken 65-75% confluentie ten tijde van de transfectie.
      Opmerking: [P] verminderen cel nummers als de cellen voorafgaand aan vorming van syncytia virus-geïnduceerde overwoekeren.
    2. [P] Transfect de cellen met DNA-codering van de virale anti-genoom, vereiste helper plasmiden, en, indien gewenst, een plasmide codering een fluorescerende verslaggever om transfectie efficiëntie te beoordelen.
      1. [M] Mix 5 µg recombinant DNA codering van de mazelen anti-virusgenoom, 500 ng elke van zoogdieren expressie plasmiden codering mazelenvirus N en L eiwitten en 100 ng elke van plasmiden codering P eiwit en een fluorescerende verslaggever in een totaal volume van 200 µL DMEM.
      2. Voeg 18,6 µL van liposomaal transfectiereagens onmiddellijk meng door flicking de buis en incubeer gedurende 25 minuten bij kamertemperatuur (RT).
      3. [P] vervangen door het medium 1.8 mL DMEM, 2% FBS, 50 µg Mo/mL kanamycine (of andere antibiotica om verontreiniging te voorkomen) per putje, dan toevoegen van de transfectie mix ontkleuring naar de waterput en zorgvuldig wervelen. Incubeer de cellen 's nachts bij 37 ° C, 5% CO2. Vervang medium met 2 mL verse DMEM, 2% FBS, en 50 µg Mo/mL kanamycine de volgende dag; Herhaal dit medium zodra een zuur.
        Let op: [O] behandelen cellen en materialen volgens de bioveiligheid verordeningen, zoals virus aanwezig van transfectie door de volgende stappen kan zijn. Verwijdering van (potentieel) besmettelijk afval op de juiste manier.
  2. [P] verzamelen en verspreiden van virusdeeltjes.
    1. [P] observeren cellen dagelijks door microscopie voor verslaggever gen expressie en syncytia vorming (Figuur 4). Oogst virus wanneer grote syncytia, bestaande uit 20 of meer cellen, zichtbaar zijn, of wanneer de cellen worden te dichte (dwz., wanneer ze beginnen te groeien in meerdere lagen, meestal na 7-9 dagen).
      Opmerking: [P] als geen syncytia worden waargenomen voor de constructie van een bepaalde vector, betekent dit niet noodzakelijkerwijs dat de redding is mislukt. Zoals besmettelijke virus toch aanwezig in het monster wellicht, transfer naar verse producent cellen voor passaging.
    2. [P] zaad ongeveer 1.5 x 106 producent cellen in 12 mL DMEM met 10% FBS, op 10 cm 24 h vóór de verwachte oogst, of 2.5 x 106 cellen per gerechten plaat 4 – 6 uur voorafgaand aan de passaging van het virus te bereiken 65-75% confluentie ten tijde van virus inoculat ion.
    3. [P] voor het verzamelen van virus nakomelingen, zorgvuldig aanhangend producent cellen van de plaat met behulp van een cel schraper Schraap en breng het supernatant met cellen in een centrifugebuis. Verwijderen van puin van de cel door centrifugeren voor 5 min bij 2.500 x g - en 4 ° C.
      Opmerking: Geschraapt cellen kunnen rechtstreeks zonder centrifugeren te maximaliseren van de overdracht van het virus ten koste van suboptimaal kweekomstandigheden en potentiële microscopie artefacten worden overgedragen.
      Let op: [O] Vermijd morsen media wanneer cellen schrapen. Minimaliseer aërosol vorming.
    4. [P] bereid entmateriaal door het mengen van het supernatans dat cel-vrij vanaf stap 2.2.3 met serumvrij middellange tot een eindvolume van 4 mL. Het medium op producent cellen vervangen door het entmateriaal en Incubeer de cellen gedurende ten minste 2 uur bij 37 ° C en 5% CO2. Voeg 6 mL DMEM met 10% FBS en incubeer cellen 's nachts voordat u wijzigt van het medium aan 12 mL verse DMEM met 10% FBS.
    5. [P] observeren de cellen ten minste tweemaal daags en oogst virus voordat syncytia burst (dwz, , wanneer de verstoring van de membraan zichtbaar wordt). Verkrijgen van de eerste passage van virus, bovendrijvende vloeistof verwijderen van de plaat, voeg 600 µL van serumvrij medium schrapen van cellen met een cel lifter en overbrengen naar een schone buis.
      Opmerking: [M] afhankelijk van virus stam51,52 en progressie van de infectie, overdracht van platen met geïnfecteerde cellen tot 32 ° C om virale replicatie en verspreiding te vergemakkelijken. In het algemeen, propageren MV Schwarz stammen goed bij 37 ° C, terwijl de overdracht van cellen geïnfecteerd met Edmonston B stam virussen tot 32 ° C resulteert in langzamer vorming van syncytia maar hogere titers.
      Opmerking: [P] niet toegestaan de cellaag te drogen tijdens de oogst, aangezien dit in lagere infectiviteit van virale deeltjes resulteren zal. Hoewel sommige virus verloren gaat wanneer het supernatant van geïnfecteerde cellen teruggooi, kunnen hogere titers worden verkregen bij de cellaag.
    6. [P] onmiddellijk bevriezen de virussuspensie in vloeibare stikstof. Winkel bij-80 ° C gedurende ten minste 24 uur om grondige bevriezen. Uitbreiden tot meerdere dagen te onderbreken van de procedure, indien nodig.
    7. Vrijlating van virale deeltjes door ontdooien bij 37 ° C. Meng door vortexing en centrifuge voor 5 min bij 2.500 x g - en 4 ° C. Het supernatant overbrengen in gelabelde cryotubes en winkel bij-80 ° C.
      Opmerking: [O] slaan virussen in aliquoot maten geschikt voor latere experimenten, zoals ze zijn bij voorkeur slechts eenmaal ontdooid en onmiddellijk gebruikt. [P] verder bevriezen-ontdooien cycli of opslag bij 4 ° C over meerdere dagen resultaat in aanzienlijke vermindering van de virale titers.
    8. [P] een dag voorafgaand aan verdere passaging om normbedrag en titer, 4 x 106 producent cellen in 12 mL DMEM met 10% zaad FBS op 15 cm schotels. Enten met virus op een veelheid van infectie (MOI) van 0,03. In 8 mL serumvrij voedingsbodem per plaat infecteren en middellange omzetten in DMEM met 10% FBS na incubatie van cellen voor ten minste 2 h. schaal omhoog met behulp van meerdere platen.
    9. Oogst zoals beschreven in stap 2.2.5, toen syncytia hebben verspreid over het hele cellaag. Zwembad de verkregen schorsingen in 50 mL tubes en proces zoals beschreven in stappen 2.2.6–2.2.7.
      Opmerking: [O] het is van cruciaal belang om te controleren van alle platen visueel voor bacteriële en schimmelinfecties besmetting vóór het oogsten. In het algemeen, Controleer alle cellijnen regelmatig voor besmetting met mycoplasma of onvoorziene virussen door multiplex PCR.
  3. [P] evalueren virale titers. Bepalen titers virusvoorraden in octuplicates per monster met behulp van 96-wells-platen. Titratie van drie afzonderlijke aliquots per virus redding uitvoeren en gebruiken de gemiddelde waarde te berekenen van de hoeveelheid virussuspensie moet worden gebruikt in experimenten.
    1. [P] de pool de producent cellen, tellen, en aan te passen aan 1.5 x 105 cellen per mL in DMEM met 10% FBS.
    2. [P] Pipetteer 90 µL van DMEM met 10% FBS in ieder putje van een 96-wells-plaat.
    3. [P] 10 µL van een aliquoot gedeelte van de voorraad virus toevoegen aan alle 8 putjes in de eerste kolom van de plaat en meng door pipetteren op en neer ten minste 10 keer.
    4. [P] uitvoeren seriële 10-fold verdunningen van het virus. Breng 10 µL van elk putje van de eerste naar de tweede kolom met behulp van een meerkanaals Pipetteer. Meng door omhoog en omlaag pipetteren verse Pipetteer geboden tips te gebruiken voor elke verdunning stap. Gooi 10 µL van elk putje van de laatste kolom.
      Opmerking: Elke 96-wells-plaat voorziet in 12 stappen van seriële verdunning. [M] voor MV vectoren, 8 stappen van 10-fold verdunningen zijn meestal voldoende, als titers boven 1 x 109 cel besmettelijke eenheden (ICB) /mL zelden die zijn verkregen door de methode van vermeerdering beschreven in stap 2.2. [P]-controleputjes zonder virus kunnen worden gebruikt voor vergelijking en te controleren van de besmetting.
    5. [P] Voeg 100 µL celsuspensie aan elk putje en Incubeer bij 37 ° C, 5% CO2 voor 48 h. Zorg ervoor het ontbreken van cel klontjes in de suspensie tot homogene verdeling van de cellen.
    6. [P] check voor syncytia met behulp van een lichte Microscoop. Rekenen syncytia in elk putje van de kolom met de hoogste verdunningsfactor met zichtbare syncytia.
    7. Het gemiddelde aantal syncytia per putje in die kolom berekenen [P] door het verdelen van het totale aantal syncytia door acht. Vermenigvuldigen dat gemiddelde met de verdunningsfactor van de respectieve kolom, vanaf 102 ICB per mL voor de eerste kolom53 (Zie Figuur 5 als voorbeeld).

3. de vaststelling van replicatieve en cytotoxische capaciteit van virale vectoren Immunomodulators codering

  1. [O] vergelijken replicatie kinetiek van de gegenereerde recombinante virussen en de ongewijzigde vector met de groeikrommes uit één of meerdere stappen (GCs). Voor one-step GCs, worden virale nageslacht beoordeeld na gelijktijdige infectie van alle cellen (theoretisch, 100% infectie). Scriptingregel GCs beginnen bij een laag percentage van geïnfecteerde cellen te volgen verschillende rondes van de replicatie van het virus.
    1. [M] voor de analyse van mazelen virus replicatie kinetiek, seed 1 x 105 Vero-cellen in 1 mL DMEM met 10% FBS per putje op 12-Wells-platen één dag voorafgaand aan de infectie. Plaat ten minste twee putten voor elke timepoint van belang als technische wordt gerepliceerd.
    2. [O] infecteren de cellen met het virus bij lage MOI voor meerdere stappen of bij hoge MOI voor one-step GCs [M] (0.03 en 3 voor MV replicatie op Vero de cellen, respectievelijk). Medium vervangen door 300 µL van de serum-vrij opslagmedium met de respectieve hoeveelheid virus en Incubeer bij 37 ° C en 5% CO2 voor ten minste 2 h. verwijderen entmateriaal, voeg 1 mL DMEM met 10% FBS, en blijven incubatie.
    3. [P] oogst op relevante timepoints zoals 12, 24, 36, 48, 72 en 96 uur na infectie, virale nageslacht door direct het schrapen van cellen in het medium. Inhoud van elk putje overbrengen naar een afzonderlijke buis, module-freeze in vloeibare stikstof en opslaan bij-80 ° C tot titratie.
      Opmerking: [P] monsters mogen worden samengevoegd bij deze stap voor de analyse van de gemiddelde titers.
    4. [P] het verzamelen van monsters van alle timepoints. Ontdooi gelijktijdig bij 37 ° C voor beoordeling van virale nageslacht. Vortex en pellet cel puin door centrifugeren voor 5 min op 2.500 x g - en 4 ° C.
    5. [P] berekenen gemiddelde titers van elk construct en timepoint zoals hierboven beschreven. Tekenen titers na verloop van tijd. Vergelijken van de groeicurven van vectoren met en zonder ingevoegde transgenen, met verschillende transgenen, of transgenen ingevoegd op verschillende posities (Zie Figuur 6A).
  2. [O] vergelijken lytische activiteiten van immunomodulator-codering en ongewijzigde virussen.
    1. [O] Selecteer mogelijk methodologieën, met inbegrip van de impedantie metingen, lactaat dehydrogenase (LDH) vrijgeven assay of levensvatbaarheid van de colorimetrische cellen metabolisme gebaseerde testen [b.v., 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium (MTT ) en 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) testen].
      1. [M] voor het analyseren van de cytotoxiciteit van mazelen assay virus vectoren met behulp van XTT, zaad Vero-cellen zoals beschreven in stap 3.1.1. Duplo's van een niet-besmette besturingselement voor elke timepoint omvatten.
        Opmerking: [O] uitvoeren XTT assay op verschillende tijdstippen op hetzelfde monster kan het beperken van technische fouten, maar herhaaldelijk wassen en blootstelling aan XTT reagens is van invloed op het aantal levensvatbare cellen. Impedantie biedt een alternatieve uitlezing voor continumetingen.
    2. [M] infecteren Vero-cellen bij een MOI van 1 zoals beschreven in stap 3.1.2.
      Opmerking: [M] voor infectie van minder tolerant doelcellen zoals sommige cellijnen lymfkliertest tumor, kan een hogere MOI van 3 of 5 nodig zijn.
    3. [O] op timepoints van belang (b.v.., 12, 24, 36, 48, 72 en 96 uur na infectie) bereiden het normbedrag van XTT-reagens (dwz., 300 µL per goed vermeerderd met 10% teveel). Vermijd blootstelling aan licht.
    4. [M] op elke timepoint, medium, verwijderen van respectieve putten. Vervangen door 300 µL van XTT reagens en Incubeer bij 37 ° C in het donker. Verzamelen van supernatant toen donkerrood, die meestal 15 minuten tot 2 h duurt, van het reagens in de controleputjes en bevriezen bij-20 ° C.
      Opmerking: [O] incubatie tijden, is afhankelijk van virus construct, celtype, dichtheid en cytopathogeen effect.
    5. [O] na het verzamelen van alle monsters, ontdooi gelijktijdig. Breng 100 µL van elk monster aan een 96-wells-plaat en meet optische extinctie bij 450 nm, met 630 nm als een referentie-golflengte.
    6. [O] plot timepoints (x-as) versus. optische extinctie van monsters ten opzichte van de controles, met vermelding van de metabole activiteit als een surrogaat voor de levensvatbaarheid van de cellen (y-as). Relatieve absorptie na verloop van tijd afneemt impliceert virale cytotoxiciteit (Zie Figuur 6B).

4. het analyseren van activiteit van Virus-gecodeerde Immunomodulators uitgescheiden door geïnfecteerde cellen

  1. [O] isoleren secreted transgenic producten uitgedrukt door virus-geïnfecteerde doelcellen.
    1. [P] laat virus producent cellen tot 70% confluentie in T175 kolven groeien.
    2. [P] medium uit cellen verwijderen en was tweemaal met 12 mL PBS serum te verwijderen. Cellen met virus op een MOI serumvrij medium 0.03 in 12 ml beënten en incuberen bij 37 ° C en 5% CO2 's nachts. Medium vervangen door 12 mL verse serumvrij voedingsbodem.
      1. [M] Edmonston B-virussen, draag voor cellen van 37 tot 32 ° C na 40 h voor een andere 24 uur incubatie te vergemakkelijken van de infectie en verhinderen vroegtijdige uiteenspatten van syncytia. Afhankelijk van de virusstam kunnen51,52 en syncytia progressie, incubatie temperaturen en tijden worden aangepast voor optimale eiwit opbrengst en zuiverheid.
    3. [P] zorgvuldig verzamelen supernatant zonder ontkoppelen cellen voordat syncytia burst. Optimaal, hebben syncytia verspreid over het hele cellaag. Zwembad supernatant in 50 mL tubes.
      Opmerking: [P] voor efficiënte reiniging van de transgenic product, Vermijd uiteenspatten van syncytia en minimaliseren van cel puin wanneer oogsten het supernatant van geïnfecteerde cellen.
    4. [P] verwijderen cel puin van het supernatant door centrifugeren voor 5 min op 2.500 x g en 4 ° C en passeren via 0,22 µm filters. Afhankelijk van het totale volume van het filtraat, kan dit worden uitgevoerd met behulp van een spuit of een vacuümpomp.
    5. [O] isoleren transgenic product met behulp van een passende zuivering-methode. Zuiveren eiwitten met een tag hexa-histidine (zijn) door uitwisseling chromatografie van de affiniteit met Ni-NTA mini spin kolommen38 zoals beschreven hier in het kort (stappen 4.1.5.1–4.1.5.4).
      Opmerking: [O] voert u alle stappen uit snel en op ijs. Vooraf chill buffers en vooraf cool centrifuge tot 4 ° C.
      1. [O] 100 mL elke buffer met PBS, 200 mM natriumchloride en imidazol op eindconcentraties van 10 mM (wassen buffer 1, WB1), 20 mM (wassen buffer 2, WB2), en 500 mM (elutie buffer, EB) voorbereiden. Breng de pH van WB1 en WB2 voor 8.0 en EB op 7.0. Afhankelijk van de proteïne worden gezuiverd, wellicht imidazool concentraties worden aangepast.
      2. [O] equilibreer kolommen met 600 µL van WB1 en centrifuge op 800 x g gedurende 2 minuten met een open deksel.
      3. [O] laden 600 µL van gefilterde supernatant op kolommen. Binding van Zijne-gelabelde proteïnen naar de kolom matrix door middel van centrifugeren op 200 x g toestaan voor 5 min met gesloten deksel. Laden en bindend kunnen worden herhaald tot een totaal van 300 µg zijn-gelabeld eiwit per kolom.
      4. [O] was driemaal uit met WB1 en een keer met WB2, of totdat de doorstroom is kleurloos. Voeg 600 µL van buffer en spin bij 800 x g gedurende 2 min met open deksel.
      5. [O] Elueer eiwit in een verse buis door het uitvoeren van twee elutie stappen met 300 µL van EB en centrifugeren gedurende 2 minuten op 800 x g.
      6. [O] desalt en product met centrifugaal filters volgens grootte product te concentreren. PBS toevoegen aan een volume van 15 mL en filter via centrifugeren gedurende 10 minuten bij 4000 x g. Herhaal tot de gewenste zuiverheid en concentratie wordt bereikt. Om te vergroten eiwitconcentratie, reduceren het eindvolume tot ongeveer 200 µL door centrifugeren gedurende 40 minuten bij 4000 x g.
  2. [O] bevestigen de zuiverheid en de identiteit van het product.
    1. [O] het bedrag van de totale proteïne in de isolaten met behulp van standaard colorimetrische assays zoals bicinchoninic zuur (BCA) of Bradford assay54,55te kwantificeren. [M] typische waarden kunnen variëren van 1 – 3 µg transgenic product per mL supernatant van geïnfecteerde cellen.
    2. [O] voor relatieve kwantificering van eiwit, scheiden via elektroforese natrium dodecyl sulfaat polyacrylamidegel (SDS-pagina) en Coomassie kleuring56uit te voeren.
    3. [O] bevestigen van de identiteit van de gezuiverde producten door immunoblotting met specifieke antilichamen gericht op het eiwit of een bijbehorende peptide label57.
    4. [O] analyseren eiwit bindende specificiteit met behulp van geschikte technieken die kunnen bevatten enzym-verbonden immunosorbent analyse (ELISA) of stroom cytometry (Zie Figuur 7). Cel bindend kan worden bevestigd met behulp van een recent beschreven magnetische pulldown assay38.
      Opmerking: [O] passende besturingselementen gebruiken. In cel bindende analyses, bevatten negatieve controles met cellen niet uiten het gerichte molecuul (zoals in Figuur 9) en niet-targeting eiwit surrogaten (Figuur 8). Stroom cytometry experimenten, bevatten positieve, negatieve en isotype besturingselementen (Figuur 7).
      1. [O] mede Incubeer de doel cellen en eiwit isoleren om bindende toe te staan. [B] voor de analyse van BTEs binden aan perifere bloed mononucleaire cellen (PBMCs) geïsoleerd uit menselijk bloed58, incubeer 2.5 x 106 cellen met 200 ng van BTE in 100 µL van PBS met 1% FBS (bindende buffer, BB) gedurende 1 uur op het ijs.
      2. [B] Wash cellen met 1 mL BB voor het verwijderen van niet-afhankelijke eiwitten. Centrifugeer bij 300 x g gedurende 5 min, verwijder supernatant en resuspendeer de pellet in 100 µL van BB. Voeg biotinyleerd antilichaam gericht op de proteïne van belang of een bijbehorende peptide-tag en incubeer op ijs gedurende 30 minuten. Voor BTEs met influenza hemagglutinine (HA)-tag, gebruik 100 ng van anti-HA-Biotine (kloon 3F10).
      3. [B] wassen cellen tweemaal met 1 mL voor BB en resuspendeer in 80 µL van BB. Voeg 20 µL van daar-coupled magnetische microbeads en incubeer gedurende 15 min bij 4 ° C.
      4. [B] Wash eens te verwijderen overtollige kralen en resuspendeer de pellet in 500 µL van BB aangevuld met 2 mM EDTA (kolom buffer, CB).
      5. [B] het isoleren van cellen met kolommen en een magnetische staan volgens de handleiding van de provider.
        1. [B] equilibreer doordat 500 µL van CB de kolom door zwaartekracht stroom doorlaat.
          Opmerking: [B] de kolom moet nooit droog worden uitgevoerd. Pipetteer zorgvuldig en ontgas de buffers Voorkom bubbels.
        2. [B] een schone buis onder de kolom plaatsen en de cel/kraal opschorting van toepassing op de kolom. Was de kolom drie keer met 500 µL van CB per wasbeurt. Doorstroom monsters van de opschorting en van ten minste de eerste wassen stap in de buis te verzamelen, wordt opgeslagen op het ijs.
        3. [B] Elueer kraal-gebonden cellen behouden door het magnetisch veld. Te dien einde, verwijder de kolom uit de magnetische stand, plaats deze over een schone buis, voeg 1 mL CB en snel de buffer door de kolom in de buis met behulp van een zuiger te duwen. Houd de buis op ijs.
      6. [B] centrifuge buizen met doorstroming en elutie monsters voor 20 min op 16.000 x g en 4 ° C tot pellet cellen. Negeren van supernatant en lyse cellen in een radioimmunoprecipitation assay (RIPA) buffer (voorgestelde: 75 µL). Uitvoeren van SDS-pagina56.
      7. [B] uitvoeren immunoblotting met behulp van een geschikte primaire antilichaam. Antistoffen kunnen gericht zijn op het product transgenic of een cellulaire eiwit (bv., β-actine, Figuur 8) te beoordelen van BTE-cel bindend.
  3. [O] beoordelen immunologische functionaliteit van geïsoleerde immunomodulators.
    1. [O] identificeren relevante tests volgens de kenmerken van de gecodeerde immunomodulator. Met betrekking tot de verwachte immunomodulerende activiteit, kan methoden beoordelen van celproliferatie, migratie, rijping, activering of cytotoxiciteit worden toegepast.
      Opmerking: [O] celproliferatie kan door CFSE59 labeling of Ki67 kleuring60worden geanalyseerd. Transwell of kras experimenten zijn beschikbaar voor het analyseren van cel migratie61. Rijping en activering van de cellen kunnen worden beoordeeld met behulp van passende kleuring protocollen voor respectieve markeringen. [B] beschikbare technieken te evalueren van de cellulaire cytotoxiciteit BTE-gemedieerde omvatten impedantie metingen en chroom release assay. Als kiezen voor chroom release assay, observeren goede veiligheidsmaatregelen bij het verwerken van radioactief materiaal.
    2. [B] als een niet-radioactieve alternatief beschrijft de volgende in detail hoe evalueren BTE-geïnduceerde, cel-gemedieerde cytotoxiciteit door LDH release assay (eerder beschreven in korte38).
      1. [B] voorwaarden vast te beproeven tijdens het experiment (Zie Figuur 9 als een voorbeeld). Timepoints (uren tot dagen), concentraties van de immunomodulator (pg/mL tot µg/mL) en effector aan target cel (E:T) ratio's (tussen 1:50 en 50: 1, bijvoorbeeld) kan worden gevarieerd. Altijd bereid monsters in triplicates.
      2. [B] bevatten monsters zonder eiwitten en zonder effector cellen, besturingselementen voor spontane LDH release van de eencellige soorten (Tsp en Esp), een cel maximaal lysis doelbesturingselement (Tmax) met wasmiddel toegevoegd vóór uitlezing, een medium alleen controle, en een volumecontrole voor Tmax.
        Opmerking: [B] vereiste aantallen doelcellen en incubatie tijden kan variëren. Beginsnelheid van de proef wordt uitgevoerd zonder effector cellen en immunomodulators te identificeren van de optimale parameters uit te voeren. Tsp en Tmax monsters en bijbehorende besturingselementen om te beoordelen van verschillende cel nummers en timepoints bevatten.
      3. [B] isoleren immuun effector cellen bijvoorbeeld door (dichtheid kleurovergang centrifugeren van menselijk bloed te verkrijgen PBMCs58 ) of negatieve selectie van lymfkliertest T-cellen van de muis splenocytes62.
      4. [B] zaad target cellen volgens stap 4.3.2 (b.v., 5 x 10³ per putje) in een U-onder 96-wells-plaat.
      5. [B] het geïsoleerde eiwit op de gewenste concentraties aan de respectieve samples toevoegen. Immuun effector cellen toevoegen op de gewenste ratio's. Medium toevoegen aan een totaal volume van 100 µL per putje.
      6. [B] Incubate voor de termijn bepaald stap 4.3.2, meestal tussen de 4 en 48 uur (24 h voor ongestimuleerde PBMCs en 48u voor vers geïsoleerde lymfkliertest T cellen; kortere incubatietijd tijden kunnen toepassen voor prestimulated immune cellen), bij 37 ° C en 5% CO2.
      7. [B] 45 minuten vóór het verzamelen van de monsters, breng 10 µL van 10 x lysis van de oplossing in putjes met Tmax monsters en de bijbehorende middellange besturingselementen. Incubatie blijven.
      8. [B] spin down cellen bij 250 x g gedurende 4 min. Transfer 50 µL van elke bovendrijvende substantie op een bodemplaat die flat-96-Wells. Cellen Voorkom cel-gebonden LDH niet overdragen.
      9. [B] bereid substraat oplossing volgens de fabrikant. Voeg 50 µL aan elk putje en Incubeer bij RT in het donker gedurende 30 min of totdat Tmax monsters donkerrood zet.
      10. [B] aan elk putje 50 µL van eindeoplossing toevoegen. Het verwijderen van luchtbellen door centrifugeren voor 1 min bij 4000 x g, en handmatig met een holle naald. Meten van de optische absorptie bij 490 nm.
      11. [B] % lysis van de specifieke waarden voor elk monster berekenen.
        1. [B] berekening van gemiddelden voor replicatieonderzoeken middellange besturingselementen met en zonder lysis van de oplossing. Aftrekken verkregen waarden van experimentele monsters en van Tmax en spontane release besturingselementen, respectievelijk. Deze achtergrond-gecorrigeerde waarden gebruiken voor verdere berekeningen.
        2. [B] berekening van gemiddelden voor achtergrond-gecorrigeerde TmaxTspensp E-controles. Met deze gemiddelde waarden, levert de volgende vergelijking het percentage van de lysis van de specifiek voor elk monster:

          Equation 1
        3. [B] uitzetten % lysis van de specifieke waarden vs. eiwitconcentratie of E:T verhouding en vergelijk met de controlemonsters niet-targeting.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Figuur 1 illustreert het werkingsmechanisme van oncolytische mazelen virussen bispecifieke T cel engagers codering. Een stroomdiagram beeltenis van de workflow van dit protocol wordt weergegeven in Figuur 2. Figuur 3 toont een voorbeeld van een gewijzigde oncolytische mazelen virusgenoom. Dit biedt een visuele weergave van de specifieke wijzigingen toegepast op de mazelen virus anti-genoom en bijzondere kenmerken van de ingevoegde transgenen. Typische mazelen virus-geïnduceerde syncytia zijn afgebeeld in Figuur 4. Opmerking de hoge celdichtheid bij het timepoint van het oogsten van de redding (A, B), die aangeeft dat het nummer van de cel kan worden verminderd wanneer het experiment te herhalen. Incubatie temperaturen en -tijden kunnen worden geoptimaliseerd voor passaging op Vero-cellen (C, D) tot verbeterde verspreiding van syncytia over de plaat. Figuur 5 geeft de uitkomst van een typische titratie assay. In Figuur 6, one-step groeikrommes a en relatieve levensvatbaarheid van cellen (B) na inoculatie met ongewijzigde (MV) en BTE-encoding worden oncolytische mazelen virussen (MV-H-mCD3xhCD20) weergegeven. Terwijl de groeicurven van de ten opzichte van vectoren op Vero-cellen lijken, achterblijft lytische activiteit van het virus transgenic-encoding in de cellijn lymfkliertest tumor. Stroom cytometry gegevens van antigeen-uiten doelcellen geïncubeerd met BTEs in vijf verschillende verdunningen wordt gegeven in Figuur 7, met vermelding van BTE bindende door cellen in een concentratie-afhankelijke manier. Figuur 8 geeft een voorbeeldige immunoblot na magnetische pulldown BTE-geassocieerde cellen. Keuzelijst met niet-targeting BTEs (n-1, n-2) opbrengst niet detecteerbare hoeveelheden cellen, overwegende dat de bands in de Fractie van de elutie, indicatieve van afhankelijke cellen, werden waargenomen voor targeting BTE monsters (t1, t2). BTE-gemedieerde, doel antigeen-specifieke en concentratie-afhankelijke cytotoxiciteit van lymfkliertest T-cellen wordt aangegeven door een representatieve LDH release assay in Figuur 9.

Figure 1
Figuur 1 : Werkingsmechanisme van oncolytische mazelen virussen codering een bispecifieke T-cel-engager (MV-BTE). Infectie van de cel van een tumor (besmet: grijs, niet-geïnfecteerde: licht blauw) met MV-BTE is gevolgd door virale replicatie en verspreiding in de tumor, resulterend in de tumor cel lysis en immuun stimulatie. Gelijktijdig, BTEs [bestaande uit twee enkele ketens afgeleid van antilichamen gericht op CD3 op T-cellen (geel) en een tumor surface antigeen (blauw)] geproduceerd en lokaal uitgescheiden door virus-geïnfecteerde cellen. BTE-gemedieerde dwarsbinding met tumorcellen induceert activering van rusten, polyklonale T-cellen, wat resulteert in verdere tumor cellen doden. Klik hier voor een grotere versie van dit cijfer.

Figure 2
Figuur 2 : Stroomdiagram met een beschrijving van de werkstroom ontwerpen, genereren, en evalueren van nieuwe virale vectoren codering immunomodulerende transgenen. Stappen 1 tot en met 4 weerspiegelen de respectieve afdelingen van het protocol. Bullet punten geven relevante overwegingen en substeps. Het empirische karakter van de procedure, kunnen aanpassingen of verbeteringen worden aangepast bij elke stap van de werkstroom. Experimentele bevindingen kunnen bovendien leiden tot nieuwe hypothesen en inspireren van de ontwikkeling van aanvullende vectoren of combinatie behandelingen. Klik hier voor een grotere versie van dit cijfer.

Figure 3
Figuur 3 : Schematische weergave van een mazelen virusgenoom. Verbeterde groen fluorescent proteïne (eGFP) is gecodeerd in een extra transcriptie eenheid stroomafwaarts van de leider (ld)-reeks. N, P, M, F, H en L aanwijzen genen coderend voor de mazelen virus structurele proteïnen nucleoproteïne, P eiwit matrix eiwitten, fusieproteïne, hemagglutinine-eiwit en grote eiwit (polymerase), respectievelijk, die zijn differentieel uitgedruct in gevisualiseerd boven. Een bispecifieke T-cel engager (BTE) transgenic wordt ingevoegd in een extra transcriptie unit (ATU) stroomafwaarts van het H open leesraam. De transgenic codeert een Igκ leider peptide voor efficiënte afscheiding evenals influenza hemagglutinine (HA) en hexa-histidine (zijn) eiwit tags voor detectie en zuivering. Genen die coderen voor variabele zwaar (VH) en lichtketting (VL) domeinen van antilichamen gericht op CD3 en CD20, respectievelijk, zijn verbonden via peptide linker sequenties met glycine (G) en residuen van serine (S). De volgorde van transgenic wordt voorafgegaan door een Kozak sequentie. Stroomafwaarts van de codage regio, extra nucleotiden zijn opgenomen exemplarisch te voldoen aan de regel van zes. De cassette invoegen wordt geflankeerd door twee beperkingsplaatsen inbrengen in de respectieve ATU inschakelen. Klik hier voor een grotere versie van dit cijfer.

Figure 4
Figuur 4 : Mazelen virus-geïnduceerde syncytia. (A, B) Vero-cellen werden met cDNA voor redding van recombinante mazelen virussen codering verbeterde groen fluorescent proteïne (eGFP) en een bispecifieke T-cel-engager (BTE) gericht op lymfkliertest CD3 en menselijke CD20 transfected. Aanwezigheid van een fluorescerende syncytium (witte pijlen) geeft aan succesvolle redding van besmettelijke virus. (C, D) Mazelen virussen werden geoogst na redding en doorgegeven op Vero-cellen (doorgang 1). Grote syncytia hebben gevormd en zijn al beginnen te barsten (gele pijlen). Beelden werden verworven door fase contrast (B, D) en fluorescentie microscopie na excitatie voor 80 ms (A) en 100 ms (C). Klik hier voor een grotere versie van dit cijfer.

Figure 5
Figuur 5 : Representatief resultaat van een titratie assay. Titratie van een partij van de derde-passage van MV-H-mCD3xhCD20, een BTE-encoding oncolytische mazelenvirus, op Vero-cellen. Een 10-fold seriële verdunning is uitgevoerd op een 96-wells-plaat, beginnend met 10 µL van virussuspensie in elk putje van kolom 1. geen syncytia zichtbaar waren in kolom 7, zoals aangegeven door nullen. Voor de volgende laagste verdunning van virussuspensie in kolom 6, werd een gemiddelde van zes syncytia per putje waargenomen, wat resulteert in een definitieve titer van ongeveer 6 x 107 cel besmettelijke eenheden (ICB) per mL virussuspensie. Klik hier voor een grotere versie van dit cijfer.

Figure 6
Figuur 6 : Replicatie kinetiek en lytische activiteit van mazelen recombinante virussen. (A) One-step groeikrommes werden gegenereerd na infectie van Vero-cellen met ongewijzigde oncolytische mazelenvirus (MV) of mazelenvirus codering een bispecifieke T-cel-engager (MV-H-mCD3xhCD20) bij een MOI van 1. Titers van virale nageslacht waren aangewezen timepoints geëvalueerd na infectie, die soortgelijke virus replicatie kinetiek aangeeft. Gemiddelde en standaardafwijking van acht monsters (vier technische repliceert elk van twee biologische replicatieonderzoeken per timepoint) worden weergegeven. (B)-cel levensvatbaarheid werd beoordeeld op MC38 lymfkliertest colorectaal carcinoom cells stabiel uiting van menselijke carcino antigeen en de MV receptor CD46 (MC38-CEA-CD46) na inoculatie met middellange enige (mock) of aangegeven virussen bij een MOI van 1. XTT cel levensvatbaarheid assay werd uitgevoerd in de aangegeven tijdstippen. Afname van de levensvatbaarheid van de cellen werd waargenomen bij eerdere timepoints voor de ongewijzigde vector. Waarden van meer dan 100%, berekend voor MV-H-mCD3xhCD20 op de 12 h timepoint, worden vaak waargenomen kort na infectie, die veroorzaakt door cellulaire stress worden kan of cel-afgeleide factoren in de virussuspensie. Gemiddelden en standaardafwijkingen van de drie technische replicatieonderzoeken worden weergegeven voor elke timepoint. Klik hier voor een grotere versie van dit cijfer.

Figure 7
Figuur 7 : Target cel bindende door bispecifieke T cel engagers (BTEs) uitgedrukt van mazelen virus-geïnfecteerde cellen. Menselijke mantel cel lymfoom cellen endogeen uiten CD20 (Granta-519) werden geïncubeerd met menselijk immunoglobuline te blokkeren Fc receptoren, gevolgd door incubatie met 2, 4, 6, 8 of 10 µL (A) van gezuiverde mCD3xhCD20 BTE oplossing, respectievelijk. BTE-gebonden cellen werden waargenomen met behulp van phycoerythrin (PE)-geconjugeerd antilichaam gericht op de BTE-geassocieerde HA-tag. Percentages van gekleurde cellen gecorreleerd met BTE concentraties. (B) controles voor selectiviteit en de specificiteit van bindende. Niet getoond hier zijn besturingselementen van een onafhankelijke experiment, met inbegrip van één monster van cellen geïncubeerd met BTE maar met de BTE-targeting antilichaam alleen (besturingselement voor aspecifieke binding van antilichaam aan cellen) of met een BTE die erom bekend te binden aan de cellen van belang , gevolgd door incubatie met het antilichaam van BTE-targeting (positieve controle) of een antilichaam isotype. Indien beschikbaar, kunnen isogene cellen niet uiten het doel-antigeen van keuze worden gebruikt om bindende selectiviteit. Klik hier voor een grotere versie van dit cijfer.

Figure 8
Figuur 8 : Magnetische pulldown van menselijke perifere bloed mononucleaire cellen (PBMCs) gebonden aan mazelen virus-gecodeerde BTEs. Cellen werden geïncubeerd met twee verschillende batches instellen van menselijke T-cel-targeting (t1, t2) of niet-gericht op controle BTEs (n1, n2), respectievelijk. BTE-gebonden cellen werden bewaard op kolommen met behulp van magnetische kralen, Ingehuld en lysed. Β-actine in lysates werd ontdekt door immunoblotting. Intensiteiten van banden in de elutie monsters geven relatieve BTE-cel bindend. Doorstroom specimens bevestigen aanwezigheid van cellen in alle monsters. Klik hier voor een grotere versie van dit cijfer.

Figure 9
Figuur 9 : Cytotoxische activiteit van mazelen virus-gecodeerd BTEs. Tumor doelcellen (5 x 10³ B16-CD20-CD46 cellen per putje) werden geïncubeerd met lymfkliertest T-cellen bij een verhouding van 1:50. BTEs eerder gezuiverd van het supernatant van MV-H-mCD3xhCD20-geïnfecteerde cellen werden toegevoegd bij aangegeven concentraties. Relatieve lysis van doelcellen werd beoordeeld door LDH release assay na 48 h. cellen ontbreekt de BTE antigeen (B16-CD46 target) diende als referentie te evalueren van antigeen-specifieke cytotoxiciteit. Middelen plus standaardafwijkingen van drie technische replicatieonderzoeken per monster worden weergegeven. Doelcellen antigeen-uiten waren specifiek lysed in een BTE concentratie-afhankelijke manier. Zuiverheid van de BTE product- en het doeldomein antigeen expressie niveaus invloed cel doden. Bijvoorbeeld in de huidige werd 15% specifieke cel doden bereikt met een relatief hoge concentratie BTE 1 µg/ml. Dit is een normale waarde voor dergelijke een experimentele opstelling met lange co incubatie tijden en kweekomstandigheden suboptimaal T cel. In andere instellingen, werd omhoog tot 60% specifieke doden bereikt met behulp van BTEs gezuiverd van MV-geïnfecteerde supernatant, een plateau bij BTE concentraties van 100 ng/mL en hogere38te bereiken. Dit geeft aan dat counter-intuitively, de limiet van deze test minder dan 100 is % specifieke doden, die kan worden verklaard door verschillende groei kinetiek in Tmax besturingselementen in vergelijking met co cultuur monsters. Klik hier voor een grotere versie van dit cijfer.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Oncolytische immunotherapie (dwz., Overurentar in combinatie met immunomodulatie) houdt grote belofte voor de behandeling van kanker, veeleisende verdere ontwikkeling en optimalisatie van oncolytische virussen codering immunomodulerende eiwitten. Dit protocol wordt beschreven methoden om te genereren en valideren van dergelijke vectoren voor het daaropvolgende testen in relevante preklinische modellen en potentiële toekomstige klinische traduction roman anti-kanker therapieën.

Talrijke verschillende oncolytische virus perrons met duidelijke voordelen zijn beschikbaar63. Naast de specificiteit van de kanker, vector veiligheid voorschriften voor fabricage, werkzaamheid bij lysis van de cel van de tumor, en inductie van immuunresponsen is klonen capaciteit sleutel tot succesvolle vectorization van immunomodulators met behulp van een specifieke oncolytische. Helaas, directe vergelijkingen van verschillende OVs ontbreken momenteel en moeten worden voortgezet om het identificeren van de optimale behandelingsopties voor individuele patiënten. Dit kan worden vergemakkelijkt door de rationele ontwikkeling te bevorderen en beproeving van nieuwe transgenic-encoding vectoren, zoals hier wordt geïllustreerd voor MV-BTE. Gezien de gunstige eigenschappen van MV (dwz, oncotropism, veiligheid, fusogenicity, immunogeniciteit, haalbaarheid van genetische modificatie) dit protocol is gericht op deze oncolytische vector, die kan worden gegeneraliseerd voor andere OV, met name paramyxovirussen .

Voor een rationele keuze van mogelijk relevante immunomodulators zoals kandidaat-transgenen (stap 1.1.1) is een grondige kennis van de cyclus voor kanker-immuniteit essentieel, systematisch literatuuronderzoek onmisbaar maken. Daarnaast grootschalige schermen, wel kostbaar, waardevol voor het identificeren van nieuwe doelstellingen kunnen bewijzen (bijvoorbeeld Zie Patel et al.41).

Voor ontwerp van recombinante OVs, moeten gewenste expressieprofielen worden beschouwd. In het geval van RNA-virussen, wordt genexpressie beheerd op het niveau van het RNA door de respectieve polymerase. Bij het ontwerpen van transgenic cassettes voor plaatsing in MV genoom (stap 1.1.2), is het vermijden van sequenties die lijken op MV polymerase gene start/stop signalen en RNA bewerken van websites en de regel van zes cruciaal voor succesvolle vector ontwikkeling. Bovendien overeen paramyxovirus gen expressie niveaus positionering binnen het genoom, die voortvloeien uit een expressie kleurovergang43. In het algemeen, verhoogt positionering van de transgenic in een upstream positie expressie ten koste van verminderde replicatie. Echter, deze parameters ook afhangen van de grootte, structuur en volgorde van de respectieve transgenic. Bijgevolg is een beperking van de methodologie beschreven in dit protocol de noodzaak van empirisch testen van nieuwe vector ontwerpen. In specifieke gevallen, aanpassingen in de transgenic reeks of positionering mogelijk nodig is om de gewenste vector kenmerken (Figuur 2). Systematische vergelijking van verschillende posities voor checkpoint antilichaam toonde optimale resultaten worden ingevoegd voor de H- ATU (niet-gepubliceerde gegevens). Zoals BTE inzetstukken hebben vergelijkbare eigenschappen (grootte en immunoglobuline domeinen), MV-BTE vectoren analoog werden gekloond38.

Redding van infectieuze deeltjes van virus cDNA (stap 2.1) kan vereisen verschillende pogingen voor sommige constructies. Aanpassen van cel nummers kunt optimaliseren celdichtheid voor vorming van syncytia. Terwijl een bepaalde dichtheid noodzakelijk voor de efficiënte verspreiding van cel naar cel en versmelting van de celmembranen is, vermindert contact remming virale replicatie. Verder, het aantal infectieuze deeltjes mogelijk niet voldoende voor het opwekken van zichtbare celfusie. Echter mogelijk virussen aanwezig in afwezigheid van syncytia, redding monsters kunnen niettemin worden geoogst en overgedragen aan de verse producent cellen voor potentiële vermeerdering. Inefficiënte transfectie als gevolg van slechte kwaliteit van DNA of ongeschikte of aangetaste transfectie reagentia vertegenwoordigen typische problemen die zijn relatief gemakkelijk te beoordelen en op te lossen door het genereren van nieuwe preparaten van DNA en het testen van verschillende reagentia, respectievelijk.

Succesvolle virus verspreiding (stap 2.2) is cruciaal afhankelijk van de voorwaarden voor virale replicatie en lysis van de cel. Met behulp van lage passage aantallen cellen van de producent wordt aanbevolen, en geïnfecteerde cellen moeten regelmatig worden gecontroleerd voor syncytia progressie. Aanpassen van cel nummers, temperaturen en incubatie tijden mogelijk evenwicht virale verspreiding vs. celproliferatie.

Een belangrijke beperking van de beschreven methode van de virus productie is de voorbereiding van virus schorsingen van ruwe cel lysates. Onderzoekers moeten zich bewust zijn van het feit dat de virussuspensie cellulaire factoren bevat. Virusdeeltjes kunnen geconcentreerd via dichtheid verloop/sacharose kussen ultracentrifugatie ten koste van het totaalaantal besmettelijke deeltjes en ook mogelijk toenemende concentraties van cellulaire resten. Virus kan ook worden geconcentreerd van geïnfecteerde cel supernatant, steeds meer zuiverheid, maar vermindering van de totale opbrengst. GMP en grootschalige productie van paramyxovirussen wordt meestal uitgevoerd met behulp van meerdere lagen van producent cellen zaadjes op een gloeidraad netto in bioreactoren voor verhoogde titer opbrengst63. Nauwkeurige controle, continue media exchange, serumvrij voorwaarden en latere filtratie stappen zorgen voor hoge zuiverheid van geproduceerde virus.

Evaluatie van virale titers (stap 2.3 en 3.1) via de beschreven syncytia tellen methode is niet nauwkeurig, maar het is gemakkelijk uit te voeren en voldoende nauwkeurig bij het gebruik van adequate nummers van technische repliceert. Bij de beoordeling van OV-gemedieerde cytotoxiciteit (stap 3.2), beperkingen van beschikbare tests moeten worden overwogen. Metabole testen maken geen onderscheid tussen cytostatica en cytolytische effecten van experimentele behandelingen. Voor het meten van cytolysis, kan een LDH release assay worden uitgevoerd. Beide soorten testen kunnen echter worden beïnvloed door inhoud van virus preparaten van ruwe cel lysates (Figuur 6).

Isolatie van proteïnen uitgedrukt door virus-geïnfecteerde cellen (stap 4.1) kan sterk variëren in opbrengst en zuiverheid, afhankelijk van de respectieve transgenic en gebruikte virus alsmede op technische nauwkeurigheid. Kwaliteitscontrole van eiwitreiniging is dus cruciaal voor de beoordeling van verwante experimentele resultaten.

Als een uitputtende beschrijving van potentiële functionele tests die betrekking hebben op de grote verscheidenheid aan mogelijke immunomodulators buiten het bestek van deze publicatie valt, richt het zich over dit protocol op ex vivo methodologie voor het meten van cellulaire cytotoxiciteit (stap 4.3). Cellulaire cytotoxiciteit, met name door CD8 + T cellen is een belangrijke bemiddelaar voor immunologische tumor control in succesvolle immuuntherapie64. Dit heeft belangrijke implicaties voor de huidige aanpak van de immunotherapie anti-tumor immuunresponsen in het algemeen uitbreiden met antilichamen en bispecifieke T cel engagers in het bijzonder. Lokale BTE expressie door oncolytische vectoren heeft veelbelovende resultaten in verschillende Preklinische studies, met inbegrip van RNA38 en DNA virussen65,66,,67,68opgeleverd.

Als gevolg van de complexe interacties van tumor, virus, transgenic product en immuunsysteem van de gastheer in levende organismen, validatie van immunomodulator-encoding oncolytische vectoren in celkweek zoals blijkt hier volstaat niet om te voorspellen van therapeutische resultaten. Nog belangrijker is, de voorgestelde geïsoleerde beoordeling van functies, vector en immunomodulator, respectievelijk, is essentieel voor bewijs van concept maar er niet in slaagt om potentiële synergie-effecten en complexe interacties binnen de communicatie van de tumor te beschrijven. Testen voor zowel de toxiciteit en de werkzaamheid in relevante in vivo modellen is cruciaal voor verdere ontwikkeling van nieuwe recombinante vector construeert maar niet gemakkelijk worden verricht. Immunologische veiligheid wordt regelmatig toezicht gehouden in niet-menselijke primaten zoals Makaken, Muismodellen worden gebruikt voor ook en werkzaamheid analyseert20,69. Echter, veel van deze modellen hebben beperkingen ten aanzien van de expressie van virus receptoren in gastheer weefsel en host permissiviteit, en sommige alleen onvoldoende nabootsen het complexe samenspel van OV, tumor en de immuun communicatie. Zorgvuldige afweging van passende modellen is dus verplicht.

MV-BTE behandeling is eerder geëvalueerd in menselijke xenograft en syngeneic Muismodellen. Geen BTE transgenic producten waren aantoonbaar zijn in serum van muizen behandeld met BTE-encoding MV38, met vermelding van succesvolle risicopreventie van systemische blootstelling zelfs zonder verdere demping van het natuurlijk oncotropic stam vaccinvirus. Lokale expressie is cruciaal voor OV-gecodeerde immunomodulators die giftig zijn indien systemisch toegediend. Indien nodig, kan tumor specificiteit worden verbeterd door het opnieuw richten aan de oppervlakte markers van keuze70,71,72 en microRNA gebaseerde-richtend voor verbeterde oncotropism73,74 (cel herzien door Ruiz en Russell75). Extra wijzigingen kunnen worden aangebracht om te vectoren voor specifieke therapeutische doeleinden worden gebruikt (herzien door Miest en Cattaneo76), met inbegrip van de invoeging van transgenen voor diagnostische doeleinden77,78 of voorstadium optimaliseren conversie naar het minimaliseren van de bijwerkingen van chemotherapie79,80, invoering van veiligheid schakelt81, en gericht op de stroma tumor of therapieën (bijvoorbeeld via bispecifieke antilichamen82).

Afgezien van genetische modificatie van de virale vector, combinatie regimes met chimeer antigeen receptor (auto) T cel overdracht83,85,86van de84,van de chemotherapie of radiotherapie87, 88 , 89 verder vergroten het repertoire van Overurentar. Als MV immuniteit zeer gangbaar is, strategieën te omzeilen antilichaam neutralisatie zijn ontwikkeld, met inbegrip van uitwisseling van envelop-glycoproteïnes voor degenen onder Verwante paramyxovirussen90, polymeercoating van deeltjes, gebruikend cel dragers te leveren van virussen en voorbijgaande immunosuppressiva (herzien door Russell et al.6). Verdere ontwikkeling van geavanceerde OV immunotherapie regimes vereist testen van de veiligheid en de therapeutische werkzaamheid in passende diermodellen, met materiaal van de patiënt, en ten slotte, in gecontroleerde klinische proeven.

Gezien de overvloed van mogelijke combinaties, is uitgebreide testen niet haalbaar. Wiskundige modellering kan helpen bij de prioritering van potentiële combinatie regimes, alsmede hun respectieve doseren en plannen door het voorspellen van de resultaten van de behandeling in silico (herzien door Santiago et al.91). Bij het testen van efficacies van de roman, is rationeel ontworpen vectoren, geluid begeleidend translationeel onderzoek instrumentale voor een dieper begrip van de onderliggende virologische en immunologische processen. Dit is cruciaal voor de generatie van passende modellen, informatie over verdere potentiële doelen en vooruitgang op het gebied in het algemeen. Kortom, zal uit de eerste hand inzicht in relevante methoden van vector design, generatie, en karakterisering in deze lijn van het werk versnellen van de ontwikkeling en ondersteuning van exploratie van nieuwe therapeutics voor toekomstige klinische vertaling.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

C.E. Engeland wordt vermeld als mede-uitvinder van een octrooi met betrekking tot RNA virussen voor kanker Immunovirotherapy eigendom van de Universiteit van Heidelberg. J.P.W. Heidbuechel heeft niets te onthullen.

Acknowledgments

Deze methoden werden opgericht in de een groep geleid door Prof. Dr. Dr. Guy Ungerechts aan het National Center for Tumor ziekten in Heidelberg. We zijn dank verschuldigd aan hem en alle leden van het team van het laboratorium, met name Dr. Tobias Speck, Dr. Rūta Veinalde, Judith Förster, Birgit Hoyler, en Jessica Albert. Dit werk werd gesteund door de anders Kröner-Fresenius-Stiftung (Grant 2015_A78 aan C.E. Engeland) en de Duitse National Science Foundation (DFG, nl 1119/2-1 toekennen C.E. Engeland). J.P.W. Heidbuechel ontvangt een toelage van de Helmholtz International Graduate School for Cancer Research.

Materials

Name Company Catalog Number Comments
Rapid DNA Dephos & Ligation Kit Roche Life Science, Mannheim, Germany 4898117001
CloneJET PCR Cloning Kit Thermo Fisher Scientific, St. Leon-Rot K1231
Agarose Sigma-Aldrich, Taufkirchen, Germany A9539-500G
QIAquick Gel Extraction Kit QIAGEN, Hilden, Germany 28704
NEB 10-beta Competent E. coli New England Biolabs (NEB), Frankfurt/Main, Germany C3019I
LB medium after Lennox Carl Roth, Karlsruhe, Germany X964.1
Ampicillin Carl Roth, Karlsruhe, Germany HP62.1
QIAquick Miniprep Kit QIAGEN, Hilden, Germany 27104
Restriction enzyme HindIII-HF New England Biolabs (NEB), Frankfurt/Main, Germany R3104S
Dulbecco's Modified Eagle's Medium (DMEM) Invitrogen, Darmstadt, Germany 31966-021
Fetal bovine serum (FBS) Biosera, Boussens, France FB-1280/500
FugeneHD Promega, Mannheim, Germany E2311 may be replaced by transfection reagent of choice
Kanamycin Sigma-Aldrich, Taufkirchen, Germany K0129
Vero cells ATCC, Manassas, VA, USA CCL81
B16-CD46/ B16-CD20-CD46 J. Heidbuechel, DKFZ Heidelberg available upon request
Granta-519 DSMZ, Braunschweig, Germany ACC 342
Opti-MEM (serum-free medium) Gibco Life Technologies, Darmstadt, Germany 31985070
Colorimetric Cell Viability Kit III (XTT) PromoKine, Heidelberg, Germany PK-CA20-300-1000 includes XTT reagent
Dulbecco's Phosphate-Buffered Saline (PBS) Gibco Life Technologies, Darmstadt, Germany 14190-094
QIAquick Ni-NTA Spin Columns QIAGEN, Hilden, Germany 31014
Sodium chloride Carl Roth, Karlsruhe, Germany 3957.3
Imidazole Carl Roth, Karlsruhe, Germany I5513-25G
Amicon Ultra-15, PLGC Ultracel-PL Membran, 10 kDa Merck, Darmstadt, Germany UFC901024
BCA Protein Assay Kit Merck Milipore 71285-3
IgG from human serum Sigma-Aldrich, Taufkirchen, Germany I4506
Anti-HA-PE Miltenyi Biotech, Bergisch Gladbach, Germany 130-092-257 RRID: AB_871939
Mouse IgG1, kappa Isotype Control, Phycoerythrin Conjugated, Clone MOPC-21 antibody BD Biosciences, Heidelberg, Germany 555749 RRID: AB_396091
Anti-HA-biotin antibody, clone 3F10 Sigma-Aldrich, Taufkirchen, Germany 12158167001 RRID: AB_390915
Anti-Biotin MicroBeads Miltenyi Biotech, Bergisch Gladbach, Germany 130-090-485
MS Columns Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-201
MiniMACS Separator Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-102
MACS MultiStand Miltenyi Biotech, Bergisch Gladbach, Germany 130-042-303
RIPA buffer Rockland Immunochemicals, Gilbertsville, PA, USA MB-030-0050
CytoTox 96 Non-Radioactive Cytotoxicity Assay Promega, Mannheim, Germany G1780 includes 10x lysis solution, substrate solution (substrate mix and assay buffer), and stop solution
Cell lifter Corning, Reynosa, Mexico 3008
10 cm dishes Corning, Oneonta, NY, USA 430167
15 cm dishes Greiner Bio-One, Frickenhausen, Germany 639160
96-well plates, U-bottom TPP, Trasadingen, Switzerland 92097
96-well plates, flat bottom Neolab, Heidelberg, Germany 353072
6-well plates Neolab, Heidelberg, Germany 353046
12-well plates Neolab, Heidelberg, Germany 353043
50 mL tubes nerbe plus, Winsen/Luhe, Germany 02-572-3001
T175 cell culture flasks Thermo Fisher Scientific, St. Leon-Rot 159910
0.22 µm filters Merck, Darmstadt, Germany SLGPM33RS

DOWNLOAD MATERIALS LIST

References

  1. Lichty, B. D., Breitbach, C. J., Stojdl, D. F., Bell, J. C. Going viral with cancer immunotherapy. Nature Reviews Cancer. 14, (8), 559-567 (2014).
  2. Cassady, K. A., Haworth, K. B., Jackson, J., Markert, J. M., Cripe, T. P. To Infection and Beyond: The Multi-Pronged Anti-Cancer Mechanisms of Oncolytic Viruses. Viruses. 8, (2), (2016).
  3. Twumasi-Boateng, K., Pettigrew, J. L., Kwok, Y. Y. E., Bell, J. C. Oncolytic viruses as engineering platforms for combination immunotherapy. Nature Reviews Cancer. (2018).
  4. Achard, C., et al. Lighting a Fire in the Tumor Microenvironment Using Oncolytic Immunotherapy. EBioMedicine. 31, 17-24 (2018).
  5. Kelly, E., Russell, S. J. History of oncolytic viruses: genesis to genetic engineering. Molecular Therapy. The Journal of the American Society of Gene Therapy. 15, (4), 651-659 (2007).
  6. Russell, S. J., Peng, K. W., Bell, J. C. Oncolytic virotherapy. Nature Biotechnology. 30, (7), 658-670 (2012).
  7. Russell, S. J., Peng, K. W. Oncolytic Virotherapy: A Contest between Apples and Oranges. Molecular Therapy: The Journal of the American Society of Gene Therapy. 25, (5), 1107-1116 (2017).
  8. Seymour, L. W., Fisher, K. D. Oncolytic viruses: finally delivering. British Journal of Cancer. 114, (4), 357-361 (2016).
  9. Chen, D. S., Mellman, I. Oncology meets immunology: the cancer-immunity cycle. Immunity. 39, (1), 1-10 (2013).
  10. Gao, Q., Park, M. S., Palese, P. Expression of transgenes from newcastle disease virus with a segmented genome. Journal of Virology. 82, (6), 2692-2698 (2008).
  11. Billeter, M. A., Naim, H. Y., Udem, S. A. Reverse genetics of measles virus and resulting multivalent recombinant vaccines: applications of recombinant measles viruses. Current Topics in Microbiology and Immunology. 329, 129-162 (2009).
  12. Matveeva, O. V., Guo, Z. S., Shabalina, S. A., Chumakov, P. M. Oncolysis by paramyxoviruses: multiple mechanisms contribute to therapeutic efficiency. Molecular Therapy Oncolytics. 2, (2015).
  13. Suter, S. E., et al. In vitro canine distemper virus infection of canine lymphoid cells: a prelude to oncolytic therapy for lymphoma. Clinical Cancer Research. 11, (4), 1579-1587 (2005).
  14. Ammayappan, A., Russell, S. J., Federspiel, M. J. Recombinant mumps virus as a cancer therapeutic agent. Molecular Therapy Oncolytics. 3, 16019 (2016).
  15. Schirrmacher, V. Oncolytic Newcastle disease virus as a prospective anti-cancer therapy. A biologic agent with potential to break therapy resistance. Expert Opinion on Biological Therapy. 15, (12), 1757-1771 (2015).
  16. Saga, K., Kaneda, Y. Oncolytic Sendai virus-based virotherapy for cancer: recent advances. Oncolytic Virotherapy. 4, 141-147 (2015).
  17. Matveeva, O. V., Kochneva, G. V., Netesov, S. V., Onikienko, S. B., Chumakov, P. M. Mechanisms of Oncolysis by Paramyxovirus Sendai. Acta Naturae. 7, (2), 6-16 (2015).
  18. Gainey, M. D., Manuse, M. J., Parks, G. D. A hyperfusogenic F protein enhances the oncolytic potency of a paramyxovirus simian virus 5 P/V mutant without compromising sensitivity to type I interferon. Journal of Virology. 82, (19), 9369-9380 (2008).
  19. Engeland, C. E., et al. A Tupaia paramyxovirus vector system for targeting and transgene expression. The Journal of General Virology. 98, (9), 2248-2257 (2017).
  20. Russell, S. J., Peng, K. W. Measles virus for cancer therapy. Current Topics in Microbiology and Immunology. 330, 213-241 (2009).
  21. Aref, S., Bailey, K., Fielding, A. Measles to the Rescue: A Review of Oncolytic Measles Virus. Viruses. 8, (10), (2016).
  22. Demicheli, V., Rivetti, A., Debalini, M. G., Di Pietrantonj, C. Vaccines for measles, mumps and rubella in children. The Cochrane Database of Systematic Reviews. (2), 004407 (2012).
  23. Radecke, F., et al. Rescue of measles viruses from cloned DNA. The EMBO Journal. 14, (23), 5773-5784 (1995).
  24. Martin, A., Staeheli, P., Schneider, U. RNA polymerase II-controlled expression of antigenomic RNA enhances the rescue efficacies of two different members of the Mononegavirales independently of the site of viral genome replication. Journal of Virology. 80, (12), 5708-5715 (2006).
  25. Russell, S. J., et al. Remission of disseminated cancer after systemic oncolytic virotherapy. Mayo Clinic Proceedings. 89, (7), 926-933 (2014).
  26. Hardcastle, J., et al. Immunovirotherapy with measles virus strains in combination with anti-PD-1 antibody blockade enhances antitumor activity in glioblastoma treatment. Neuro-Oncology. 19, (4), 493-502 (2017).
  27. Dispenzieri, A., et al. Phase I trial of systemic administration of Edmonston strain of measles virus genetically engineered to express the sodium iodide symporter in patients with recurrent or refractory multiple myeloma. Leukemia. 31, (12), 2791-2798 (2017).
  28. Galanis, E., et al. Phase I trial of intraperitoneal administration of an oncolytic measles virus strain engineered to express carcinoembryonic antigen for recurrent ovarian cancer. Cancer Research. 70, (3), 875-882 (2010).
  29. Galanis, E., et al. Oncolytic measles virus expressing the sodium iodide symporter to treat drug-resistant ovarian cancer. Cancer Research. 75, (1), 22-30 (2015).
  30. Kurokawa, C., et al. Constitutive Interferon Pathway Activation in Tumors as an Efficacy Determinant Following Oncolytic Virotherapy. Journal of the National Cancer Institute. (2018).
  31. Msaouel, P., et al. Clinical Trials with Oncolytic Measles Virus: Current Status and Future Prospects. Current Cancer Drug Targets. 18, (2), 177-187 (2018).
  32. Grote, D., Cattaneo, R., Fielding, A. K. Neutrophils contribute to the measles virus-induced antitumor effect: enhancement by granulocyte macrophage colony-stimulating factor expression. Cancer Research. 63, (19), 6463-6468 (2003).
  33. Grossardt, C., et al. Granulocyte-macrophage colony-stimulating factor-armed oncolytic measles virus is an effective therapeutic cancer vaccine. Human Gene Therapy. 24, (7), 644-654 (2013).
  34. Iankov, I. D., et al. Expression of immunomodulatory neutrophil-activating protein of Helicobacter pylori enhances the antitumor activity of oncolytic measles virus. Molecular Therapy: The Journal of the American Society of Gene Therapy. 20, (6), 1139-1147 (2012).
  35. Engeland, C. E., et al. CTLA-4 and PD-L1 Checkpoint Blockade Enhances Oncolytic Measles Virus Therapy. Molecular Therapy: The Journal of the American Society of Gene Therapy. 22, (11), 1949-1959 (2014).
  36. Veinalde, R., et al. Oncolytic measles virus encoding interleukin-12 mediates potent antitumor effects through T cell activation. Oncoimmunology. 6, (4), 1285992 (2017).
  37. Hutzler, S., et al. Antigen-specific oncolytic MV-based tumor vaccines through presentation of selected tumor-associated antigens on infected cells or virus-like particles. Scientific Reports. 7, (1), 16892 (2017).
  38. Speck, T., et al. Targeted BiTE expression by an oncolytic vector augments therapeutic efficacy against solid tumors. Clinical Cancer Research. (2018).
  39. Andtbacka, R. H., et al. Talimogene Laherparepvec Improves Durable Response Rate in Patients With Advanced Melanoma. Journal of Clinical Oncology: Official Journal of the American Society of Clinical Oncology. 33, (25), 2780-2788 (2015).
  40. Ribas, A., et al. Oncolytic Virotherapy Promotes Intratumoral T Cell Infiltration and Improves Anti-PD-1 Immunotherapy. Cell. 170, (6), 1109-1119 (2017).
  41. Patel, S. J., et al. Identification of essential genes for cancer immunotherapy. Nature. 548, (7669), 537-542 (2017).
  42. Kimple, M. E., Brill, A. L., Pasker, R. L. Overview of affinity tags for protein purification. Current Protocols in Protein Science. 73, Unit 9.9 (2013).
  43. Cattaneo, R., Rebmann, G., Baczko, K., ter Meulen, V., Billeter, M. A. Altered ratios of measles virus transcripts in diseased human brains. Virology. 160, (2), 523-526 (1987).
  44. Gutsche, I., et al. Structural virology. Near-atomic cryo-EM structure of the helical measles virus nucleocapsid. Science. 348, (6235), New York, N.Y. 704-707 (2015).
  45. Kolakofsky, D., et al. Paramyxovirus RNA synthesis and the requirement for hexamer genome length: the rule of six revisited. Journal of Virology. 72, (2), 891-899 (1998).
  46. Kolakofsky, D., Roux, L., Garcin, D., Ruigrok, R. W. Paramyxovirus mRNA editing, the "rule of six" and error catastrophe: a hypothesis. The Journal of General Virology. 86, Pt 7 1869-1877 (2005).
  47. Parks, C. L., et al. Analysis of the noncoding regions of measles virus strains in the Edmonston vaccine lineage. Journal of Virology. 75, (2), 921-933 (2001).
  48. JoVE Science Education Database. Molecular Cloning. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  49. JoVE Science Education Database. Bacterial Transformation: The Heat Shock Method. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  50. Bergkessel, M., Guthrie, C. Colony PCR. Methods in Enzymology. 529, 299-309 (2013).
  51. Rota, J. S., Wang, Z. D., Rota, P. A., Bellini, W. J. Comparison of sequences of the H, F, and N coding genes of measles virus vaccine strains. Virus Research. 31, (3), 317-330 (1994).
  52. Bankamp, B., Takeda, M., Zhang, Y., Xu, W., Rota, P. A. Genetic characterization of measles vaccine strains. The Journal of Infectious Diseases. 204, Suppl 1 533-548 (2011).
  53. Dulbecco, R., Vogt, M. Plaque formation and isolation of pure lines with poliomyelitis viruses. The Journal of Experimental Medicine. 99, (2), 167-182 (1954).
  54. Smith, P. K., et al. Measurement of protein using bicinchoninic acid. Analytical Biochemistry. 150, (1), 76-85 (1985).
  55. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical Biochemistry. 72, 248-254 (1976).
  56. JoVE Science Education Database. Separating Protein with SDS-PAGE. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  57. JoVE Science Education Database. The Western Blot. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  58. Menck, K., et al. Isolation of human monocytes by double gradient centrifugation and their differentiation to macrophages in teflon-coated cell culture bags. Journal of Visualized Experiments. (91), e51554 (2014).
  59. Quah, B. J., Parish, C. R. The use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to monitor lymphocyte proliferation. Journal of Visualized Experiments. (44), (2010).
  60. Gerdes, J. Ki-67 and other proliferation markers useful for immunohistological diagnostic and prognostic evaluations in human malignancies. Seminars in Cancer Biology. 1, (3), 199-206 (1990).
  61. JoVE Science Education Database. The Transwell Migration Assay. JoVE Science Education Database. JoVE. Cambridge, MA. JoVE Science Education Database: Basic Methods in Cellular and Molecular Biology (2018).
  62. Lim, J. F., Berger, H., Su, I. H. Isolation and Activation of Murine Lymphocytes. Journal of Visualized Experiments. (116), e54596 (2016).
  63. Ungerechts, G., et al. Moving oncolytic viruses into the clinic: clinical-grade production, purification, and characterization of diverse oncolytic viruses. Molecular Therapy Methods & Clinical Development. 3, 16018 (2016).
  64. Fridman, W. H., Zitvogel, L., Sautes-Fridman, C., Kroemer, G. The immune contexture in cancer prognosis and treatment. Nature Reviews Clinical Oncology. 14, (12), 717-734 (2017).
  65. Yu, F., et al. T-cell engager-armed oncolytic vaccinia virus significantly enhances antitumor therapy. Molecular Therapy: The Journal of the American Society of Gene Therapy. 22, (1), 102-111 (2014).
  66. Fajardo, C. A., et al. Oncolytic Adenoviral Delivery of an EGFR-Targeting T-cell Engager Improves Antitumor Efficacy. Cancer Research. 77, (8), 2052-2063 (2017).
  67. Freedman, J. D., et al. Oncolytic adenovirus expressing bispecific antibody targets T-cell cytotoxicity in cancer biopsies. EMBO Molecular Medicine. 9, (8), 1067-1087 (2017).
  68. Wing, A., et al. Improving CART-Cell Therapy of Solid Tumors with Oncolytic Virus-Driven Production of a Bispecific T-cell Engager. Cancer Immunology Research. 6, (5), 605-616 (2018).
  69. Myers, R. M., et al. Preclinical pharmacology and toxicology of intravenous MV-NIS, an oncolytic measles virus administered with or without cyclophosphamide. Clinical Pharmacology and Therapeutics. 82, (6), 700-710 (2007).
  70. Rittner, K., Schreiber, V., Erbs, P., Lusky, M. Targeting of adenovirus vectors carrying a tumor cell-specific peptide: in vitro and in vivo studies. Cancer Gene Therapy. 14, (5), 509-518 (2007).
  71. Nakamura, T., et al. Rescue and propagation of fully retargeted oncolytic measles viruses. Nature Biotechnology. 23, (2), 209-214 (2005).
  72. Campadelli-Fiume, G., et al. Retargeting Strategies for Oncolytic Herpes Simplex Viruses. Viruses. 8, (3), 63 (2016).
  73. Leber, M. F., et al. MicroRNA-sensitive oncolytic measles viruses for cancer-specific vector tropism. Molecular Therapy: The Journal of the American Society of Gene Therapy. 19, (6), 1097-1106 (2011).
  74. Baertsch, M. A., et al. MicroRNA-mediated multi-tissue detargeting of oncolytic measles virus. Cancer Gene Therapy. 21, (9), 373-380 (2014).
  75. Ruiz, A. J., Russell, S. J. MicroRNAs and oncolytic viruses. Current Opinion in Virology. 13, 40-48 (2015).
  76. Miest, T. S., Cattaneo, R. New viruses for cancer therapy: meeting clinical needs. Nature Reviews Microbiology. 12, (1), 23-34 (2014).
  77. Phuong, L. K., et al. Use of a vaccine strain of measles virus genetically engineered to produce carcinoembryonic antigen as a novel therapeutic agent against glioblastoma multiforme. Cancer Research. 63, (10), 2462-2469 (2003).
  78. Dingli, D., et al. Image-guided radiovirotherapy for multiple myeloma using a recombinant measles virus expressing the thyroidal sodium iodide symporter. Blood. 103, (5), 1641-1646 (2004).
  79. Abate-Daga, D., et al. Oncolytic adenoviruses armed with thymidine kinase can be traced by PET imaging and show potent antitumoural effects by ganciclovir dosing. PLoS One. 6, (10), 26142 (2011).
  80. Ungerechts, G., et al. Lymphoma chemovirotherapy: CD20-targeted and convertase-armed measles virus can synergize with fludarabine. Cancer Research. 67, (22), 10939-10947 (2007).
  81. Ketzer, P., et al. Artificial riboswitches for gene expression and replication control of DNA and RNA viruses. Proceedings of the National Academy of Sciences of the United States of America. 111, (5), 554-562 (2014).
  82. Freedman, J., et al. Targeting T-cells to human cancer associated fibroblasts using an oncolytic virus expressing a FAP-specific T-cell engager. Keystone Symposia & Digitell, Inc. (2018).
  83. Nishio, N., et al. Armed oncolytic virus enhances immune functions of chimeric antigen receptor-modified T cells in solid tumors. Cancer Research. 74, (18), 5195-5205 (2014).
  84. Bressy, C., Benihoud, K. Association of oncolytic adenoviruses with chemotherapies: an overview and future directions. Biochemical Pharmacology. 90, (2), 97-106 (2014).
  85. Wennier, S. T., Liu, J., McFadden, G. Bugs and drugs: oncolytic virotherapy in combination with chemotherapy. Current Pharmaceutical Biotechnology. 13, (9), 1817-1833 (2012).
  86. Fillat, C., Maliandi, M. V., Mato-Berciano, A., Alemany, R. Combining oncolytic virotherapy and cytotoxic therapies to fight cancer. Current Pharmaceutical Design. 20, (42), 6513-6521 (2014).
  87. Li, H., Peng, K. W., Russell, S. J. Oncolytic measles virus encoding thyroidal sodium iodide symporter for squamous cell cancer of the head and neck radiovirotherapy. Human Gene Therapy. 23, (3), 295-301 (2012).
  88. Opyrchal, M., et al. Effective radiovirotherapy for malignant gliomas by using oncolytic measles virus strains encoding the sodium iodide symporter (MV-NIS). Human Gene Therapy. 23, (4), 419-427 (2012).
  89. Mansfield, D., et al. Oncolytic Vaccinia virus and radiotherapy in head and neck cancer. Oral Oncology. 49, (2), 108-118 (2013).
  90. Miest, T. S., et al. Envelope-chimeric entry-targeted measles virus escapes neutralization and achieves oncolysis. Molecular Therapy: The Journal of the American Society of Gene Therapy. 19, (10), 1813-1820 (2011).
  91. Santiago, D. N., et al. Fighting Cancer with Mathematics and Viruses. Viruses. 9, (9), (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics