Generasjon 3D huden Organoid fra ledningen blod-avledet indusert Pluripotent stamceller

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Vi foreslår en protokoll som viser hvordan å skille indusert pluripotent Stamcelle-avledet keratinocytter og fibroblaster og generere en 3D huden organoid, bruke disse keratinocytter og fibroblaster. Denne protokollen inneholder et ekstra trinn for å generere en humanized mus modell. Teknikken presenteres her vil forbedre dermatologic forskning.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Kim, Y., Ju, J. H. Generation of 3D Skin Organoid from Cord Blood-derived Induced Pluripotent Stem Cells. J. Vis. Exp. (146), e59297, doi:10.3791/59297 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Huden er kroppens største organ og har mange funksjoner. Huden fungerer som en fysisk barriere og beskytter av kroppen og regulerer kroppsfunksjoner. Biomimetics er imitasjon av modeller, systemer og elementene for å løse komplekse menneskelige problemer1. Huden biomimetics er et nyttig verktøy for i vitro sykdom forskning og i vivo regenerativ medisin. Menneskelige indusert pluripotent stamceller (iPSCs) har karakteristisk for ubegrenset spredning og differensiering evnen til å tre bakterie lag. Menneskelige iPSCs genereres fra ulike primære celler, for eksempel blodceller, keratinocytter, fibroblaster og mer. Blant dem, ledningen blod mononukleære celler (CBMCs) har dukket opp som en alternativ celle fra perspektivet til allogene regenerativ medisin. CBMCs er nyttige i regenerativ medisin fordi menneskelige leukocytter antigen (HLA) skriver er avgjørende for cellen banksystemet. Vi tilbyr en metode for differensiering av CBMC-iPSCs keratinocytter og fibroblaster og generering av en 3D hud organoid. CBMC-iPSC-avledet keratinocytter og fibroblaster har egenskaper som ligner på en primær cellen linje. 3D huden organoids genereres ved overliggende dypeste laget på et dermal lag. Ved transplanting denne 3D huden organoid, genereres en humanized mus modell. Denne studien viser at en 3D iPSC-avledet huden organoid kan være en roman, alternative verktøy for dermatologic forskning i vitro og in vivo.

Introduction

Huden dekker ytterste overflaten av kroppen og beskytter indre organer. Huden har forskjellige funksjoner, inkludert beskyttelse mot patogener, absorberende og lagring vann, regulerer kroppstemperaturen, og skiller ut kroppen avfall2. Huden grafts kan klassifiseres avhenger på huden kilde; graftene med skall fra en annen donor kalles allografts grafts ved hjelp av pasientens egen hud er autografts. Selv om en autograft er foretrukket behandling på grunn av sin lave avvisning risiko, er hud biopsies vanskelig å utføre på pasienter med alvorlig lesjonene eller et lite antall hudceller. Hos pasienter med alvorlige forbrenninger er tre ganger antall hudceller nødvendig for å dekke store områder. Den begrensede tilgjengeligheten av hudceller fra pasientens kropp resulterer i situasjoner der allogenous transplantasjon er nødvendig. En allograft brukes midlertidig til autolog transplantasjon kan utføres siden den er vanligvis avvist av verten immunsystem etter ca 1 uke3. Å seire over avslag av pasientens immunsystem, må graftene komme fra en kilde med samme immun identitet som pasient4.

Menneskelig iPSCs er en nye celler for stilk cellen terapi5. Menneskelige iPSCs genereres fra somatiske celler, med reprogramming faktorer som OCT4, SOX2, Klf4 og c-Myc6. Bruker human iPSCs seirer etiske og immunologiske saker av embryonale stamceller (ESCs)7,8. Menneskelige iPSCs har pluripotency og kan skille ut tre bakterie lag9. Tilstedeværelsen av HLA, en kritisk faktor i regenerativ medisin, bestemmer immunforsvaret og muligheten for avvisning10. Bruk av pasient-avledede iPSCs løser problemene med cellen kildekode begrensning og immunsystemet avvisning. CBMCs har også dukket opp som en alternativ cellen for regenerativ medisin11. Obligatorisk HLA skriver, som oppstår under CBMC bank, kan enkelt brukes for forskning og transplantasjon. Videre, homozygous HLA-type iPSCs kan vidt gjelder ulike pasienter12. En CBMC-iPSC bank er en roman og effektiv strategi for cellen terapi og allogenic regenerativ medisin12,13,14. I denne studien vi bruker CBMC-iPSCs, i keratinocytter og fibroblaster, og generere lagdelt 3D huden lag. Resultater fra denne studien tyder på at en CBMC-iPSC-avledet 3D huden organoid er en roman verktøy for i vitro og in vivo dermatologic forskning.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle prosedyrer som involverer dyr ble utført i samsvar med laboratoriet dyr velferd gjerning, guiden og bruk av forsøksdyr, og retningslinjer og policyer for gnagere eksperimentering levert av det institusjonelle Animal Care og Bruk Committee (IACUC) av School of Medicine i katolske universitetet i Korea. Studien protokollen ble godkjent av institusjonelle gjennomgang styret i den katolske universitetet av Korea (CUMC-2018-0191-01). IACUC og den avdelingen av laboratoriet dyr (DOLA) i katolske universitetet i Korea, Songeui Campus akkreditert Korea Excellence dyr laboratorium innretningen av Korea Food and Drug Administration i 2017 og ervervet Association for vurdering og Akkreditering av laboratoriet Animal Care International (AAALAC), internasjonal akkreditering full i 2018.

1. huden celledifferensiering fra indusert pluripotent stamceller

  1. Middels forberedelse
    Merk: Lagre alle medium på 4 ° C i et mørkt miljø for inntil 3 måneder. Filtrere alle mediet bruker et 0.22 μm polyethersulfone filtersystem før bruk for sterilisering. Alle medium var tilgjengelig i et totalt volum på 500 mL.
    1. Forberede KDM1 (keratinocyte differensiering mellom 1). Mix Dulbecco endret Eagle's Medium (DMEM) / F12 medium (3:1) med 2% fosterets bovin serum (FBS), 0,3 mmol/L L-askorbinsyre, 5 μg/mL insulin og 24 µg/mL adenine.
    2. Forberede KDM2 (keratinocyte differensiering mellom 2). Mix definert keratinocyte serum-free middels (se Tabell for materiale) med 0,3 mmol/l L-askorbinsyre, 5 μg/mL insulin og 10 μg/mL adenine.
      Merk: Definert keratinocyte serum-free medium er optimalisert for å støtte vekst og ekspansjon av keratinocytter.
    3. Forberede KDM3 (keratinocyte differensiering mellom 3). Mix definert keratinocyte serum-free medium og keratinocyte serum-free medium (1:1) se Tabell for materiale for detaljer.
      Merk: Keratinocyte serum-free medium er optimalisert for vekst og vedlikehold av keratinocytter.
    4. Forberede FDM1 (fibroblast differensiering mellom 1). Blanding DMEM/F12 medium (3:1) med 5% FBS, 5 μg/mL insulin, 0,18 mM adenine og 10 ng/mL epidermal vekstfaktor (EGF).
    5. Forberede FDM2 (fibroblast differensiering mellom 2). Blanding DMEM/F12 medium (1:1) med 5% FBS og 1% unødvendige aminosyrer.
    6. Forberede EP1 (epithelial mellom 1). Blanding DMEM/F12 (3:1) med 4 mM L-glutamin, 40 μM adenine, 10 μg/mL transferrin, 10 μg/mL insulin og 0,1% FBS.
    7. Forberede EP2 (epithelial mellom 2). Bland EP1 og 1,8 mM veisalt.
    8. Forberede EP3 (epithelial medium 3, cornification medium). Mix F12 medium med 4 mM L-glutamin, 40 μM adenine, 10 μg/mL transferrin, 10 μg/mL insulin, 2% FBS og 1,8 mM veisalt.
  2. Embryonale hovedtekst
    1. Generere CBMC-iPSCs ved hjelp av protokollen som er vist i en tidligere studie12.
    2. Coat kultur retter, med vitronectin. Forberede 5 mL til coat en 100 mm rett.
      1. Tine og resuspend 50 μL av 0,5 mg/mL vitronectin (siste konsentrasjon: 5 µg/mL) med 5 mL steril fosfat-bufret saltoppløsning (PBS). Legge løsningen til rettene og ruge ved romtemperatur (RT) for 1 h. leveringstanken belegg før bruk (ikke tørke ut).
    3. Opprettholde CBMC-avledet-iPSCs til vitronectin-belagt 100 mm plate og endre iPSC mediet (E8) daglig på 37 ° C med 10% CO2.
    4. Generere embryonale organer (EBs) ved hjelp av protokollen som er vist i en tidligere studie15 (beskrevet kort som følger). Utvid iPSCs ved å endre medium til cellene har nådd 80% samløpet. På 80% samløpet, fjerne mediet og vask med PBS.
    5. Behandle cellene med 1 mL 1 mM ethylenediaminetetraacetic syre (EDTA). Ruge på 37 ° C med 5% CO2 i 2 minutter og høste celler med 3 mL E8 medium. Sentrifuge cellene på 250 x g i 2 minutter.
    6. Sug opp nedbryting og bruke 5 mL av E8 medium til cellene. Telle celler ved hjelp av en hemocytometer og overføre 1 x 106 celler til en ny 15 mL konisk tube. Sentrifuge cellene på 250 x g i 2 minutter.
    7. Resuspend overført cellene med 2,5 mL EB formasjon medium med 10 μM Rho-assosiert kinase (ROCK) inhibitor. Slipp 1 x 104 celler (25 µL/slipp) på en noncoated kultur plate lokket med en 10-100 μL flerkanals pipette. Skjemaet 100 EBs fra 1 x 106 celler (1 x 104 celler/1 EB). Snu fatet og henge på slippverktøyet lokket.
      Merk: ROCK hemmer kreves under vedlegg trinnet i vedlikehold og differensiering. Legg den ROCK inhibitor bare på EB aggregering scenen.
    8. Inkuber dråpene på 37 ° C med 5% CO2 for 1 dag.
    9. Neste dag, høste 100 EBs og bruke dem for differensiering. Bleke lokket på plate med iPSC medium (E8 medium) eller PBS og høste innholdet til en 50 mL konisk rør. Opprettholde EBs i RT for 1 min for å slå dem. Sug opp nedbryting, resuspend EBs med E8 medium og opprettholde dem i en 90 mm Petriskål til differensiering.
  3. Differensiering av CBMC-iPSCs i keratinocytter
    Merk: For et fargevalg keratinocyte differensiering fra CBMC-iPSCs, se figur 1A.
    1. Harvest 100 EBs slik 50 mL konisk med iPSC middels eller PBS. Opprettholde på RT for 1 min å slå seg ned EBs. Kontroller at de bosette seg på bunnen av koniske røret. Sug opp nedbryting og resuspend EBs med E8 medium med 1 ng/mL bein Morfogenetiske proteinet 4 (BMP4). Overføre EBs til en 90 mm Petriskål og opprettholde dem på 37 ° C med 5% CO2 for 1 dag.
    2. Coat kultur retter, med type IV kollagen. Forberede 5 mL av type IV kollagen å coat en 100 mm rett.
      1. Tine og resuspend type IV kollagen løsning (siste konsentrasjon: 50 µg/mL) med 0,05 N HCl. legge løsningen til rettene og ruge på RT for 1 h. Sug opp belegg før bruk (ikke tørke ut).
        Merk: Før du bruker plater, ta oppvasken 3 x med PBS fjerne alle syre.
    3. Høste EBs (trinn 1.3.1) til en 50 mL konisk tube og opprettholde dem på RT for 1 min for å slå dem. Kontroller at de bosette seg på bunnen av koniske røret, Sug opp nedbryting og resuspend EBs i 6 mL av KDM1 med 10 µM ROCK inhibitor. Overføre EBs til type IV kollagen-belagt 100 mm parabolen.
      Merk: Legg den ROCK inhibitor bare på EB vedlegg scenen.
    4. Mellom dager 0 – 8, endre mediet hver dag til KDM1 med 3 µM retinsyre (RA) og 25 ng/mL hver BMP4 og EGF. Opprettholde EBs på 37 ° C med 5% CO2.
    5. Mellom dager 9 – 12: endre mediet annenhver dag til KDM2 med 3 µM RA, 25 ng/mL BMP4 og 20 ng/mL EGF.
    6. Mellom dager 13-30, endre mediet annenhver dag til KDM3 med 10 ng/mL BMP4 og 20 ng/mL EGF.
  4. Differensiering av CBMC-iPSC i fibroblaster
    Merk: Hvis en ordning med fibroblast differensiering fra CBMC-iPSCs, se figur 2A.
    1. Coat kultur retter, bruke kjelleren membran matrise. Forberede 5 mL til coat en 100 mm rett.
      1. Tine kjelleren membran matrix (siste konsentrasjon: 600 ng/mL) og fortynne den med DMEM/F12 medium. Legge løsningen til rettene og ruge på 37 ° C for 30 min. leveringstanken belegg før bruk (ikke tørke ut).
    2. Harvest 100 EBs slik 50 mL konisk med en pipette med iPSC medium eller PBS. Opprettholde på RT for 1 min å slå seg ned EBs. Kontroller de bosette seg på bunnen av koniske røret. Fjerne nedbryting.
    3. Resuspend EBs bruker en 1000 µL pipette i 6 mL av FDM1 med 10 µM ROCK inhibitor. Overføre EBs (med middels) til en kjeller membran matrix-belagt 100 mm rett og ruge på 37 ° C med 5% CO2. Oppdatere FDM1 annenhver dag 3 dager.
      Merk: Bare legge den ROCK inhibitor på EB vedlegg scenen.
    4. Legg til 0,5 nM bein Morfogenetiske proteinet 4 (BMP 4) FDM1 mellom dager 4 og 6.
    5. På dag 7, endre mediet til FDM2 annenhver dag 1 uke.
    6. På dag 14, Legg 1 mL 1 mM EDTA og ruge på 37 ° C med 5% CO2 for 2 min. høste celler med 3 mL FDM2 og sentrifuger 250 x g 2 min. fjerne nedbryting og resuspend cellene i 5 mL av FDM1.
    7. Telle celler ved hjelp av en hemocytometer, resuspend 2 x 106 celler med FDM1 medium og overføre cellene til noncoated parabolen. Opprettholde cellene på 37 ° C med 5% CO2 og endre mediet annenhver dag.
    8. Pelsen kultur retter, bruker skriver jeg kollagen. Forberede 5 mL til coat en 100 mm rett. Fortynne skriver jeg kollagen løsning (siste konsentrasjon: 50 µg/mL) i 0.02 N eddiksyre. Legge løsningen til rettene og ruge på RT for 1 h. leveringstanken belegg før bruk (ikke tørke ut).
      Merk: Før du bruker plater, ta oppvasken 3 x med PBS fjerne syre.
    9. På dag 21, Legg 1 mL 1 mM EDTA og ruge på 37 ° C med 5% CO2 for 2 min. høste celler med 3 mL FDM1 og sentrifuger 250 x g 2 min. fjerne nedbryting og resuspend cellene i 5 mL av FDM1. Antall celler ved hjelp av en hemocytometer og overføre 2 x 106 celler til type jeg kollagen-belagt 100 mm parabolen med FDM1 medium. Opprettholde cellene på 37 ° C med 5% CO2 og endre mediet annenhver dag.
    10. På dag 28, Legg 1 mL 1 mM EDTA og ruge på 37 ° C med 5% CO2 for 2 min. høste celler med 3 mL FDM1 og sentrifuger 250 x g 2 min. fjerne nedbryting og resuspend cellene i 5 mL av FDM1. Telle celler ved hjelp av en hemocytometer og overføre 2 x 106 celler til en noncoated rett med FDM1 medium. Vedlikeholde cellen i 37 ° C med 5% CO2 og endre mediet annenhver dag.
      Merk: iPSC-avledet fibroblaster sprer som en primær fibroblast celle linje og passasje til 10 passasjer. I denne studien brukte vi iPSC-avledet fibroblaster av to til fem avsnitt for videre analyse.

2. Bruk av hiPSC-avledet differensierte celler

  1. Generasjon 3D hud organoid
    1. Forberede men type jeg kollagen på is, følge anbefalingene fra produsenten. Siste konsentrasjon, bruke 3 mg/mL for type I-kollagen (type I-lager konsentrasjon av kollagen er 3.47 mg/mL), og kontroller at det siste bindet av blandingen er 5 mL. Beregne volumet av 10 x PBS (siste volum/10 = 0,5 mL). Beregne volumet av type I-kollagen brukes (siste volum x siste kollagen konsentrasjon / lager kollagen konsentrasjon = 5 mL x 3 mg / mL / 3.47 mg / mL = 4.32 mL). Beregne volumet av 1 N NaOH (volumet av kollagen brukes x 0.023 mL = 0,1 mL). Beregne volumet av dH2O (siste volum - volum av kollagen - volumet av 10 x PBS - antall 1 N NaOH = 5 mL - 4.32 mL-0,5 mL-0,1 mL = 0,08 mL). Bland innholdet i røret og holde det på is inntil klar til bruk.
    2. Legge til 1 mL av EDTA fibroblaster iPSC-avledet fra trinn 1.4.10 og ruge på 37 ° C med 5% CO2 for 2 min. høste frittliggende cellene, telle celler ved hjelp av en hemocytometer og overføre 2 x 105 cellene til en ny 15 mL konisk tube. Sentrifuge 250 x g i 2 minutter og fjerne nedbryting. Resuspend cellene i de iPSC-avledet fibroblaster i 1,5 mL av FDM1 og nøytralisert type jeg kollagen løsning (1:1).
      Merk: Bland løsningen forsiktig for å unngå bobler.
    3. Plasser membran innsatsen på et 6-og microplate, overføre blandingen til innsatsen og ruge på RT i 30 min.
      Merk: Ikke flytte platene.
    4. Når du bekrefter gelation, legge 2 mL av medium til toppen av innsettings- og 3 mL til bunnen av brønnen. Inkuber matrisen fibroblaster og kollagen på 37 ° C med 5% CO2 for 5-7 dager, til gelation er fullført og ikke lenger kontrakter.
    5. Etter fullført gelation, koble den iPSC-avledet keratinocytter (fra trinn 1.3.6) med EDTA. Legg 1 mL av EDTA og ruge på 37 ° C med 5% CO2 for 2 min. høste frittliggende cellene, telle dem ved hjelp av en hemocytometer og overføre 1 x 106 celler til en ny 15 mL konisk tube. Sentrifuger 250 x g i 2 minutter.
    6. Fjern nedbryting og resuspend 1 x 106 celler i 50-100 µL av lav kalsium epithelial medium 1 (EP1).
    7. Sug opp alle medium i matrisen (se trinn 2.1.5) og frø 1 x 106 celler med iPSC-avledet keratinocytter på hver fibroblast lag. Inkuber platen på 37 ° C med 5% CO2 i 30 min.
      Merk: Ikke flytte platen, og ikke legger et medium til å feste keratinocyte.
    8. Legg 2 mL EP1 toppen av sette og 3 mL EP1 til bunnen av brønnen.
    9. Etter 2 dager, Sug opp alle medium i membranen sett inn platen og endre mediet til normal kalsium EP2 for 2 dager.
    10. Etter 2 dager, Sug opp alle medium og legge 3 mL cornification mediet bare til bunnen for å generere en luft-væske-grensesnittet.
    11. Vedlikeholde 3D huden organoid for opptil 14 dager på 37 ° C med 5% CO2 og endre mediet annenhver dag. Høste 3D huden organoid ved å kutte kanten av innsatsen, og bruke den for en videre undersøkelse av flekker og hud pode.
  2. Hud pode
    1. Utføre innånding anestesi på NIKK/scid mus (mannlige, 6 uker gamle), bruke en standard, institusjonelt godkjent. For hud pode, barbere pelsen til hver mus er dorsal huden.
    2. Fjerne en 1 cm x 2 cm av musen er huden, buede saks med tang.
    3. Plass CBMC-iPSC-avledet 3D huden organoid på feil sted og Sutur bruke en tie-over dressing med silke suturer.
    4. Observere musene i 2 uker og ofre dem for histologiske analyse. Fargeprotokoll ble bekreftet i tidligere studier16.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Huden består for det meste, overhuden og dermis. Keratinocytter er den viktigste celle typen overhuden fibroblaster er viktigste celle type dermis. Ordningen med keratinocyte differensiering er vist i figur 1A. CBMC-iPCSc ble opprettholdt i en vitronectin-belagt rett (figur 1B). I denne studien differensiert vi CBMC-iPSCs keratinocytter og fibroblaster med EB formasjon. Vi generert EBs bruker hengende slipp-metoden for å sikre en jevn og kontrollert differensiering av keratinocytter og fibroblaster (figur 1C). EBs var knyttet til typen IV kollagen-belagt plater for keratinocyte differensiering, og mediet ble endret daglig. CBMC-iPSCs ble behandlet med RA, BMP4 og EGF. CBMC-iPSCs ble differensiert til keratinocytter. Differensiering, morfologi av CBMC-iPSC-avledet keratinocytter endret over tid (supplerende figur 1).

CBMC-iPSC-avledet keratinocytter har morphologies ligner på primære keratinocytter (figur 1D). Genuttrykk av pluripotent merket OCT4 var downregulated i CBMC-iPSC-avledet keratinocytter. Primer sekvenser er vist i tabell 1. Økt uttrykk for keratinocyte markører Np63, KRT5 og KRT14 i CBMC-iPSC-avledet keratinocytter (figur 1F). CBMC-iPSC-avledet keratinocytter ble bekreftet av uttrykk for Np63 og KRT14 av immunhistokjemi (figur 1E). Disse resultatene bekrefter at CBMC-iPSC-avledet keratinocytter har karakteristikkene av primære keratinocytter.

Ordningen med fibroblast differensiering er vist i figur 2A. Vi også vedlikeholdt CBMC-iPSCs i vitronectin-belagt parabol og brukt EB formasjon fibroblast differensiering (figur 2B, C). Vi tilknyttet EBs kjelleren membran matrix-belagte plater og endret mediet annenhver dag. Utvekst celler ble overført til noncoated og skriv jeg kollagen belagte plater. CBMC-iPSCs ble differensiert til fibroblaster. Differensiering, morfologi av CBMC-iPSC-avledet fibroblaster endret over tid (supplerende figur 2).

CBMC-iPSC-avledet fibroblaster har morphologies ligner på primære fibroblaster (figur 2D). Uttrykk for pluripotent stamceller markør OCT4 var downregulated i CBMC-iPSC-avledet fibroblaster. Fibroblast angir COL1A1, COL1A2, COL3A1 og CD44 var upregulated i CBMC-iPSC-avledet fibroblaster (figur 2F). Primer sekvenser er vist i tabell 1. Også ble CBMC-iPSC-avledet fibroblaster bekreftet av uttrykk for vimentin og fibronectin av immunhistokjemi (figur 2E). Disse resultatene tyder på at CBMC-iPSC-avledet fibroblaster ligner på primære fibroblaster.

Vi generert en 3D huden organoid bruke CBMC-iPSC-avledet keratinocytter og fibroblaster. Ordningen med dannelsen av 3D huden organoid vises i Figur 3A. Vi generert en 3D huden organoid på en membran sett inn plate. 3D kulturen, CBMC-iPSC-avledet fibroblaster var lagdelt med type jeg kollagen og kledde med CBMC-iPSC-avledet keratinocytter. Etter seeding CBMC-iPSC-avledet keratinocytter, ble mediet endret til en vanlig kalsium konsentrasjon i 2 dager. Etter 2 dager lagt en høy kalsium konsentrasjon medium bare til nedre kammeret for dannelsen av luft-flytende grensesnitt kultur. Air-flytende grensesnitt kulturen indusert modning og lagdeling av keratinocytter. Tykkelsen på 3D huden organoid økt under 3D kultur. Disse resultatene bekrefter at 3D huden organoid ble generert fra iPSC-avledet keratinocytter og fibroblaster av hematoxylin og eosin (H & E) flekker (Figur 3C).

Bruker CBMC-iPSC-avledet 3D huden organoid, generert vi humanized mus modell (Figur 3B) av pode 3D huden organoid til mus. 1 cm x 2 cm feil ble indusert, og bruk av tie-over metoden for transplantasjon. Etter 2 uker transplantert huden ble podet effektivt til mus, og vi bekreftet dette ved H & E og immunocytochemical analyse (Figur 3D). Keratinocyte modning og epidermal differensiering markørene loricrin og KRT14 ble uttrykt i CBMC-iPSC-avledet 3D huden organoids (Figur 3E). CBMC-iPSC-avledet 3D huden organoids var funksjonelt differensiert, podet effektivt på mus og effektivt helbredet mus hud defekter.

Figure 1
Figur 1 : Keratinocyte differensiering av CBMC-iPSCs. (A) sammenhengen keratinocyte differensiering fra CBMC-iPSCs. (B og C) morfologi av CBMC-iPSCs (panel B) og iPSC-avledet EBs (panel C). (D) morfologi av CBMC-iPSC-avledet keratinocytter. (E) Immunocytochemical analyse av Np63 (rød) og KRT14 (grønn), sammen med DAPI flekker (blå). Skala barer = 100 μm. (F) genuttrykk pluripotent markør og keratinocyte markører for iPSC-avledet keratinocytter (iPSC-Ks). Grafene viser gjennomsnittet med SEM av fem uavhengige utvalg. Forskjeller mellom gruppene ble undersøkt for statistisk betydning ved hjelp av Student t-test. T-test ble brukt til å analysere parametriske kvantitative datasett, og den ensidige p-verdien var beregnet (*p < 0,05, **p < 0,01, ***p < 0,001 angitt statistiske betydning). Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2 : Fibroblast differensiering av CBMC-iPSCs. (A) ordningen med fibroblast differensiering fra CBMC-iPSCs. (B og C) morfologi av CBMC-iPSCs (panel B) og iPSC-avledet EBs (panel C). (D) morfologi av CBMC-iPSC-avledet fibroblaster. (E) Immunocytochemical analyse av vimentin (rød) og fibronectin (rød), sammen med DAPI flekker (blå). Skala barer = 100 μm. (F) genuttrykk pluripotent markør og fibroblast markører for iPSC-avledet fibroblast (iPSC-Fs). Grafene viser gjennomsnittet med SEM av fem uavhengige utvalg. Forskjeller mellom gruppene ble undersøkt for statistisk betydning ved hjelp av Student t-test. T-test ble brukt til å analysere parametriske kvantitative datasett, og den ensidige p-verdien var beregnet (*p < 0,05, **p < 0,01, ***p < 0,001 angitt statistiske betydning). Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3 : Generasjon CBMC-iPSC-avledet hud organoid og humanized mus modell. (A) skjematisk diagram av iPSC-avledet huden organoid (iSO) generasjon. (B) transplantasjon med iSO i mus. (C) histologiske analyse av iSO i vitro. (D) histologiske analyse av transplantert iSO i vivo. (E-H) Immunocytochemical analyse av loricrin og KRT14. HÅNE Kontrollpanel ( E), transplantert iSO ( F-panelet, loricrin), mus hud (negativ kontroll, G-panelet), transplantert iSO (panel H, KRT14). Skala barer = 200 μm. Klikk her for å se en større versjon av dette tallet.

Supplementary Figure 1
Supplerende figur 1: morfologi av iPSC-avledet keratinocytter. Klikk her for å se en større versjon av dette tallet.

Supplementary Figure 2
Supplerende figur 2: morfologi av iPSC-avledet fibroblaster. Klikk her for å se en større versjon av dette tallet.

Målnavnet Retning Primer sekvens (5 - 3') Størrelse (Base-par) Refseq_ID
OCT4 Fremover
Omvendt
ACCCCTGGTGCCGTGAA
GGCTGAATACCTTCCCAAATA
190 NM_203289.5
PAX6 Fremover
Omvendt
GTCCATCTTTGCTTGGGAAA
TAGCCAGGTTGCGAAGAACT
110 NM_000280.4
SOX1 Fremover
Omvendt
CACAACTCGGAGATCAGCAA
GGTACTTGTAATCCGGGTGC
133 NM_005986.2
Np63 Fremover
Omvendt
GGAAAACAATGCCCAGACTC
GTGGAATACGTCCAGGTGGC
294 NM_001114982.1
KRT5 Fremover
Omvendt
ACCGTTCCTGGGTAACAGAGCCAC
GCGGGAGACAGACGGGGTGATG
198 NM_000424.3
KRT14 Fremover
Omvendt
GCAGTCATCCAGAGATGTGACC
GGGATCTTCCAGTGGGATCT
181 NM_000526.4
CD44 Fremover
Omvendt
AAGGTGGAGCAAACACAACC
AGCTTTTTCTTCTGCCCACA
151 NM_001202556.1
COL1A1 Fremover
Omvendt
CCCCTGGAAAGAATGGAGATG
TCCAAACCACTGAAACCTCTG
148 NM_000088.3
COL1A2 Fremover
Omvendt
GGATGAGGAGACTGGCAACC
TGCCCTCAGCAACAAGTTCA
77 NM_000089.3
COL3A1 Fremover
Omvendt
CGCCCTCCTAATGGTCAAGG
TTCTGAGGACCAGTAGGGCA
161 NM_000090.3
Vimentin Fremover
Omvendt
GAGAACTTTGCCGTTGAAGC
TCCAGCAGCTTCCTGTAGGT
170 NM_003380.5
GAPDH Fremover
Omvendt
ACCCACTCCTCCACCTTTGA
CTGTTGCTGTAGCCAAATTCGT
110 NM_002046.5

Tabell 1: Sekvenser av primere brukt for kvantitative sanntid polymerasekjedereaksjons.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Menneskelige iPSCs har blitt foreslått som et nytt alternativ for personlig regenerativ medisin17. Pasient-avledede personlig iPSCs gjenspeiler pasientens egenskaper som kan brukes for sykdom modellering og narkotikarelaterte screening autolog transplantasjon18,19. Bruk av pasient-avledede iPSCs kan også overvinne problemer vedrørende primære celler, mangel på tilstrekkelig celle tall og immunreaksjoner5,17,19. Generering av personlig iPSCs er imidlertid ikke økonomisk gjennomførbart på grunn av tid, kostnader og arbeid restriksjoner. HLA-homozygous CBMC-avledet iPSCs har dukket opp som en ny mulighet. HLA-homozygous iPSCs kan være økonomisk og kan brukes på et stort antall pasienter8,11,12,13. Videre oppstår HLA innskriving av CBMCs under cellen bank lagring, og dermed gjør dem enkle å bruke for forskning og transplantasjon. Protokoller å skille CBMC-iPSCs i cardiomyocytes, hepatocytter og chondrocytes rapportert16,20,21,22,23.

Epidermal og dermal lag er komponentene i huden. Overhuden består av keratinocytter og dermis består av fibroblaster. Så differensiert vi CBMC-iPSCs keratinocytter og fibroblaster, henholdsvis. Differensiering, uniformerte, godt kontrollert og optimalisert EBs ble generert av hengende slippe metoden15,24. Type IV kollagen er en viktig komponent i kjelleren membranen. For keratinocyte differensiering, EBs var knyttet til type IV kollagen-belagt retter. CBMC-iPSC-avledet keratinocytter hadde en brosteinsbelagt-lignende morfologi (figur 1D). Keratinocyte markørene Np63 og KRT14 ble uttrykt i iPSC-Ks (figur 1E, F). Som bekreftet at RA og BMP4 indusert oppregulering av keratinocyte markører. CBMC-iPSCs ble videre differensiert i keratinocytter ligner på primære keratinocytter.

For fibroblast differensiering, EBs var festet til kjelleren membran matrix-belagt plater, og de differensierte cellene var serielt passaged på noncoated og skriver jeg kollagen belagte plater. En seriell subkultur ble overtalt til å angi fibroblast differensiering. Fibroblaster produsert en ekstracellulær matrix (EFM) som hadde migrasjon og vedheft. Fibroblaster produserer rikelig kollagen komponenter25. I CBMC-iPSC-avledet fibroblaster, ble fibroblast overflaten markøren CD44 økt. Uttrykket av kollagen var upregulated i iPSC-Fs (figur 2F). Uttrykk for fibronectin og vimentin ble økt i iPSC-Fs (figur 2E).

Bruke differensiert keratinocytter og fibroblaster, generert vi CBMC-iPSC-avledet huden organoids (Figur 3A). Vi brukte en luft-flytende grensesnitt kultur med en high-kalsium medium som indusert lagdelt lag av CBMC-iPSC-avledet hud organoids. Den høye konsentrasjonen av kalsium var nødvendig for keratinocyte modning i vivo og in vitro, mens luften-flytende grensesnittet ble brukt til å utvikle flere lag lag26,27,28. Vi anvendt denne metoden for å etterligne virkelige hud, og histologiske analyse viste at huden var lagdelt (Figur 3C). For å bekrefte sårhelende evnen, transplantert vi iSO i mus hud, med metoden slips over dressing (Figur 3D). Etter transplantasjon, hud organoids var effektivt podet og helbredet mus huden tilstrekkelig. KRT14 ble uttrykt i basale laget av stratifying plateepitel og nonsquamous epithelia. Loricrin er en viktig komponent i i stratum corneum funnet i terminalt differensiert og keratinized epitelceller29,30. Epidermal differensiering markør for loricrin ble uttrykt i transplantert huden. Uttrykk for KRT14 og loricrin bekreftet at huden organoid var fullt ut modne, og differensiering ble demonstrert av immunohistochemical flekker (Figur 3E).

I denne studien utviklet vi en protokoll for å skille CBMC-iPSCs i keratinocytter og fibroblaster, de viktigste celletyper av. Vi bekreftet at den CBMC-iPSC-avledet keratinocytter og fibroblaster viste fenotyper som primær cellelinjer. Bruker disse differensierte celler, vi generert en 3D hud organoid og podet det hilsen/scid mus med metoden slips over dressing. Denne opprinnelige teknikken ble først beskrevet i 1929 av Blair og Brown og har blitt brukt skin pode31,32. Denne metoden forhindret graftet flyttes, foretrakk en god vedheft til såret og dermed akselerert vev helbredelse. Histologiske analyse bekreftet at 3D huden organoid etterlignet en menneskelig hud fenotypen som vellykket lagdelt og modnet over 2 uker. Skin pode utføres vanligvis med enkeltceller keratinocytter og fibroblaster av silisium boble chamber33,34. Denne system er lett pode men vi trengte mer tid for observert til transplantasjon effektivitet etter pode. Plast eller silisium kammer fungerer som en barriere mot Musenes hud. 3D huden organoid system-avledet iPSCs bruker ikke en plast eller silisium kammer. I dette systemet var transplantasjon effektiv; men var det vanskelig å blokkere den naturlige helbredelsesprosessen mus. Så, det mus huden dekket mange deler av iSO lenge etter transplantasjon. Dette er en del av metoden presenteres her som må forbedres.

I konklusjonen, er CBMC-iPSCs en potensiell celle kilde for huden grafts. Bruker disse protokollene, CBMC-iPSC-avledet keratinocytter, kan fibroblaster og en 3D huden organoid brukes i studier knyttet til Dermatologi, narkotika og kosmetisk screening og regenerativ medisin.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne ikke avsløre.

Acknowledgments

Dette arbeidet ble støttet av et stipend fra Korea Healthcare teknologi R & D prosjektet, departementet for helse-, sosial- og familiedepartementet, Sør-Korea (H16C2177, H18C1178).

Materials

Name Company Catalog Number Comments
Adenine Sigma A2786 Component of differentiation medium for fibroblast
AggreWell Medium (EB formation medium) STEMCELL 05893 EB formation
Anti-Fibronectin antibody abcam ab23750 Fibroblast marker
Anti-KRT14 antibody abcam ab7800 Keratinocyte marker
Anti-Loricrin antibody abcam ab85679 Stratum corneum marker
Anti-p63 antibody abcam ab124762 Keratinocyte marker
Anti-Vimentin antibody Santa cruz sc-7558 Fibroblast marker
BAND AID FLEXIBLE FABRIC Johnson & Johnson - Bandage
Basement membrane matrix (Matrigel) BD 354277 Component of differentiation medium for fibroblast
BLACK SILK suture AILEEE SK617 Skin graft
CaCl2 Sigma C5670 Component of epithelial medium for 3D skin organoid
Collagen type I BD 354236 3D skin organoid
Collagen type IV Santa-cruz sc-29010 Component of differentiation medium for keratinocyte
Defined keratinocyte-Serum Free Medium Gibco 10744-019 Component of differentiation medium for keratinocyte
DMEM, high glucose Gibco 11995065 Component of differentiation medium
DMEM/F12 Medium Gibco 11330-032 Component of differentiation medium
Essential 8 medium Gibco A1517001 iPSC medium
FBS, Qualified Corning 35-015-CV Component of differentiation medium for fibroblast and keratinocyte
Glutamax Supplement  Gibco 35050061 Component of differentiation medium for fibroblast
Insulin Invtrogen 12585-014 Component of differentiation medium for fibroblast and keratinocyte
Iris standard curved scissor Professional PC-02.10 Surgical instrument
Keratinocyte Serum Free Medium Gibco 17005-042 Component of differentiation medium for keratinocyte
L-ascorbic acid 2-phosphata sesquimagnesium salt hydrate Sigma A8960 Component of differentiation medium for keratinocyte
MEM Non-Essential Amino Acid Gibco 1140050 Component of differentiation medium for fibroblast
Meriam Forceps Thumb 16 cm HIROSE HC 2265-1 Surgical instrument
NOD.CB17-Prkdc SCID/J The Jackson Laboratory 001303 Mice strain for skin graft
Petri dish 90 mm Hyundai Micro H10090 Plastic ware
Recombinant Human BMP-4 R&D 314-BP Component of differentiation medium for keratinocyte
Recombinant human EGF protein R&D 236-EG Component of differentiation medium for keratinocyte
Retinoic acid Sigma R2625 Component of differentiation medium for keratinocyte
T/C Petridish 100 mm, 240/bx TPP 93100 Plastic ware
Transferrin Sigma T3705 Component of epithelial medium for 3D skin organoid
Transwell-COL collagen-coated membrane inserts  Corning CLS3492 Plastic ware for 3D skin organoid 
Vitronectin Life technologies A14700 iPSC culture
Y-27632 Dihydrochloride peprotech 1293823 iPSC culture

DOWNLOAD MATERIALS LIST

References

  1. Vincent, J. F., Bogatyreva, O. A., Bogatyrev, N. R., Bowyer, A., Pahl, A. K. Biomimetics: its practice and theory. Journal of The Royal Society Interface. 3, (9), 471-482 (2006).
  2. Madison, K. C. Barrier function of the skin: "la raison d'etre" of the epidermis. Journal of Investigative Dermatology. 121, (2), 231-241 (2003).
  3. Chen, M., Przyborowski, M., Berthiaume, F. Stem cells for skin tissue engineering and wound healing. Critical Reviews in Biomedical Engineering. 37, (4-5), 399-421 (2009).
  4. Dixit, S., et al. Immunological challenges associated with artificial skin grafts: available solutions and stem cells in future design of synthetic skin. Journal of Biological Engineering. 11, 49 (2017).
  5. Yamanaka, S. Induced pluripotent stem cells: past, present, and future. Cell Stem Cell. 10, (6), 678-684 (2012).
  6. Yamanaka, S. Pluripotency and nuclear reprogramming. Philosophical Transactions of the Royal Society B: Biological Sciences. 363, (1500), 2079-2087 (2008).
  7. Scheiner, Z. S., Talib, S., Feigal, E. G. The potential for immunogenicity of autologous induced pluripotent stem cell-derived therapies. Journal of Biological Chemistry. 289, (8), 4571-4577 (2014).
  8. Zimmermann, A., Preynat-Seauve, O., Tiercy, J. M., Krause, K. H., Villard, J. Haplotype-based banking of human pluripotent stem cells for transplantation: potential and limitations. Stem Cells and Development. 21, (13), 2364-2373 (2012).
  9. Takahashi, K., Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126, (4), 663-676 (2006).
  10. Terasaki, P. I. A brief history of HLA. Immunologic Research. 38, (1-3), 139-148 (2007).
  11. Haase, A., et al. Generation of induced pluripotent stem cells from human cord blood. Cell Stem Cell. 5, (4), 434-441 (2009).
  12. Rim, Y. A., et al. Recent progress of national banking project on homozygous HLA-typed induced pluripotent stem cells in South Korea. Journal of Tissue Engineering and Regenerative Medicine. 12, (3), 1531-1536 (2018).
  13. Nakatsuji, N., Nakajima, F., Tokunaga, K. HLA-haplotype banking and iPS cells. Nature Biotechnology. 26, (7), 739-740 (2008).
  14. Pappas, D. J., et al. Proceedings: human leukocyte antigen haplo-homozygous induced pluripotent stem cell haplobank modeled after the california population: evaluating matching in a multiethnic and admixed population. Stem Cells Translational Medicine. 4, (5), 413-418 (2015).
  15. Lin, Y., Chen, G. Embryoid body formation from human pluripotent stem cells in chemically defined E8 media. StemBook. Available from: https://www.stembook.org/node/6632 (2008).
  16. Kim, Y., et al. Establishment of a complex skin structure via layered co-culture of keratinocytes and fibroblasts derived from induced pluripotent stem cells. Stem Cell Research & Therapy. 9, (1), 217 (2018).
  17. Diecke, S., Jung, S. M., Lee, J., Ju, J. H. Recent technological updates and clinical applications of induced pluripotent stem cells. The Korean Journal of Internal Medicine. 29, (5), 547-557 (2014).
  18. Shi, Y., Inoue, H., Wu, J. C., Yamanaka, S. Induced pluripotent stem cell technology: a decade of progress. Nature Reviews Drug Discovery. 16, (2), 115-130 (2017).
  19. Yoshida, Y., Yamanaka, S. Recent stem cell advances: induced pluripotent stem cells for disease modeling and stem cell-based regeneration. Circulation. 122, (1), 80-87 (2010).
  20. Pham, T. L., Nguyen, T. T., Van Bui, A., Nguyen, M. T., Van Pham, P. Fetal heart extract facilitates the differentiation of human umbilical cord blood-derived mesenchymal stem cells into heart muscle precursor cells. Cytotechnology. 68, (4), 645-658 (2016).
  21. Stecklum, M., et al. Cell differentiation mediated by co-culture of human umbilical cord blood stem cells with murine hepatic cells. In Vitro Cellular & Developmental Biology - Animal. 51, (2), 183-191 (2015).
  22. Nam, Y., Rim, Y. A., Ju, J. H. Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells. Journal of Visualized Experiments. (124), e55988 (2017).
  23. Rim, Y. A., Nam, Y., Ju, J. H. Application of Cord Blood and Cord Blood-derived Induced Pluripotent Stem Cells for Cartilage Regeneration. Cell Transplantation. (2018).
  24. Shevde, N. K., Mael, A. A. Techniques in embryoid body formation from human pluripotent stem cells. Methods in Molecular Biology. 946, 535-546 (2013).
  25. Shamis, Y., et al. iPSC-derived fibroblasts demonstrate augmented production and assembly of extracellular matrix proteins. In Vitro Cellular & Developmental Biology - Animal. 48, (2), 112-122 (2012).
  26. Bikle, D. D., Xie, Z., Tu, C. L. Calcium regulation of keratinocyte differentiation. Expert Review of Endocrinology & Metabolism. 7, (4), 461-472 (2012).
  27. Bernstam, L. I., Vaughan, F. L., Bernstein, I. A. Keratinocytes grown at the air-liquid interface. In Vitro Cellular & Developmental Biology. 22, (12), 695-705 (1986).
  28. Prunieras, M., Regnier, M., Woodley, D. Methods for cultivation of keratinocytes with an air-liquid interface. Journal of Investigative Dermatology. 81, 1 Suppl 28-33 (1983).
  29. Steven, A. C., Bisher, M. E., Roop, D. R., Steinert, P. M. Biosynthetic pathways of filaggrin and loricrin--two major proteins expressed by terminally differentiated epidermal keratinocytes. Journal of Structural Biology. 104, (1-3), 150-162 (1990).
  30. Hohl, D., et al. Characterization of human loricrin. Structure and function of a new class of epidermal cell envelope proteins. Journal of Biological Chemistry. 266, (10), 6626-6636 (1991).
  31. Bern, R., et al. Original and modified technique of tie-over dressing: Method and application in burn patients. Burns. 44, (5), 1357-1360 (2018).
  32. Joyce, C. W., Joyce, K. M., Kennedy, A. M., Kelly, J. L. The Running Barbed Tie-over Dressing. Plastic and Reconstructive Surgery - Global Open. 2, (4), 137 (2014).
  33. Wang, C. K., Nelson, C. F., Brinkman, A. M., Miller, A. C., Hoeffler, W. K. Spontaneous cell sorting of fibroblasts and keratinocytes creates an organotypic human skin equivalent. Journal of Investigative Dermatology. 114, (4), 674-680 (2000).
  34. Yang, R., et al. Generation of folliculogenic human epithelial stem cells from induced pluripotent stem cells. Nature Communications. 5, 3071 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics