Generation von 3D Haut organoide aus Cord Blood-abgeleitete induzierte pluripotente Stammzellen

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Wir schlagen eine Protokoll, die zeigt, wie man differenzieren induzierten pluripotenten Stammzellen abgeleitet Keratinozyten und Fibroblasten und generieren eine organoide 3D Haut mit diesen Keratinozyten und Fibroblasten. Dieses Protokoll enthält einen zusätzlichen Schritt einem humanisierten Mäuse-Modell zu erzeugen. Die hier vorgestellten Technik verbessert die dermatologische Forschung.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Kim, Y., Ju, J. H. Generation of 3D Skin Organoid from Cord Blood-derived Induced Pluripotent Stem Cells. J. Vis. Exp. (146), e59297, doi:10.3791/59297 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Die Haut ist das größte Organ und hat viele Funktionen. Die Haut wirkt wie eine physikalische Barriere und Beschützer des Körpers und reguliert Körperfunktionen. Bionik ist die Nachahmung der Modelle, Systeme und Elemente der Natur zur Lösung komplexer Probleme1. Haut-Bionik ist ein nützliches Werkzeug für die Erforschung von Krankheiten in-vitro- und in-vivo regenerative Medizin. Menschlichen induzierten pluripotenten Stammzellen (iPSCs) haben das Merkmal der unbegrenzten Verbreitung und die Fähigkeit der Differenzierung, drei Mikrobeschichten. Menschlichen iPSCs entstehen aus verschiedenen Primärzellen, wie Blutzellen, Keratinozyten und Fibroblasten. Unter ihnen sind Kabel mononukleären Blutzellen (CBMCs) als alternative Zelle Quelle aus der Perspektive der allogenen regenerative Medizin entstanden. CBMCs eignen sich in der regenerativen Medizin, weil human Leukocyte Antigen (HLA) Eingabe in die Zelle, die banking-System notwendig ist. Wir bieten eine Methode für die Differenzierung von CBMC iPSCs in Keratinozyten und Fibroblasten und zur Erzeugung von einem 3D Haut organoide. CBMC-iPSC-derived Keratinozyten und Fibroblasten haben ähnliche Merkmale auf, eine primäre Zelllinie. Die 3D Haut Organellen entstehen durch die Überlagerung einer epidermalen Schicht auf eine Hautschicht. Durch die Transplantation von diesem 3D Haut organoide, wird einen vermenschlichten Mäuse-Modell erstellt. Diese Studie zeigt, dass ein 3D iPSC-abgeleitete Menschenhaut organoide möglicherweise eine neuartige, alternative Tool für dermatologische Forschung in vitro und in vivo.

Introduction

Haut bedeckt die äußerste Oberfläche des Körpers und schützt innere Organe. Die Haut hat verschiedene Funktionen, einschließlich Schutz gegen Krankheitserreger, Aufnahme und Speicherung von Wasser, Regulierung der Körpertemperatur, und Körper Ausscheiden Abfälle2. Hauttransplantationen können je nach Haut Quelle eingestuft werden; Transplantate mit der Haut von einem anderen Spender sind Allografts bezeichnet, und mit der Haut des Patienten Transplantate sind Autotransplantate. Obwohl eine Autotransplantation die bevorzugte Behandlung wegen seiner niedrigen Ablehnung ist, sind Hautbiopsien schwer auf Patienten mit schweren Verletzungen oder eine unzureichende Anzahl von Hautzellen durchführen. Bei Patienten mit schweren Verbrennungen sind drei Mal die Zahl der Hautzellen notwendig, um große Flächen abdecken. Die begrenzte Verfügbarkeit von Hautzellen vom Körper des Patienten führt zu Situationen, wo allo-Transplantation erforderlich ist. Ein Allograft dient vorübergehend bis autologe Transplantation durchgeführt werden kann, da es in der Regel vom Immunsystem des Wirts nach ca. 1 Woche3abgelehnt wird. Ablehnung durch das Immunsystem zu überwinden, müssen die Transplantate aus einer Quelle mit der gleichen immun Identität als Patient4kommen.

Menschlichen iPSCs sind eine neue Quelle von Zellen für Stammzell-Therapie5. Menschlichen iPSCs entstehen aus Körperzellen, Neuprogrammierung Faktoren wie OCT4, SOX2, Klf4 und c-Myc-6. Mit menschlichen iPSCs überwindet die ethischen und immunologischen Fragen von embryonalen Stammzellen (WSR)7,8. Menschlichen iPSCs haben Pluripotenz und kann in drei Mikrobeschichten9unterscheiden. Das Vorhandensein von HLA, ein entscheidender Faktor in der regenerativen Medizin, bestimmt die Immunantwort und die Möglichkeit der Ablehnung10. Die Verwendung von Patienten abgeleitet iPSCs löst die Probleme der Zelle-Source Einschränkung und Immunsystem Ablehnung. CBMCs sind auch als alternative Zelle Quelle für regenerative Medizin11entstanden. Obligatorische HLA Typisierung, die während CBMC Banking auftritt, kann leicht für Forschung und Transplantation verwendet werden. Weitere, homozygot HLA-Typ iPSCs können weitgehend auf verschiedenen Patienten12anwenden. Eine CBMC iPSC-Bank ist eine neuartige und effiziente Strategie für Zelltherapie und allogenen regenerative Medizin12,13,14. In dieser Studie wir verwenden CBMC-iPSCs in Keratinozyten und Fibroblasten, differenzieren und geschichteten 3D Hautschichten zu generieren. Ergebnisse dieser Studie legen nahe, dass eine CBMC iPSC abgeleitete 3D Haut organoide ein neuartiges Werkzeug für in-vitro- und in-vivo dermatologische Forschung ist.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle Verfahren, die Tiere wurden in Übereinstimmung mit dem Labor Tiere Welfare Act, der Leitfaden für die Pflege und Verwendung von Labortieren, durchgeführt und die Richtlinien und Richtlinien für Nager Experimente zur Verfügung gestellt von der institutionellen Animal Care und Ausschuss (IACUC) von der medizinischen Fakultät der katholischen Universität von Korea zu verwenden. Das Studienprotokoll wurde von Institutional Review Board of The Catholic University of Korea (CUMC-2018-0191-01) genehmigt. Die IACUC und die Abteilung von Labor Tiere (DOLA) der katholischen Universität Korea, Songeui Campus akkreditiert die Korea Excellence Tier Laboreinrichtung der Korea Food and Drug Administration in 2017 und erworbene Assoziation zur Beurteilung und Akkreditierung von Laboratory Animal Care International (AAALAC) internationale volle Akkreditierung im Jahr 2018.

(1) Haut-Zell-Differenzierung von induzierten pluripotenten Stammzellen

  1. Mittlere Vorbereitung
    Hinweis: Bewahren Sie alle Mittel bei 4 ° C in einer dunklen Umgebung für bis zu 3 Monaten. Filtern Sie alle Medium mit einem 0,22 μm Polyethersulfone Filtersystem vor der Verwendung für die Sterilisation. Alle Medium war in einem Gesamtvolumen von 500 mL erhältlich.
    1. KDM1 vorbereiten (Keratinozyten Differenzierung Medium 1). Mischung Dulbecco geändert Eagle Medium (DMEM) / F12 Medium (3:1) mit 2 % fetalen bovine Serum (FBS), 0,3 Mmol/L L-Ascorbinsäure, 5 μg/mL Insulin und 24 µg/mL Adenin.
    2. Bereiten Sie KDM2 (Keratinozyten Differenzierung Medium 2). Mix Keratinozyten serumfreien Medium definiert (siehe Tabelle der Materialien) mit 0,3 Mmol/l-L-Ascorbinsäure, 5 μg/mL Insulin und 10 μg/mL Adenin.
      Hinweis: Definierte Keratinozyten serumfreien Medium ist optimiert, um das Wachstum und die Expansion der Keratinozyten zu unterstützen.
    3. KDM3 vorbereiten (Keratinozyten Differenzierung Medium 3). Mix definiert Keratinozyten serumfreien Medium und Keratinozyten serumfreien Medium (1:1) Tabelle der Materialien für Details anzeigen.
      Hinweis: Keratinozyten serumfreien Medium ist für das Wachstum und die Aufrechterhaltung der Keratinozyten optimiert.
    4. Bereiten Sie FDM1 (Fibroblasten Differenzierung Medium 1). Mix DMEM/F12 Medium (3:1) mit 5 % FBS, 5 μg/mL Insulin 0,18 mM Adenin und 10 ng/mL epidermalen Wachstumsfaktor (EGF).
    5. Bereiten Sie FDM2 (Fibroblasten Differenzierung Medium 2). Mix DMEM/F12 Medium (1:1) mit 5 % FBS und 1 % nichtessentiellen Aminosäuren.
    6. Bereiten Sie EP1 (epitheliale Medium 1). Mix DMEM/F12 (3:1) mit 4 mM L-Glutamin, 40 μM Adenin, 10 μg/mL Transferrin, 10 μg/mL Insulin und 0,1 % FBS.
    7. Bereiten Sie EP2 (epitheliale Medium 2). Mischen Sie EP1 und 1,8 mM Calciumchlorid.
    8. Bereiten Sie EP3 (epitheliale Medium 3, Verhornungsstörungen Medium). Mix-F12 Medium mit 4 mM L-Glutamin, 40 μM Adenin, 10 μg/mL Transferrin, 10 μg/mL Insulin, 2 % FBS und 1,8 mM Kalzium-Chlorid.
  2. Embryonalen Körper generation
    1. Generieren Sie CBMC-iPSCs mithilfe des Protokolls, die in einer früheren Studie12gezeigt.
    2. Bestreichen Sie Kultur-Gerichte, mit Vitronectin. Bereiten Sie 5 mL einen 100 Millimeter-Teller zu beschichten.
      1. Auftauen und Aufschwemmen 50 μL von 0,5 mg/mL Vitronectin (Endkonzentration: 5 µg/mL) mit 5 mL sterilem Phosphat-gepufferte Kochsalzlösung (PBS). Die Gerichte der Lösung hinzu und Inkubation bei Raumtemperatur (RT) für 1 h Aspirat das Beschichtungsmaterial vor Gebrauch (nicht austrocknen).
    3. Pflegen Sie CBMC abgeleitet iPSCs zum Vitronectin-beschichtete 100 mm Platte und das iPSC-Medium (E8) bei 37 ° C mit 10 % CO2täglich verändern.
    4. Generieren Sie embryonalen Organe (EBs) unter Verwendung des Protokolls, die in einer früheren Studie15 (wie folgt kurz beschrieben) gezeigt. Erweitern Sie iPSCs durch das Medium zu wechseln, bis die Zellen 80 % Zusammenfluss erreicht haben. Am Zusammenfluss von 80 % entfernen Sie das Medium und mit PBS waschen.
    5. Behandeln Sie die Zellen mit 1 mL 1 mM Ethylenediaminetetraacetic Säure (EDTA). Inkubation bei 37 ° C mit 5 % CO2 für 2 min und die Zellen mit 3 mL E8 Medium zu ernten. Zentrifugieren Sie die Zellen bei 250 X g für 2 min.
    6. Den Überstand abgesaugt und 5 mL Medium E8 auf Zellen anwenden. Zählen der Zellen unter Verwendung einer Hemocytometer und 1 x 106 Zellen auf eine neue 15 mL konische Rohr übertragen. Zentrifugieren Sie die Zellen bei 250 X g für 2 min.
    7. Die übertragenen Zellen mit 2,5 mL EB Bildung Medium mit 10 μM Rho-assoziierten Kinase (ROCK) Inhibitor aufzuwirbeln. Tropfen Sie 1 x 104 Zellen (25 µL/Drop) auf eine noncoated Kultur Platte Deckel mit einer 10-100 μl Mehrkanal-Pipette. Form 100 EBs aus 1 x 106 Zellen (1 x 104 Zellen/1 EB). Die Schale umdrehen und den Deckel auf das Droplet hängen.
      Hinweis: ROCK-Hemmer ist während der Anlage Schritt im Prozess Wartung und Differenzierung erforderlich. Fügen Sie der ROCK-Inhibitors nur in der EB-Aggregation-Phase.
    8. 1 Tag inkubieren Sie die Tropfen bei 37 ° C mit 5 % CO2 .
    9. Am nächsten Tag ernten die 100 EBs und Differenzierung zu verwenden. Der Deckel der Platte mit iPSC Mittel (E8 Mittel) "oder" PBS auswaschen und den Inhalt in ein 50 mL konische Rohr zu ernten. Pflegen Sie die EBs bei RT für 1 min um ihnen niederzulassen. Den Überstand abgesaugt, Aufschwemmen der EBs mit E8 Medium, und pflegen sie in einem 90 mm Petrischale bis die Differenzierung.
  3. Differenzierung der CBMC iPSCs in Keratinozyten
    Hinweis: Für eine Regelung der Keratinozyten Differenzierung von CBMC iPSCs, siehe Abbildung 1A.
    1. Ernte 100 EBs ein 50 mL konische Röhrchen mit iPSC Mittel "oder" PBS. Pflegen Sie bei RT für 1 min um die EBs niederlassen. Stellen Sie sicher, dass sie am unteren Rand das konische Rohr niederlassen. Den Überstand abgesaugt und Aufschwemmen der EBs mit E8 Medium mit 1 ng/mL Knochen morphogenetische Protein 4 (BMP4). Übertragen Sie die EBs mit einem 90 mm Petrischale zu und pflegen sie bei 37 ° C mit 5 % CO2 für 1 Tag.
    2. Kultur-Gerichte, mit Typ IV Kollagen zu beschichten. Bereiten Sie 5 mL Typ IV Kollagen, einen 100-Millimeter-Teller zu beschichten.
      1. Auftauen und Aufschwemmen den Typ IV Kollagen Lösung (Endkonzentration: 50 µg/mL) mit 0,05 N HCl. Fügen Sie die Lösung zu den Gerichten und 1 h bei RT inkubieren Aspirieren das Beschichtungsmaterial vor Gebrauch (nicht austrocknen).
        Hinweis: Bevor Sie die Platten verwenden, den Abwasch 3 X mit PBS, Säure zu entfernen.
    3. Ernten Sie der EBs (Schritt 1.3.1) in ein 50 mL konische Röhrchen zu und pflegen sie bei RT für 1 min um ihnen niederzulassen. Stellen Sie sicher sie am unteren Rand das konische Rohr zu begleichen, Aspirieren überstand und Aufschwemmen der EBs in 6 mL KDM1 mit 10 µM-ROCK-Inhibitor. Übertragen Sie die EBs auf die Art IV Kollagen beschichtet 100 mm Schale.
      Hinweis: Hinzufügen der ROCK-Inhibitors nur Stadium der EB Anlage.
    4. Wechseln Sie zwischen 0 – 8 Tage das Medium jeden zweiten Tag zu KDM1 mit 3 µM-Retinsäure (RA) und 25 ng/mL jedes BMP4 und EGF. Die EBs bei 37 ° C mit 5 % CO2zu erhalten.
    5. Zwischen den Tagen 9 – 12 verändern Sie das Medium jeden zweiten Tag, KDM2 mit 3 µM RA 25 ng/mL BMP4 und 20 ng/mL EGF.
    6. Zwischen den Tagen 13 – 30 verändern Sie das Medium jeden zweiten Tag zu KDM3 mit 10 ng/mL BMP4 und 20 ng/mL EGF.
  4. Differenzierung der CBMC iPSC in Fibroblasten
    Hinweis: Für eine Regelung der Fibroblasten Differenzierung von CBMC iPSCs, siehe Abbildung 2A.
    1. Kultur-Gerichte, mit Basalmembran Matrix Mantel. Bereiten Sie 5 mL einen 100 Millimeter-Teller zu beschichten.
      1. Tauen Sie Basalmembran Matrix (Endkonzentration: 600 ng/mL) und verdünnen Sie es mit DMEM/F12 Medium. Die Gerichte der Lösung hinzu und Inkubation bei 37 ° C für 30 min. Aspirat das Beschichtungsmaterial vor Gebrauch (nicht austrocknen).
    2. Ernte 100 EBs eine 50 mL konische Rohr mit einer Pipette mit iPSC Mittel "oder" PBS. Pflegen Sie bei RT für 1 min um die EBs niederlassen. Stellen Sie sicher, dass sie am unteren Rand das konische Rohr niederlassen. Den Überstand zu entfernen.
    3. Aufzuwirbeln Sie die EBs mit einer 1.000 µL Pipette in 6 mL FDM1 mit 10 µM ROCK Inhibitor. Transfer der EBs (mit Medium) in eine Basalmembran Matrix beschichtet 100 mm Schale und Inkubation bei 37 ° C mit 5 % CO2. Aktualisieren Sie die FDM1 täglich für 3 Tage.
      Hinweis: Nur die ROCK-Inhibitor Stadium der EB-Anlage hinzufügen.
    4. Die FDM1 zwischen 4 und 6 Tage 0,5 nM Knochen morphogenetische Protein 4 (BMP-4) hinzufügen.
    5. Am 7.Tag ändern Sie das Medium in FDM2 täglich für 1 Woche.
    6. Am 14. Tag fügen Sie 1 mL 1 mM EDTA und Inkubation bei 37 ° C mit 5 % CO2 für 2 min. Ernten der Zellen mit 3 mL FDM2 und Zentrifuge bei 250 X g für 2 min. Überstand zu entfernen und die Zellen in 5 mL FDM1 aufzuwirbeln.
    7. Zählen der Zellen unter Verwendung einer Hemocytometer, 2 x 106 Zellen mit FDM1 Medium Aufschwemmen und übertragen die Zellen in die noncoated Schale. Die Zellen bei 37 ° C mit 5 % CO2 zu erhalten und das Medium täglich verändern.
    8. Mantel-Kultur-Gerichte, mit Typ I Kollagen. Bereiten Sie 5 mL einen 100 Millimeter-Teller zu beschichten. Verdünnen Sie Typ-I-Kollagen-Lösung (Endkonzentration: 50 µg/mL) in 0,02 N Essigsäure. Die Gerichte der Lösung hinzu und bei RT inkubieren Sie 1H Aspirat das Beschichtungsmaterial vor Gebrauch (nicht austrocknen).
      Hinweis: Bevor Sie die Platten verwenden, den Abwasch 3 X mit PBS, die Säure zu entfernen.
    9. Am Tag 21 fügen Sie 1 mL 1 mM EDTA und Inkubation bei 37 ° C mit 5 % CO2 für 2 min. Ernten der Zellen mit 3 mL FDM1 und Zentrifuge bei 250 X g für 2 min. Überstand zu entfernen und die Zellen in 5 mL FDM1 aufzuwirbeln. Die Anzahl der Zellen mit einem Hemocytometer und Transfer 2 x 106 Zellen in den Typ ich Kollagen beschichtet 100 Millimeter-Teller mit FDM1 Medium. Die Zellen bei 37 ° C mit 5 % CO2 zu erhalten und das Medium täglich verändern.
    10. Am 28. Tag fügen Sie 1 mL 1 mM EDTA und Inkubation bei 37 ° C mit 5 % CO2 für 2 min. Ernten der Zellen mit 3 mL FDM1 und Zentrifuge bei 250 X g für 2 min. Überstand zu entfernen und die Zellen in 5 mL FDM1 aufzuwirbeln. Zählen der Zellen unter Verwendung einer Hemocytometer und 2 x 106 Zellen auf ein noncoated Gericht mit FDM1 Medium übertragen. Die Zelle bei 37 ° C mit 5 % CO2 zu erhalten und das Medium täglich verändern.
      Hinweis: iPSC abgeleitet Fibroblasten vermehren sich wie eine primäre Fibroblasten Zelllinie und Passage bis zu 10 Passagen. In dieser Studie haben wir iPSC-abgeleitete Fibroblasten von zwei bis fünf Passagen zur weiteren Analyse verwendet.

2. Anwendung der HiPSC abgeleitete differenzierte Zellen

  1. Generation von 3D Haut organoide
    1. Bereiten Sie neutralisiert Typ ich Kollagen auf Eis, nach den Empfehlungen des Herstellers. Verwendung als letztendliche Konzentration 3 mg/mL für Typ I Kollagen (Typ-I-Lager Konzentration von Kollagen ist 3,47 mg/mL), und sicherstellen, dass der letzte Band der Mischung beträgt 5 mL. Berechnen Sie das Volumen von 10 X PBS (letzte Band/10 = 0,5 mL). Berechnen Sie das Volumen des Typ-I-Kollagen verwendet werden (Endvolumen x letzte Kollagen Konzentration / Kollagen Konzentration Lager = 5 mL x 3 mg / mL / 3,47 mg / mL = 4,32 mL). Berechnen Sie das Volumen von 1 N NaOH (Volumen von Kollagen zu verwendenden x 0,023 mL = 0,1 mL). Berechnen Sie das Volumen des dH2O (Endvolumen - Volumen von Kollagen - Volumen von 10 X PBS - Volumen von 1 N NaOH = 5 mL - 4,32 mL-0,5 mL-0,1 mL = 0,08 mL). Mischen Sie den Inhalt des Röhrchens und halten sie auf dem Eis bis zur Anwendung.
    2. Fügen Sie 1 mL EDTA in der iPSC-abgeleitete Fibroblasten aus Schritt 1.4.10 und Inkubation bei 37 ° C mit 5 % CO2 für 2 min. die freistehenden Zellen zu ernten, zählen Sie die Zellen mit einem Hemocytometer und 2 x 105 Zellen auf eine neue 15 mL konische Rohr übertragen. 250 X g für 2 min Zentrifugieren und den Überstand zu entfernen. Die Zellen der iPSC-abgeleitete Fibroblasten in 1,5 mL FDM1 Aufschwemmen und neutralisiert die Art ich Kollagen-Lösung (1:1).
      Hinweis: Mischen Sie die Lösung vorsichtig, um Luftblasen zu vermeiden.
    3. Legen Sie die Membran-Einsatz auf einer 6-Well Mikrotestplatte, übertragen Sie die Mischung auf den Einsatz und 30 min bei RT inkubieren.
      Hinweis: Bewegen Sie die Platten nicht.
    4. Fügen Sie nach der Bestätigung der Gelierung 2 mL Medium oben einfügen und 3 mL auf den Boden des Brunnens. Inkubieren Sie die Matrix der Fibroblasten und Kollagen bei 37 ° C mit 5 % CO2 5-7 Tage, bis die Gelierung abgeschlossen ist und nicht mehr Verträge.
    5. Nach der vollständigen Gelierung, lösen die iPSC-abgeleitete Keratinozyten (aus Schritt 1.3.6) mit EDTA. Fügen Sie 1 mL EDTA und Inkubation bei 37 ° C mit 5 % CO2 für 2 min. die freistehenden Zellen zu ernten, rechnen sie mit einer Hemocytometer und 1 x 106 Zellen auf eine neue 15 mL konische Rohr übertragen. Zentrifuge bei 250 X g 2 min. lang.
    6. Den Überstand zu entfernen und erneut 1 x 106 Zellen in 50-100 µL niedrige Kalzium epithelialen Medium 1 (EP1).
    7. Aspirieren Sie alle Mittel in der Matrix (siehe Punkt 2.1.5) und 1 x 106 Zellen der iPSC-abgeleitete Keratinozyten auf jede Schicht Fibroblasten Samen. Inkubieren Sie die Platte bei 37 ° C mit 5 % CO2 für 30 min.
      Hinweis: Die Platte nicht bewegen und keines Medium für die Befestigung der Keratinozyten hinzufügen.
    8. Fügen Sie 2 mL EP1 an die Spitze des Einsatzes und 3 mL EP1 an der Unterseite des Brunnens.
    9. Nach 2 Tagen alle Mittel in die Membran Einlegeplatte Aspirieren und das Medium zum normalen Calcium EP2 für 2 Tage verändern.
    10. Aspirieren Sie nach 2 Tagen alle mittleren und 3 mL des Mediums Verhornungsstörungen nur nach unten auf eine Air-Liquid-Schnittstelle zu generieren.
    11. Pflegen Sie die 3D Haut organoide für bis zu 14 Tage bei 37 ° C mit 5 % CO2 und verändern Sie das Medium täglich. Ernten Sie 3D Haut organoide durch die Schneide des Einsatzes zu, und verwenden Sie es für eine weitere Studie von Färbung und Hauttransplantation.
  2. Hauttransplantation
    1. Führen Inhalation Anästhesie auf NOD/scid-Mäuse (männlich, 6 Wochen alt), ein standard, institutionell anerkannte Methode. Rasieren Sie für Hauttransplantation, das Fell der Rückenhaut jede Maus.
    2. Entfernen Sie einen 1 x 2 cm Abschnitt der Maus Haut, mit gebogenen Schere mit einer Pinzette.
    3. Legen Sie die CBMC iPSC abgeleitete 3D Haut organoide auf den Defekt Website und Naht mit einer Krawatte über Dressing-Methode mit seidenen Fäden.
    4. Beobachten Sie die Mäuse für 2 Wochen und für die histologische Analyse zu opfern. Die Färbung Protokoll wurde in früheren Studien16verifiziert.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Haut besteht zum größten Teil aus der Epidermis und der Dermis. Keratinozyten sind die wichtigsten Zellen der Epidermis und Fibroblasten sind die wichtigsten Zelltyp der Dermis. Das Schema der Keratinozyten Differenzierung ist in Abbildung 1Agezeigt. CBMC-iPCSc wurden beibehalten, in einer Schale Vitronectin beschichtet (Abbildung 1B). In dieser Studie differenziert wir CBMC iPSCs in Keratinozyten und Fibroblasten mit EB Bildung. Wir generierten EBs mit der hängenden drop-Methode um eine gleichmäßige und kontrollierte Differenzierung der Keratinozyten und Fibroblasten (Abbildung 1C) zu gewährleisten. EBs Typ IV Kollagen-beschichtete Platten für die Differenzierung der Keratinozyten befestigt waren, und das Medium wurde täglich gewechselt. CBMC iPSCs wurden mit RA, BMP4 und EGF behandelt. CBMC iPSCs wurden zu Keratinozyten differenziert. Während der Differenzierung die Morphologie der Keratinozyten CBMC iPSC abgeleitet verändert im Laufe der Zeit (ergänzende Abbildung1).

CBMC-iPSC-derived Keratinozyten haben Morphologien primären Keratinozyten (Abbildung 1D) ähnlich. Die Genexpression von pluripotenten Marker OCT4 war herunterreguliert in Keratinozyten CBMC iPSC abgeleitet. Primer-Sequenzen sind in Tabelle 1dargestellt. Der Ausdruck der Keratinozyten Marker Np63, KRT5 und KRT14 wurde im CBMC-iPSC-derived Keratinozyten (Abbildung 1F) erhöht. Keratinozyten CBMC iPSC abgeleitet wurden durch die Expression von Np63 und KRT14 von Immunohistochemistry (Abbildung 1E) bestätigt. Diese Ergebnisse bestätigten, dass CBMC-iPSC-derived Keratinozyten die Merkmale der primären Keratinozyten.

Das Schema der Fibroblasten Differenzierung ist in Abbildung 2Agezeigt. Wir auch gepflegt CBMC iPSCs in einer Schale mit Vitronectin beschichtet und EB Bildung für Fibroblasten-Differenzierung (Abbildung 2B, C) verwendet. Wir an der EBs Basalmembran Matrix-beschichteten Platten und das Medium jeden zweiten Tag gewechselt. Auswuchs Zellen wurden zu noncoated und Typ I-Kollagen-beschichteten Platten. CBMC iPSCs wurden zu Fibroblasten differenziert. Während der Differenzierung verändert die Morphologie der CBMC-iPSC-derived Fibroblasten im Laufe der Zeit (ergänzende Abbildung2).

CBMC-iPSC-derived Fibroblasten haben Morphologien ähnlich wie primäre Fibroblasten (Abbildung 2D). Der Ausdruck der pluripotenten Stammzelle Marker OCT4 war herunterreguliert in Fibroblasten CBMC iPSC abgeleitet. Fibroblasten-Marker des COL1A1, COL1A2, COL3A1 und CD44 wurden hochreguliert in CBMC-iPSC-derived Fibroblasten (Abbildung 2F). Primer-Sequenzen sind in Tabelle 1dargestellt. Darüber hinaus wurden CBMC-iPSC-derived Fibroblasten durch die Expression von Vimentin und Fibronektin von Immunohistochemistry (Abb. 2E) bestätigt. Diese Ergebnisse deuten darauf hin, dass Fibroblasten CBMC iPSC abgeleitet, die primäre Fibroblasten ähneln.

Wir erzeugt eine 3D Haut organoide mit dem CBMC-iPSC-derived Keratinozyten und Fibroblasten. Das Schema der Bildung von 3D Haut organoide ist in Abbildung 3gezeigt. Wir erzeugt eine 3D Haut organoide auf eine Membran Einlegeplatte. Für die 3D Culture CBMC-iPSC-derived Fibroblasten wurden geschichtet mit Typ ich Kollagen und überlagert mit CBMC-iPSC-derived Keratinozyten. Nach der Aussaat der Keratinozyten CBMC iPSC abgeleitet, wurde das Medium in einem normalen Calcium-Konzentration für 2 Tage geändert. Nach 2 Tagen wurde eine hohe Calcium-Konzentration-Medium nur die untere Kammer für die Bildung von Luft-Flüssigkeit Schnittstelle Kultur hinzugefügt. Die Luft-Flüssigkeit Schnittstelle Kultur induzierte der Reifung und Schichtung der Keratinozyten. Die Stärke des 3D Haut organoide war während 3D Culture erhöht. Diese Ergebnisse bestätigten, dass die 3D Haut organoide aus iPSC-abgeleitete Keratinozyten und Fibroblasten von Hämatoxylin und Eosin (H & E) Färbung (Abb. 3C) generiert wurde.

Mit 3D Haut CBMC-iPSC-derived organoide, erzielten wir einen humanisierten Mäuse-Modell (Abbildung 3B) durch Pfropfung 3D Haut organoide für die Mäuse. 1 x 2 cm Mangel induziert wurde, und die Krawatte-Over-Methode wurde für die Transplantation verwendet. Nach 2 Wochen die transplantierte Haut war effizient den Mäusen verpflanzt, und wir dies durch H & E und Immunocytochemical Analyse (Abbildung 3D) bestätigt. Reifung der Keratinozyten und epidermalen Differenzierung Marker für Loricrin und KRT14 wurden in 3D Haut CBMC iPSC-abgeleitete Organellen (Abbildung 3E) ausgedrückt. 3D Haut CBMC iPSC-abgeleitete Organellen wurden funktional differenziert, effizient aufgepfropft Mäuse und Mäuse Hautdefekte wirksam geheilt.

Figure 1
Abbildung 1 : Differenzierung der Keratinozyten der CBMC iPSCs. (A) Regelung der Keratinozyten Differenzierung von CBMC iPSCs. (B und C) Morphologie der CBMC-iPSCs (Gruppe B) und iPSC-abgeleitete EBs (Gruppe C). (D) Morphologie der Keratinozyten CBMC iPSC abgeleitet. (E) Immunocytochemical Analyse der Np63 (rot) und KRT14 (grün), zusammen mit DAPI-Färbung (blau). Der Maßstabsbalken = 100 μm. (F) gen-Expression der pluripotenten Marker und Keratinozyten Marker der iPSC-abgeleitete Keratinozyten (iPSC-Ks). Die Diagramme zeigen den Mittelwert mit SEM der fünf unabhängige Stichproben. Unterschiede zwischen den Gruppen wurden untersucht, für die statistische Signifikanz mit Student t-test. T-Test wurde angewandt, um analysieren nichtparametrische quantitative Datasets und der einseitigen p-Wert berechnet wurde (*p < 0,05, **p < 0,01 ***p < 0,001 angegeben statistischen Signifikanz). Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 2
Abbildung 2 : Fibroblast Differenzierung der CBMC iPSCs. (A) Regelung der Fibroblasten Differenzierung von CBMC iPSCs. (B und C) Morphologie der CBMC-iPSCs (Gruppe B) und iPSC-abgeleitete EBs (Gruppe C). (D) Morphologie der Fibroblasten CBMC iPSC abgeleitet. (E) Immunocytochemical Analyse von Vimentin (rot) und Fibronektin (rot), zusammen mit DAPI-Färbung (blau). Der Maßstabsbalken = 100 μm. (F) gen-Expression der pluripotenten Marker und Fibroblasten Marker der iPSC-abgeleitete Fibroblasten (iPSC-Fs). Die Diagramme zeigen den Mittelwert mit SEM der fünf unabhängige Stichproben. Unterschiede zwischen den Gruppen wurden untersucht, für die statistische Signifikanz mit Student t-test. T-Test wurde angewandt, um analysieren nichtparametrische quantitative Datasets und der einseitigen p-Wert berechnet wurde (*p < 0,05, **p < 0,01 ***p < 0,001 angegeben statistischen Signifikanz). Bitte klicken Sie hier für eine größere Version dieser Figur.

Figure 3
Abbildung 3 : Generation CBMC-iPSC-derived Haut organoide und humanisierten Mäuse Modell. (A) schematische Darstellung der Generierung iPSC-abgeleitete Haut organoide (iSO). (B) Transplantation Prozess der iSO in Mäuse. (C) histologische Analyse der in-vitro-iSO. (D) histologische Analyse der transplantierten iSO in-vivo. (E-H) Immunocytochemical Analyse der Loricrin und KRT14. MOCK transplantierten iSO (Panel F, Loricrin), Mäusen Haut (Negativkontrolle, Panel G), Kontrolle (Gruppe E), transplantierten iSO (Tafel H, KRT14). Der Maßstabsbalken = 200 μm. Bitte klicken Sie hier für eine größere Version dieser Figur.

Supplementary Figure 1
Ergänzende Abbildung 1: Morphologie der iPSC-abgeleitete Keratinozyten. Bitte klicken Sie hier für eine größere Version dieser Figur.

Supplementary Figure 2
Ergänzende Abbildung 2: Morphologie der iPSC-abgeleitete Fibroblasten. Bitte klicken Sie hier für eine größere Version dieser Figur.

Zielname Richtung Primer Sequenz (5' - 3') Größe (Basenpaare) Refseq_ID
OCT4 vorwärts
Rückwärts
ACCCCTGGTGCCGTGAA
GGCTGAATACCTTCCCAAATA
190 NM_203289.5
PAX6 vorwärts
Rückwärts
GTCCATCTTTGCTTGGGAAA
TAGCCAGGTTGCGAAGAACT
110 NM_000280.4
SOX1 vorwärts
Rückwärts
CACAACTCGGAGATCAGCAA
GGTACTTGTAATCCGGGTGC
133 NM_005986.2
Np63 vorwärts
Rückwärts
GGAAAACAATGCCCAGACTC
GTGGAATACGTCCAGGTGGC
294 NM_001114982.1
KRT5 vorwärts
Rückwärts
ACCGTTCCTGGGTAACAGAGCCAC
GCGGGAGACAGACGGGGTGATG
198 NM_000424.3
KRT14 vorwärts
Rückwärts
GCAGTCATCCAGAGATGTGACC
GGGATCTTCCAGTGGGATCT
181 NM_000526.4
CD44 vorwärts
Rückwärts
AAGGTGGAGCAAACACAACC
AGCTTTTTCTTCTGCCCACA
151 NM_001202556.1
COL1A1 vorwärts
Rückwärts
CCCCTGGAAAGAATGGAGATG
TCCAAACCACTGAAACCTCTG
148 NM_000088.3
COL1A2 vorwärts
Rückwärts
GGATGAGGAGACTGGCAACC
TGCCCTCAGCAACAAGTTCA
77 NM_000089.3
COL3A1 vorwärts
Rückwärts
CGCCCTCCTAATGGTCAAGG
TTCTGAGGACCAGTAGGGCA
161 NM_000090.3
Vimentin vorwärts
Rückwärts
GAGAACTTTGCCGTTGAAGC
TCCAGCAGCTTCCTGTAGGT
170 NM_003380.5
GAPDH vorwärts
Rückwärts
ACCCACTCCTCCACCTTTGA
CTGTTGCTGTAGCCAAATTCGT
110 NM_002046.5

Tabelle 1: Sequenzen der Zündkapseln für quantitative Real-Time Polymerase-Kettenreaktion verwendet.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Menschlichen iPSCs haben als eine neue Alternative für personalisierte regenerative Medizin17vorgeschlagen worden. Personalisierte iPSCs Patienten abgeleitet reflektieren Patienten-Charakteristika, die für die Krankheit Modellierung, Drogen-Screening und autologe Transplantation18,19verwendet werden können. Die Verwendung von Patienten abgeleitet iPSCs kann auch Probleme in Bezug auf primäre Zellen, ein Mangel an ausreichenden Zellzahlen und Immunreaktionen5,17,19überwinden. Die Generation von personalisierten iPSCs ist jedoch nicht wirtschaftlich durch Zeit, Kosten und Arbeit Einschränkungen. HLA-homozygot CBMC abgeleitet iPSCs entstanden als eine neue Möglichkeit. HLA-homozygot iPSCs kann wirtschaftlich wertvoll sein und kann auf eine große Anzahl von Patienten8,11,12,13angewendet werden. Darüber hinaus tritt die HLA-Typisierung der CBMCs während der Zelle Bank Lagerung, wodurch sie einfach zu bedienen für Forschung und Transplantation. Protokolle zu CBMC iPSCs in Herzzellen, Leberzellen und Chondrozyten differenzieren wurden16,20,21,22,23gemeldet.

Epidermalen und dermalen Layer sind Bestandteile der Haut. Die Epidermis besteht aus Keratinozyten und die Dermis besteht aus Fibroblasten. Also, wir differenzierte CBMC iPSCs in Keratinozyten und Fibroblasten, beziehungsweise. Für die Differenzierung, uniformierte, gut kontrollierten und optimierte EBs wurden durch das hà ¤ ngen generiert drop Methode15,24. Typ IV Kollagen ist ein wichtiger Bestandteil der Basalmembran. Zur Differenzierung der Keratinozyten EBs wurden angebracht, um IV Kollagen beschichtet Gerichte geben. CBMC-iPSC-derived Keratinozyten hatte eine Kopfsteinpflaster-ähnliche Morphologie (Abbildung 1D). Keratinozyten Marker Np63 und KRT14 wurden in iPSC-Ks (Abbildung 1E, F) ausgedrückt. Dieses Ergebnis bestätigt, dass RA und BMP4 Hochregulation der Keratinozyten Marker induzierte. Darüber hinaus wurden CBMC iPSCs in Keratinozyten primären Keratinozyten ähnlich differenziert.

Fibroblasten Differenzierung wurden EBs Basalmembran Matrix-beschichteten Platten befestigt und die differenzierte Zellen wurden seriell auf noncoated passagiert und Typ I-Kollagen-beschichteten Platten. Eine serielle Subkultur wurde an Fibroblasten Differenzierung induziert. Fibroblasten produziert eine extrazelluläre Matrix (ECM), die Migration und Adhäsion Funktionen hatte. Fibroblasten produzieren auch reichlich Kollagen Komponenten25. CBMC-iPSC-derived Fibroblasten wurde der Fibroblasten Oberfläche Marker CD44 erhöht. Der Ausdruck des Kollagens war hochreguliert in iPSC-Fs (Abbildung 2F). Der Ausdruck der Fibronektin und Vimentin wurde im iPSC-Fs (Abb. 2E) erhöht.

Mit dem differenzierten Keratinozyten und Fibroblasten, erzielten wir Haut CBMC iPSC-abgeleitete Organellen(Abbildung 3). Wir verwendeten eine Air-Liquid-Schnittstelle-Kultur mit einem hohen Kalzium-Medium, die geschichtete Schichten der Haut CBMC iPSC-abgeleitete Organellen induziert. Die hohe Konzentration von Kalzium war notwendig für die Reifung der Keratinozyten in vivo und in vitro während die Luft-Flüssigkeit-Schnittstelle verwendet wurde, um mehrschichtige Schichten26,27,28zu entwickeln. Wir haben diese Methode imitieren echte Haut und histologische Analysen zeigten, dass die Haut geschichtet war (Abb. 3C). Um die Wundheilung Fähigkeit zu bestätigen, transplantiert wir die iSO in Mäusen Haut, mit der Krawatte über Dressing-Methode (Abbildung 3D). Nach der Transplantation die Haut Organellen wurden effizient gepfropft und die Mäuse Haut ausreichend geheilt. KRT14 wurde in der basalen Schicht der stratifiziert Plattenepithelkarzinom und nonsquamous Epithelien exprimiert. Loricrin ist ein Hauptbestandteil des Stratum corneums gefunden unheilbar differenziert und keratinized Epithelzellen29,30. Die epidermalen Differenzierung Markierung der Loricrin äußerte transplantierten Haut. Der Ausdruck von KRT14 und Loricrin bestätigt, dass die Haut organoide voll ausgereift war und Differenzierung zeigte sich durch immunhistochemische Färbung (Abbildung 3E).

In dieser Studie entwickelten wir ein Protokoll zur CBMC iPSCs in Keratinozyten und Fibroblasten, die wichtigsten Zelltypen der menschlichen Haut zu unterscheiden. Wir bestätigen, dass CBMC-iPSC-derived Keratinozyten und Fibroblasten Phänotypen ähnlich Primärzelle Linien zeigten. Mit dieser differenzierten Zellen, wir erzeugt eine 3D Haut organoide und veredelt es in NOD/scid-Mäuse mit der Krawatte über Dressing-Methode. Dieses ursprüngliche Verfahren wurde erstmals im Jahre 1929 von Blair und Brown beschrieben und hat üblicherweise für Hauttransplantationen31,32. Diese Methode verhindert, dass das Transplantat bewegen, begünstigt eine gute Haftung an der Wunde und somit beschleunigt die Heilung des Gewebes. Histologischen Untersuchung bestätigt, dass die 3D Haut organoide einen menschlichen Haut Phänotyp nachgeahmt, die erfolgreich geschichtet und über 2 Wochen gereift. Hauttransplantationen erfolgt in der Regel mit Einzelzellen von Keratinozyten und Fibroblasten durch Silizium Blasenkammer33,34. Dieses System ist einfach zu verpflanzen, aber wir brauchten mehr Zeit für zur Transplantation Effizienz nach Transplantation beobachtet. Die Kunststoff oder Silikon Kammer dient als Barriere gegen die Mäuse Haut. Die 3D Haut organoide System abgeleitet iPSCs verwenden keine Kunststoff oder Silikon Kammer. In diesem System war die Transplantation effizient; jedoch war es schwierig, den natürlichen Heilungsprozess von Mäusen zu blockieren. So, die Mäuse Haut bedeckt viele Teile der iSO für eine lange Zeit nach der Transplantation. Dies ist ein Teil der hier vorgestellten Methode, die verbessert werden muss.

Im Ergebnis sind CBMC iPSCs potentielle Zelle Quelle für Hauttransplantationen. Mit diesen Protokollen, CBMC-iPSC-derived Keratinozyten, Fibroblasten und eine 3D Haut organoide können in Studien in den Bereichen Dermatologie, Droge und kosmetische Screening und regenerative Medizin verwendet werden.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts preisgeben.

Acknowledgments

Diese Arbeit wurde durch einen Zuschuss aus Korea Healthcare Technology R & D Projekt, Ministerium für Gesundheit, Wohlfahrt und Familienangelegenheiten, Republik Korea (H16C2177, H18C1178) unterstützt.

Materials

Name Company Catalog Number Comments
Adenine Sigma A2786 Component of differentiation medium for fibroblast
AggreWell Medium (EB formation medium) STEMCELL 05893 EB formation
Anti-Fibronectin antibody abcam ab23750 Fibroblast marker
Anti-KRT14 antibody abcam ab7800 Keratinocyte marker
Anti-Loricrin antibody abcam ab85679 Stratum corneum marker
Anti-p63 antibody abcam ab124762 Keratinocyte marker
Anti-Vimentin antibody Santa cruz sc-7558 Fibroblast marker
BAND AID FLEXIBLE FABRIC Johnson & Johnson - Bandage
Basement membrane matrix (Matrigel) BD 354277 Component of differentiation medium for fibroblast
BLACK SILK suture AILEEE SK617 Skin graft
CaCl2 Sigma C5670 Component of epithelial medium for 3D skin organoid
Collagen type I BD 354236 3D skin organoid
Collagen type IV Santa-cruz sc-29010 Component of differentiation medium for keratinocyte
Defined keratinocyte-Serum Free Medium Gibco 10744-019 Component of differentiation medium for keratinocyte
DMEM, high glucose Gibco 11995065 Component of differentiation medium
DMEM/F12 Medium Gibco 11330-032 Component of differentiation medium
Essential 8 medium Gibco A1517001 iPSC medium
FBS, Qualified Corning 35-015-CV Component of differentiation medium for fibroblast and keratinocyte
Glutamax Supplement  Gibco 35050061 Component of differentiation medium for fibroblast
Insulin Invtrogen 12585-014 Component of differentiation medium for fibroblast and keratinocyte
Iris standard curved scissor Professional PC-02.10 Surgical instrument
Keratinocyte Serum Free Medium Gibco 17005-042 Component of differentiation medium for keratinocyte
L-ascorbic acid 2-phosphata sesquimagnesium salt hydrate Sigma A8960 Component of differentiation medium for keratinocyte
MEM Non-Essential Amino Acid Gibco 1140050 Component of differentiation medium for fibroblast
Meriam Forceps Thumb 16 cm HIROSE HC 2265-1 Surgical instrument
NOD.CB17-Prkdc SCID/J The Jackson Laboratory 001303 Mice strain for skin graft
Petri dish 90 mm Hyundai Micro H10090 Plastic ware
Recombinant Human BMP-4 R&D 314-BP Component of differentiation medium for keratinocyte
Recombinant human EGF protein R&D 236-EG Component of differentiation medium for keratinocyte
Retinoic acid Sigma R2625 Component of differentiation medium for keratinocyte
T/C Petridish 100 mm, 240/bx TPP 93100 Plastic ware
Transferrin Sigma T3705 Component of epithelial medium for 3D skin organoid
Transwell-COL collagen-coated membrane inserts  Corning CLS3492 Plastic ware for 3D skin organoid 
Vitronectin Life technologies A14700 iPSC culture
Y-27632 Dihydrochloride peprotech 1293823 iPSC culture

DOWNLOAD MATERIALS LIST

References

  1. Vincent, J. F., Bogatyreva, O. A., Bogatyrev, N. R., Bowyer, A., Pahl, A. K. Biomimetics: its practice and theory. Journal of The Royal Society Interface. 3, (9), 471-482 (2006).
  2. Madison, K. C. Barrier function of the skin: "la raison d'etre" of the epidermis. Journal of Investigative Dermatology. 121, (2), 231-241 (2003).
  3. Chen, M., Przyborowski, M., Berthiaume, F. Stem cells for skin tissue engineering and wound healing. Critical Reviews in Biomedical Engineering. 37, (4-5), 399-421 (2009).
  4. Dixit, S., et al. Immunological challenges associated with artificial skin grafts: available solutions and stem cells in future design of synthetic skin. Journal of Biological Engineering. 11, 49 (2017).
  5. Yamanaka, S. Induced pluripotent stem cells: past, present, and future. Cell Stem Cell. 10, (6), 678-684 (2012).
  6. Yamanaka, S. Pluripotency and nuclear reprogramming. Philosophical Transactions of the Royal Society B: Biological Sciences. 363, (1500), 2079-2087 (2008).
  7. Scheiner, Z. S., Talib, S., Feigal, E. G. The potential for immunogenicity of autologous induced pluripotent stem cell-derived therapies. Journal of Biological Chemistry. 289, (8), 4571-4577 (2014).
  8. Zimmermann, A., Preynat-Seauve, O., Tiercy, J. M., Krause, K. H., Villard, J. Haplotype-based banking of human pluripotent stem cells for transplantation: potential and limitations. Stem Cells and Development. 21, (13), 2364-2373 (2012).
  9. Takahashi, K., Yamanaka, S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126, (4), 663-676 (2006).
  10. Terasaki, P. I. A brief history of HLA. Immunologic Research. 38, (1-3), 139-148 (2007).
  11. Haase, A., et al. Generation of induced pluripotent stem cells from human cord blood. Cell Stem Cell. 5, (4), 434-441 (2009).
  12. Rim, Y. A., et al. Recent progress of national banking project on homozygous HLA-typed induced pluripotent stem cells in South Korea. Journal of Tissue Engineering and Regenerative Medicine. 12, (3), 1531-1536 (2018).
  13. Nakatsuji, N., Nakajima, F., Tokunaga, K. HLA-haplotype banking and iPS cells. Nature Biotechnology. 26, (7), 739-740 (2008).
  14. Pappas, D. J., et al. Proceedings: human leukocyte antigen haplo-homozygous induced pluripotent stem cell haplobank modeled after the california population: evaluating matching in a multiethnic and admixed population. Stem Cells Translational Medicine. 4, (5), 413-418 (2015).
  15. Lin, Y., Chen, G. Embryoid body formation from human pluripotent stem cells in chemically defined E8 media. StemBook. Available from: https://www.stembook.org/node/6632 (2008).
  16. Kim, Y., et al. Establishment of a complex skin structure via layered co-culture of keratinocytes and fibroblasts derived from induced pluripotent stem cells. Stem Cell Research & Therapy. 9, (1), 217 (2018).
  17. Diecke, S., Jung, S. M., Lee, J., Ju, J. H. Recent technological updates and clinical applications of induced pluripotent stem cells. The Korean Journal of Internal Medicine. 29, (5), 547-557 (2014).
  18. Shi, Y., Inoue, H., Wu, J. C., Yamanaka, S. Induced pluripotent stem cell technology: a decade of progress. Nature Reviews Drug Discovery. 16, (2), 115-130 (2017).
  19. Yoshida, Y., Yamanaka, S. Recent stem cell advances: induced pluripotent stem cells for disease modeling and stem cell-based regeneration. Circulation. 122, (1), 80-87 (2010).
  20. Pham, T. L., Nguyen, T. T., Van Bui, A., Nguyen, M. T., Van Pham, P. Fetal heart extract facilitates the differentiation of human umbilical cord blood-derived mesenchymal stem cells into heart muscle precursor cells. Cytotechnology. 68, (4), 645-658 (2016).
  21. Stecklum, M., et al. Cell differentiation mediated by co-culture of human umbilical cord blood stem cells with murine hepatic cells. In Vitro Cellular & Developmental Biology - Animal. 51, (2), 183-191 (2015).
  22. Nam, Y., Rim, Y. A., Ju, J. H. Chondrogenic Pellet Formation from Cord Blood-derived Induced Pluripotent Stem Cells. Journal of Visualized Experiments. (124), e55988 (2017).
  23. Rim, Y. A., Nam, Y., Ju, J. H. Application of Cord Blood and Cord Blood-derived Induced Pluripotent Stem Cells for Cartilage Regeneration. Cell Transplantation. (2018).
  24. Shevde, N. K., Mael, A. A. Techniques in embryoid body formation from human pluripotent stem cells. Methods in Molecular Biology. 946, 535-546 (2013).
  25. Shamis, Y., et al. iPSC-derived fibroblasts demonstrate augmented production and assembly of extracellular matrix proteins. In Vitro Cellular & Developmental Biology - Animal. 48, (2), 112-122 (2012).
  26. Bikle, D. D., Xie, Z., Tu, C. L. Calcium regulation of keratinocyte differentiation. Expert Review of Endocrinology & Metabolism. 7, (4), 461-472 (2012).
  27. Bernstam, L. I., Vaughan, F. L., Bernstein, I. A. Keratinocytes grown at the air-liquid interface. In Vitro Cellular & Developmental Biology. 22, (12), 695-705 (1986).
  28. Prunieras, M., Regnier, M., Woodley, D. Methods for cultivation of keratinocytes with an air-liquid interface. Journal of Investigative Dermatology. 81, 1 Suppl 28-33 (1983).
  29. Steven, A. C., Bisher, M. E., Roop, D. R., Steinert, P. M. Biosynthetic pathways of filaggrin and loricrin--two major proteins expressed by terminally differentiated epidermal keratinocytes. Journal of Structural Biology. 104, (1-3), 150-162 (1990).
  30. Hohl, D., et al. Characterization of human loricrin. Structure and function of a new class of epidermal cell envelope proteins. Journal of Biological Chemistry. 266, (10), 6626-6636 (1991).
  31. Bern, R., et al. Original and modified technique of tie-over dressing: Method and application in burn patients. Burns. 44, (5), 1357-1360 (2018).
  32. Joyce, C. W., Joyce, K. M., Kennedy, A. M., Kelly, J. L. The Running Barbed Tie-over Dressing. Plastic and Reconstructive Surgery - Global Open. 2, (4), 137 (2014).
  33. Wang, C. K., Nelson, C. F., Brinkman, A. M., Miller, A. C., Hoeffler, W. K. Spontaneous cell sorting of fibroblasts and keratinocytes creates an organotypic human skin equivalent. Journal of Investigative Dermatology. 114, (4), 674-680 (2000).
  34. Yang, R., et al. Generation of folliculogenic human epithelial stem cells from induced pluripotent stem cells. Nature Communications. 5, 3071 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics