स्टेम सेल व्युत्पन्न वायरल एजी-विशिष्ट टी लिम्फोसाइट्स चूहे में एचबीवी प्रतिकृति को दबा

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

यहाँ प्रस्तुत स्टेम सेल व्युत्पन्न वायरल प्रतिजन (एजी) विशेष टी लिम्फोसाइटों के दत्तक कोशिका हस्तांतरण (ACT) का उपयोग करके चूहों में हेपेटाइटिस बी वायरस (एचबीवी) प्रतिकृति के प्रभावी दमन के लिए एक प्रोटोकॉल है। इस प्रक्रिया को एचबीवी संक्रमण के संभावित अधिनियम-आधारित इम्यूनोथेरेपी के लिए अनुकूलित किया जा सकता है।

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Xiong, X., Lei, F., Haque, M., Song, J. Stem Cell-Derived Viral Ag-Specific T Lymphocytes Suppress HBV Replication in Mice. J. Vis. Exp. (151), e60043, doi:10.3791/60043 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

हेपेटाइटिस बी वायरस (एचबीवी) संक्रमण एक वैश्विक स्वास्थ्य मुद्दा है। दुनिया भर में 350 मिलियन से अधिक लोगों को प्रभावित करने के साथ, एचबीवी संक्रमण यकृत कैंसर का प्रमुख कारण बना हुआ है। यह विशेष रूप से विकासशील देशों में एक प्रमुख चिंता का विषय है। एचबीवी के खिलाफ एक प्रभावी प्रतिक्रिया माउंट करने के लिए प्रतिरक्षा प्रणाली की विफलता पुरानी संक्रमण की ओर जाता है। यद्यपि एचबीवी टीका मौजूद है और नवीन एंटीवायरल दवाएं बनाई जा रही हैं, फिर भी वायरस-आरक्षण कोशिकाओं का उन्मूलन एक प्रमुख स्वास्थ्य विषय बना हुआ है। यहाँ वर्णित वायरल प्रतिजन (एजी) की पीढ़ी के लिए एक विधि है -विशिष्ट CD8+ cytotoxic टी लिम्फोसाइटों (CTLs) प्रेरित pluripotent स्टेम सेल (iPSCs) (यानी, iPSC-CTLs) से व्युत्पन्न, जो एचबीवी प्रतिकृति को दबाने की क्षमता है. एचबीवी प्रतिकृति कुशलतापूर्वक जिगर में एक एचबीवी अभिव्यक्ति प्लाज्मिड, पावएवी/एचबीवी1.2 के हाइड्रोडायनामिक इंजेक्शन के माध्यम से चूहों में प्रेरित किया जाता है। फिर, एचबीवी सतह एजी-विशिष्ट माउस आईपीएससी-सीटीएल को दत्तक रूप से स्थानांतरित किया जाता है, जो यकृत और रक्त में एचबीवी प्रतिकृति को बहुत दबाता है और साथ ही हेप्टोसाइट्स में एचबीवी सतह एजी अभिव्यक्ति को रोकता है। यह विधि हाइड्रोडायनामिक इंजेक्शन के बाद चूहों में एचबीवी प्रतिकृति को प्रदर्शित करती है और स्टेम सेल व्युत्पन्न वायरल एजी-विशिष्ट CTLs एचबीवी प्रतिकृति को रोक सकते हैं। यह प्रोटोकॉल एचबीवी इम्यूनोथेरेपी के लिए एक उपयोगी तरीका प्रदान करता है।

Introduction

तीव्र संक्रमण के बाद, अनुकूली प्रतिरक्षा प्रणाली (यानी, हास्य और सेलुलर प्रतिरक्षा) तीव्र एचबीवी से संबंधित हेपेटाइटिस के थोक को नियंत्रित करती है। फिर भी, एचबीवी-एंटोइनल क्षेत्रों में कई लोग वायरस को खत्म नहीं कर सकते हैं और बाद में पुराने व्यक्तियों के रूप में परिवर्तित नहीं कर सकते हैं। दुनिया भर में 25% से अधिक पुराने रोगियों (gt; 250 मिलियन लोग) प्रगतिशील यकृत रोग विकसित करते हैं, जिसके परिणामस्वरूप लीवर सिरोसिस और/या हेपेटोकोशिकीय कार्सिनोमा (एचसीसी)1होता है। नतीजतन, आग्रहपूर्ण रूप से संक्रमित कोशिकाओं का उन्मूलन एक सामान्य स्वास्थ्य समस्या बनी हुई है, भले ही वहाँ एक उपलब्ध टीका2 और कई एंटीवायरल दवाएं विकास के अधीन हैं। एचबीवी संक्रमण के लिए मानक उपचार में आईएफएन-जेड, न्यूक्लिओसाइड और न्यूक्लिओटाइड एनालॉग शामिल हैं। इन एजेंटों प्रत्यक्ष एंटीवायरल गतिविधि और प्रतिरक्षा आमध्यस्थ क्षमता है. फिर भी, एचबी एंटीजन (एजी)+ विरोधी एचबीएंटी (एबी) के साथ वाहक और सीरम एचबीवी deoxyribonucleic एसिड (डीएनए) की हानि इलाज रोगियों के लगभग 20% में व्यक्तिगत रूप से दिखाई देते हैं, और वायरस के पूरे प्रतिरक्षा नियंत्रण HBsAg के अभाव से सत्यापित 5%3से अधिक नहीं है . इसके अलावा, उपचार के लिए प्रतिक्रिया अक्सर टिकाऊ नहीं है. रिकॉमबिनेंट HBs एजी के साथ रोगनिरोधी टीकाकरण संक्रमण को रोकने में अत्यधिक प्रभावी है, लेकिन चिकित्सीय HBs एजी टीकाकरण प्रभावी नहीं है। जाहिर है, टी सेल मध्यस्थता प्रतिरक्षा प्रतिक्रियाओं एचबीवी संक्रमण और जिगर हानि को नियंत्रित करने में एक महत्वपूर्ण भूमिका निभाते हैं; हालांकि, क्रोनिक हेपेटाइटिस रोगियों में, एचबीवी-रिएक्टिव टी कोशिकाओं को अक्सर नष्ट कर दिया जाता है, बेकार, या समाप्त4,5,6 परिवर्तित कर दिया जाताहै। नतीजतन, लगातार एचबीवी संक्रमण वाले व्यक्तियों में, एंटी-वायरल उपचार, इम्यूनो-मॉडुलन साइटोकिन्स, या उपचारात्मक प्रतिरक्षण के माध्यम से एचबीवी-विशिष्ट प्रतिरक्षा (यानी, टी सेल-आधारित प्रतिरक्षा) को बहाल करने का कोई प्रयास नहीं है।

एचबीवी एजी-विशिष्ट टी कोशिकाओं के दत्तक कोशिका स्थानांतरण (ACT) एक कुशल उपचार अंततः शेष hepatocytes wih HBV7,8उन्मूलन करने के लिए निर्देशित है। एचबीवी-संक्रमित चूहों में एचबीवी-विशिष्ट सीटीएल के अधिनियम को क्षणिक, हल्के हेपेटाइटिस, और हेपाटोसाइट्स में एचबीवी राइबोनुक्लिइक एसिड (आरएनए) ट्रांसक्रिप्ट्स में नाटकीय गिरावट का कारण दिखाया गया है। इन अध्ययनों में, सीटीएल ने एचबीवी जीनों के प्रतिलेखन को बाधित नहीं किया बल्कि एचबीवी लिपियों9की गिरावट को बढ़ाया। वायरल संक्रमण को रोकने और एचबीवी10,11की निकासी में मध्यस्थता करने के लिए एचबीवी-विशिष्ट सीटीएल महत्वपूर्ण हैं। अधिनियम-आधारित उपचारों के लिए, विवो पुनर्वास में उच्च अभिक्रियाशीलता वाले एचबीवी-विशिष्ट टी कोशिकाओं के विट्रो विस्तार में एक आदर्श विधि12,13,14होने का सुझाव दिया गया है; फिर भी, वर्तमान दृष्टिकोण उत्पन्न करने के लिए अपनी क्षमताओं के बारे में प्रतिबंधित कर रहे हैं, अलग, और संभावित चिकित्सा के लिए रोगियों से एचबीवी-विशिष्ट टी कोशिकाओं के उचित मात्रा और गुणों को विकसित.

हालांकि नैदानिक परीक्षण वर्तमान सुरक्षा, व्यावहारिकता, और इंजीनियर टी कोशिकाओं है कि एचबीवी वायरस संक्रमित hepatocytes के लिए विशिष्ट हैं के माध्यम से सेल आधारित उपचार के संभावित चिकित्सीय गतिविधि, वहाँ प्रतिकूल प्रभाव के बारे में चिंता कर रहे हैं mispairing टी सेल रिसेप्टर से पार प्रतिक्रिया की वजह से autoimmune प्रतिक्रियाओं से होने वाली (TCR)15,16,गैर-विशिष्ट TCR द्वारा बंद लक्ष्य एजी मान्यता17 और पर लक्ष्य बंद विषाक्तता द्वारा एक झंकार एजी रिसेप्टर (सीएआर) 18 , 19 स्वस्थ ऊतकों के साथ. वर्तमान में, आनुवंशिक रूप से संशोधित टी कोशिकाओं, जो केवल विवो में अल्पकालिक हठ है, आमतौर पर मध्यवर्ती या बाद में प्रभावक टी कोशिकाओं रहे हैं. तारीख करने के लिए, pluripotent स्टेम सेल (PSCs) केवल भोले एकल प्रकार एजी विशिष्ट टी कोशिकाओं20,21,22,23की उच्च संख्या उत्पन्न करने के लिए उपलब्ध स्रोत हैं. प्रेरित पीएससी (iPSCs) बस कई प्रतिलेखन कारकों के जीन transduction के उपयोग के माध्यम से एक रोगी की दैहिक कोशिकाओं से बदल रहे हैं. परिणामस्वरूप, आई पी एस सी की लक्षणात् वरीय लक्षणे भ्रूणीय स्टेम कोशिकाओं (ईएससी) 24 के समान होतीहैं। लचीलापन और स्वयं को नवीनीकृत करने के लिए अनंत क्षमता के लिए संभावना के कारण, ऊतक प्रतिस्थापन के अलावा, iPSC आधारित उपचार व्यापक रूप से पुनर्योजी चिकित्सा में लागू किया जा सकता है. इसके अलावा, iPSCs अंतर्निहित रेजिमेंटों काफी वर्तमान सेल आधारित उपचार में सुधार हो सकता है.

इस विधि का समग्र लक्ष्य ACT-आधारित इम्यूनोथेरेपी के लिए आईपीएससी (यानी, आईपीएससी-सीटीएल) से एचबीवी-विशिष्ट सीटीएल की एक बड़ी राशि उत्पन्न करना है। वैकल्पिक तकनीकों पर लाभ यह है कि एचबीवी-विशिष्ट iPSC-CTLs एक एकल प्रकार TCR और भोले phenotype है, जो अधिनियम के बाद और अधिक स्मृति टी सेल विकास में परिणाम है. यह दिखा दिया है कि एचबीवी-विशिष्ट iPSC-CTLs के अधिनियम जिगर में कार्यात्मक CD8+ टी कोशिकाओं के प्रवास बढ़ जाती है और दोनों जिगर और प्रशासित चूहों के रक्त में एचबीवी प्रतिकृति कम कर देता है। इस विधि से एचबीवी इम्यूनोथेरेपी के लिए वायरल एजी-विशिष्ट आईपीएससी-सीटीएल के संभावित उपयोग का पता चलता है और वायरल इम्यूनोथेरेपी के लिए अन्य वायरल एजी-विशिष्ट आईपीएससी-टी कोशिकाओं को उत्पन्न करने के लिए अनुकूलित किया जा सकता है।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

सभी पशु प्रयोगों टेक्सास ए एंड एम विश्वविद्यालय पशु देखभाल समिति (IACUC और #2018-0006) द्वारा अनुमोदित कर रहे हैं और मूल्यांकन और प्रयोगशाला पशु देखभाल के प्रत्यायन के लिए एसोसिएशन के दिशा निर्देशों के अनुपालन में आयोजित कर रहे हैं. चूहे उम्र के 6-9 सप्ताह के दौरान उपयोग किया जाता है.

1. iPSCs से वायरल एजी-विशिष्ट CD8+ टी कोशिकाओं की पीढ़ी (iPSC-CD8+ टी कोशिकाओं)

  1. रेट्रोवायरल निर्माण का निर्माण
    NOTE: TCR और जेड जीन 2A स्व-claving अनुक्रम के साथ जुड़े हुए हैं। रेट्रोवायरल वेक्टर एमएससीवी-आईआरईआरएस-डीएसडी (एमआईडीआर) डीएसरेड+ 23है।
    1. उप-क्लोन HBs183-191 (FLLTRILTI)-विशिष्ट A2-प्रतिबंधित मानव-मौरी संकर TCR (s183 TCR) जीन (V$34 और V$28) MiDR में s183 MiDR निर्माण बनाने के लिए (चित्र 1)25.
  2. रेट्रोवायरल ट्रांसडक्शन
    नोट: प्लेटिनम-ई (प्लेट-ई) कोशिकाओं का उपयोग रेट्रोवायरस (s183 टीसीआर जीन ले जाने) के लिए किया जाता है, जिसका उपयोग रेट्रोवायरल ट्रांसडक्शन के लिए किया जाएगा। प्लेट-ई कोशिकाओं को 293T कोशिकाओं के अंतर्निहित एक प्रभावी रेट्रोवायरस पैकेजिंग कोशिकाओं, जो EF1 के माध्यम से अद्वितीय पैकेजिंग निर्माण के माध्यम से विकसित किए गए थे , retroviral संरचना प्रोटीन व्यक्त करने के लिए, गैग, पोल, और ecotropic env सहित.
    1. एक 100 मिमी संस्कृति पकवान पर, बीज 3 x 106 प्लेट-ई कोशिकाओं DMEM संस्कृति माध्यम के 8 एमएल में 10% भ्रूण बछड़ा सीरम (एफसीएस) एक इनक्यूबेटर में 37 डिग्री सेल्सियस के साथ 5% सीओ2, 1 दिन transfection से पहले.
    2. 0 दिन, s183 MiDR एक डीएनए transfection अभिकर्मक25का उपयोग कर प्लेट-ई कोशिकाओं में निर्माण transfect.
    3. 1 दिन, बीज 1 x 106 iPSCs (GFP+) एक जिलेटिन पूर्व लेपित संस्कृति प्लेट में.
    4. दिन 2-3 पर, 1,6-dibromohexane समाधान25की उपस्थिति में s183 TCR के साथ iPSCs ट्रांसड्यूस करने के लिए प्लेट-ई सेल संस्कृति से retroviruses युक्त supernatant इकट्ठा .
    5. 4 दिन, s183 TCR जीन-transduced iPSCs, 5 मिनट और बीज के लिए 400 x ग्राम पर सेंट्रीफ्यूज 3 $ 105 iPSCs एक 100 मिमी संस्कृति पकवान पूर्व के साथ लेपित 3 x 106 विकिरणित SNL76/7 (irSNL76/7) सेल फीडर25.
    6. संगम के 5 या 6 दिन पर, कोशिकाओं को trypsinize, 5 मिनट के लिए 400 x ग्राम पर अपकेंद्रण और सेल छँटाई के लिए प्रक्रिया. लाइव कोशिकाओं पर गैटिंग, एक उच्च गति सेल सॉर्टर का उपयोग कर GFP और DsRED डबल सकारात्मक कोशिकाओं ( s183 TCR जीन-transduced iPSCs) सॉर्ट करें। कदम 1.2.5 के समान, सह संस्कृति भविष्य के उपयोग के लिए irSNL76/7 फीडर कोशिकाओं पर हल कोशिकाओं25.
  3. एचबीवी-विशिष्ट iPSC-CD8+ टी कोशिकाओं का भेदभाव
    नोट: OP9-DL1/DL4 stromal कोशिकाओं दोनों पायदान ligands DL1 और DL4 overexpress, और iPSCs के साथ सह-पुलिंग iPSCs पायदान संकेतन मध्यस्थता टी सेल भेदभाव26को बढ़ावा कर सकते हैं.
    1. वृद्धि s183 TCR जीन-transduced iPSCs (s183/iPSCs) OP9-DL1-DL4 सेल monolayer में $-न्यूनतम आवश्यक माध्यम (एमईएम) मीडिया जिसमें 20% भ्रूण गोजातीय सीरम (FBS)27. संस्कृति में murine Flt3 लिगन्ड (mFlt-3L; अंतिम सांद्रता ] 5 एनजी/एमएल) शामिल करें।
    2. 0 दिन, बीज 0.5-1.0 x 105 S183/iPSCs एक 10 सेमी संस्कृति पकवान में पहले OP9-DL1-DL4 कोशिकाओं के साथ बड़े हो. सत्यापित करें कि OP9-DL1-DL4 कोशिकाओं की स्थिति में हैं 80%-90% संगम.
    3. 5 दिन, आईपीएससी को 10 एमएल फॉस्फेट-बफर्ड नमकीन (पीबीएस) के साथ कुल्ला करें, पीबीएस से aspirate, इसे 0.25% ट्रिप्सिन के 4 एमएल में जोड़ें, और 10 मिनट के लिए 37 डिग्री सेल्सियस इन्क्यूबेटर में इनक्यूबेट करें। इसके बाद, आईपीएससी मीडिया का एक अनुपूरक 8 एमएल जोड़ें। 15-30 डिग्री सेल्सियस पर 5 मिनट के लिए 400 x ग्राम पर कोशिकाओं और अपकेंद्रित्र युक्त सभी पाचन समाधान संचित करें।
    4. आईपीएससी मीडिया के 10 एमएल में सुपरनेंट को प्रेरित करें और कोशिकाओं को फिर से शुरू करें। सेल निलंबन को एक नई 10 सेमी पेट्री प्लेट में स्थानांतरित करें और 37 डिग्री सेल्सियस पर 30 मिनट के लिए एक इनक्यूबेटर में इनक्यूबेट करें।
    5. 30 मिनट के बाद, अस्थायी कोशिकाओं वाले iPSC मीडिया इकट्ठा. 70 डिग्री सेल छलनी के माध्यम से सेल निलंबन पास और सेल संख्या की गणना.
    6. बीज 5 x 105 कोशिकाओं संस्कृति पकवान में पहले से हो गया OP9-DL1-DL4 कोशिकाओं 80% की एक शर्त के साथ -90% confluent के रूप में कदम 1.3.1 में वर्णित.
      नोट: टी सेल भेदभाव के लिए, प्रत्येक 2-3 दिनों, iPSC व्युत्पन्न कोशिकाओं OP9-DL1-DL4 कोशिकाओं की एक ताजा परत के साथ फिर से बीज की जरूरत है.
  4. मूल्यांकन
    1. आइपीएससी के भिन्न परिवर्तन
      1. विभिन्न दिनों पर एक माइक्रोस्कोप के तहत कोशिकाओं का निरीक्षण करें।
        नोट: 5 दिन तक, कालोनियों में मध्यमार्ग जैसी विशेषताएं होती हैं, मानव चर्मफाइब्रोब्लास्ट्स और इन विट्रो में निरंतर वृद्धि जैसी क्लासिक धुरी-आकार की आकृति विज्ञान का प्रदर्शन। 8 दिन तक, कोशिकाओं के छोटे गोल समूहों को प्रकट करने के लिए शुरू करते हैं।
    2. प्रवाह साइटोमेट्री द्वारा आइपीएससी के अंतर का विश्लेषण
      1. सह-संस्कृति के विभिन्न दिनों पर, iPSC व्युत्पन्न कोशिकाओं का विश्लेषण करें जैसा कि पहले25 वर्णित किया गया है (चित्र 1B,C)।
    3. अलग iPSCs के कार्यात्मक विश्लेषण
      1. 28 के दिन सह-संस्कृति, अस्थायी कोशिकाओं की कटाई के माध्यम से संस्कृतियों से iPSC-CD8+ टी कोशिकाओं को इकट्ठा, 0.25% trypsin के साथ बचे हुए कोशिकाओं trypsinize, iPSC मीडिया के 8 एमएल में फिर से निलंबित, 5 मिनट के लिए सेंट्रीफ्यूज 15-30 डिग्री सेल्सियस पर 400 x g पर, मीडिया को हटा दें, फिर मीडिया के 10 एमएल में कोशिकाओं को फिर से निलंबित करें।
      2. 30 मिनट के लिए एक 37 डिग्री सेल्सियस इनक्यूबेटर में एक ताजा 10 सेमी पकवान में फिर से निलंबित कोशिकाओं रखें और अस्थायी कोशिकाओं को इकट्ठा। फिर कोशिकाओं को एक बार ठंडे पीबीएस से धोलें।
      3. इनक्यूबेट 3 x 106 टी सेल-depleted स्प्लेनोसाइट्स (CD4-CD8- )एच -2 वर्ग मैं नॉकआउट की तिल्ली से, HLA-A2.1-transgenic (HHD) चूहों के साथ 5 $M s183 पेप्टाइड (FLLTRILTI) 30 मिनट के लिए 4 डिग्री सेल्सियस पर मीडिया के 200 जेडएल में।
      4. iPSC-CD8+ S183 पेप्टाइड के साथ स्पंदित स्प्लेनोसाइट्स के साथ टी कोशिकाओं का एक मिश्रण का उत्पादन (टी कोशिकाओं: splenocytes ] 1:4; का उपयोग करें 0.75 x 106 टी कोशिकाओं). 40 ज के लिए एक सीओ2 इनक्यूबेटर में 37 डिग्री सेल्सियस पर कोशिकाओं के मिश्रण को इनक्यूबेट करें। पिछले 7 ज के दौरान, सेल सक्रियण के दौरान परिवहन प्रक्रियाओं को ब्लॉक करने के लिए संस्कृति (1,000x की अंतिम सांद्रता, जो 1x संस्कृति मीडिया में पतला हो जाएगा) में पतला brefeldin A के 4 डिग्री सेल्सियस जोड़ें।
      5. कोशिकाओं को दागें और इंट्रासेल्यूलर आईएफएन-जेड का प्रवाह साइटोमेट्रिक विश्लेषण करें जैसा कि पहले वर्णित किया गया था (चित्र 2)।

2. एचबीवी प्लास्मिड के हाइड्रोडायनामिक वितरण के माध्यम से एचबीवी प्रतिकृति को शामिल करना

नोट: pAAV/HBV1.2 निर्माण पहले9वर्णित के रूप में उत्पन्न किया गया था। एचबीवी 1.2 पूर्ण डीएनए वेक्टर पाएवी में शामिल किया गया है।

  1. टेल नस के माध्यम से एचबीवी प्लास्मिड का हाइड्रोडायनामिक प्रसव
    1. पूंछ नस को फैलाने के लिए पिंजरे में 5 मिनट के लिए एक गर्मी दीपक का उपयोग कर एचएचडी चूहों गर्मी।
    2. एक निरोधक के माध्यम से पशु को रोकें, और 70% इथेनॉल स्प्रे के साथ साफ माउस पूंछ.
    3. जिगर में प्लाज्मिड की डिलीवरी.
    4. मापने के पैमाने का उपयोग करके माउस शरीर के वजन को मापने.
    5. शरीर द्रव्यमान पीबीएस (उदाहरण के लिए, एक 20 ग्राम माउस के लिए 1.6 एमएल) के 8% समतुल्य में एचबीवी प्लाज्मिड का 10 डिग्री ग्राम पतला करें। एक 26 ग्राम सिरिंज के साथ एक 3 एमएल सिरिंज में पतला प्लाज्मिड लोड करें, 1 $2" (0ण्45 ] 12 मिमी) हाइपोडर्मिक सुई।
    6. पूंछ के मध्य तिहाई में दो पार्श्व पूंछ नसों में से एक का पता लगाएँ और या तो पार्श्व नस में सुई की स्थिति. 3 - 5 एस के भीतर पूंछ नस के माध्यम से एचबीवी प्लाज्मिड युक्त इंजेक्शन को प्रशासित करें।
  2. संक्रमित चूहों के रक्त सीरम से viremia की मात्रा
    नोट: HBV प्रतिकृति माउस सीरम में दिन 3-35 से होती है। डीएनए प्रतिकृति 7 दिन पर चोटियों और धीरे-धीरे कम कर देता है। एचबीवी डीएनए सीरम से 35 दिन तक साफ नहीं है.
    1. संक्रमित चूहों से रक्त सीरम का संग्रह
      1. एक माइक्रोसेंट्रीफ्यूज ट्यूब में लगभग 0.1 एमएल रक्त एकत्र करें 3, 5, 7, और 10 दिनों के बाद संक्रमण के बाद एक 1.5 एमएल microcentrifuge ट्यूब में रेट्रो कक्षीय खून बह रहा है, तो कमरे के तापमान पर इनक्यूबेट (आरटी) 20 मिनट के लिए।
      2. 4 डिग्री सेल्सियस पर 15 मिनट के लिए 6,000 x ग्राम पर नमूना सेंट्रीफ्यूज और सेंट्रीफ्यूगेशन के बाद सीरम supernatant इकट्ठा।
    2. निर्माता की सिफारिशों के बाद एक व्यावसायिक रूप से उपलब्ध डीएनए निष्कर्षण किट का उपयोग कर रक्त सीरम से डीएनए को शुद्ध करें। संक्षेप में, एक सिलिका आधारित कॉलम में कोशिकाओं lyse, washes प्रदर्शन, और elution कॉलम में 100% इथेनॉल जोड़कर डीएनए निकालने और 1 मिनट के लिए 6000 x ग्राम पर centrifuging. RNase मुक्त पानी के 50L में डीएनए Elute.
    3. वास्तविक समय पीसीआर विश्लेषण के लिए elution से एचबीवी डीएनए के 100 एनजी का प्रयोग करें। निम्नलिखित प्राइमर और जांच का उपयोग करें: आगे 5' TAGGAGGTGTTAGCATAATTGG 3'; रिवर्स 5' GCACAGCTGGGCTTGT 3'; जांच 5' TCACCTCTGCCTAATC 3'.
      1. मानक वक्र के लिए प्लाज्मिड (pAAV/HBV1.2) युक्त एचबीवी जीनोम का उपयोग करें और 10 ख्ल् की कुल आयतन में रीयल-टाइम पीसीआर का प्रयोग करें (चित्र 3)।
    4. सारणी 1में दर्शाए अनुसार 10 डिग्री सेल्सियस के कुल खंड में पीसीआर अभिक्रिया को सेट अप करें।
    5. सारणी 2में दर्शाए गए तापचक्र में पीसीआर प्रोग्राम सेट अप करें। क्रमादेशित ताप संक्रमण दर विकृतीकरण/अनीलन के लिए 20 डिग्री सेल्सियस/सी तथा विस्तार के लिए 5 डिग्री सेल्सियस/ वास्तविक समय पीसीआर की निगरानी के लिए प्रत्येक चक्र के लिए अनीलन चरण के अंत में फ्लोरोसेंट को मापने.

3. वायरल एजी-विशिष्ट iPSC-CD8+ टी कोशिकाओं के अधिनियम द्वारा एचबीवी प्रतिकृति की कमी

  1. दत्तक कोशिका स्थानांतरण (ACT)
    1. धारा 1.3 में वर्णित 8 दिनों के लिए एमएफएलटी-3एल और एमएल-7 की उपस्थिति में ओपी 9-डीएल1-डीएल4 स्ट्रॉमल कोशिकाओं पर s183/iPSCs (1.3.7) का अंतर है।
    2. 22 दिन, trypsin के साथ 10 सेमी प्लेट से iPSC-CD8+ टी कोशिकाओं को इकट्ठा, तो धोने और ताजा मीडिया के 10 एमएल में प्रत्येक 10 सेमी प्लेट resuspend. एक ताजा 10 सेमी प्लेट में कोशिकाओं को जोड़ें और अनुभाग 1.3 में किए गए 30 मिनट के लिए इनक्यूबेटर पर वापस लौटें। 30 मिनट के बाद, अस्थायी कोशिकाओं को इकट्ठा।
    3. कोशिका समूहों को समाप्त करने और सेल संख्या की गणना करने के लिए कोशिकाओं को पास करने के लिए 70 डिग्री नायलॉन छलनी का उपयोग करें। ठंडे पीबीएस समाधान में 1.5 x 107 कोशिकाओं/एमएल की सांद्रता के लिए कोशिकाओं को अनुकूलित करें और आवश्यकता होने पर सेल समूहों को फिर से समाप्त करने के लिए कोशिकाओं को पारित करने के लिए 70 डिग्री मी नायलॉन छलनी का उपयोग करें। अधिनियम तक बर्फ पर कोशिकाओं रखें.
    4. सुई नस के माध्यम से 4-6 सप्ताह पुराने HHD चूहों में 200 जेडएल सेल निलंबन (3 x 106 कोशिकाओं) इंजेक्शन.
  2. एचबीवी प्रतिकृति का प्रेरण
    1. सेल हस्तांतरण के 14 दिन बाद, खंड 2.1 में वर्णित पूंछ नस के माध्यम से एचबीवी प्लाज्मिड की हाइड्रोडायनामिक डिलीवरी करें।
  3. संक्रमित जिगर से वायरस प्रोटीन का पता लगाने
    1. दिन 3, 5, 7, 14, और 21 के बाद संक्रमण पर चूहों बलिदान. इच्छामृत्यु के लिए, प्रत्येक पिंजरे में, पहले चरण में कार्बन डाइऑक्साइड (सीओ2)का 1-2 ल का उपयोग करें। जब पशु चेतना की हानि विकसित करता है, चारों ओर सीओ2 प्रवाह दर लाभ 4-5 L/min. प्रदर्शन माउस इच्छामृत्यु सीओ2 साँस लेना का उपयोग कर.
    2. पर्युदरस और संदंश का उपयोग करने वाले पेरिटोनम की सतह की त्वचा को काटने से जिगर को अलग करें और थोड़ा जिगर को वापस खींचकर आंतरिक त्वचा को उजागर करने के लिए पेरिटोनल गुहा को उजागर करें। लीजिए और जिगर के नमूने में कटौती (लंबाई x चौड़ाई x ऊंचाई ] 0.5 सेमी x 0.5 सेमी X 0.3 सेमी) संक्रमित चूहों के embedding कैसेट में आसानी से फिट करने के लिए और ब्लॉक में 10% तटस्थ बफर formalin के लिए 4-24 ज.
    3. 2.5 एम फोरमिक एसिड का उपयोग करने वाले यकृत नमूनों को निष्क्रिय करें; 3 मिनट के लिए xylene में कुल्ला, 100% इथेनॉल में 2x कुल्ला, 95% इथेनॉल में 2x कुल्ला, deionized में 2x कुल्ला (डीआई) पानी में 2 मिनट के लिए, तो 1 एमएम ethylenediaminetetraacetic एसिड (EDTA) इसी में जिगर के नमूने decalcify. 20 मिनट के लिए एक उप-बोइलिंग तापमान (90 डिग्री सेल्सियस) पर संभाल।
    4. 30 मिनट के लिए निश्चित जिगर के ऊतकों को ठंडा करें। ऊतकों को 4 मिनट के लिए 1x पीबीएस के साथ कुल्ला करें और ऊतकों को पैराफिन में एम्बेड करें। पानी को बदलने के लिए इथेनॉल की बढ़ती सांद्रता की एक श्रृंखला में ऊतकों को निर्जलित करें, और फिर xylene विसर्जन में विसर्जित करें। घुसपैठ के ऊतकों को मोम ब्लॉक में एम्बेड करें। धुंधला के लिए समान रूप से ऊर्ध्वाधर और क्षैतिज अनुभागिंग करें। एक फिसलने microtome के साथ 4 डिग्री मीटर वर्गों तैयार करें।
    5. xylene और इथेनॉल का उपयोग कर deparaffinization और पुनर्जलीकरण के माध्यम से वर्गों पास, तो वर्गों के इम्यूनोफ्लोरेसेंट धुंधला प्रदर्शन करते हैं।
    6. एचबीवी सतह एजी-विशिष्ट एंटीबॉडी (1:100 अवरुद्ध समाधान में कमजोर पड़ने) के 200 $L के साथ वर्गों दाग। एक 75%-100% आर्द्र कक्ष में आरटी में 2 एच के लिए एंटीबॉडी के साथ वर्गों इनक्यूबेट, और 5 मिनट के लिए 1x पीबीएस में 5x धो लें।
    7. स्लाइड का मुकाबला करने के लिए परमाणु दाग के लिए 4',6-diamidino-2-phenylindole (DAPI) युक्त एक विरोधी-फैड अभिकर्मक का प्रयोग करें। पतला DAPI धुंधला समाधान (300 एनएम 1x पीबीएस में) के बारे में 300 डिग्री सेल्सियस के साथ कवर पर्ची जोड़ें और कवर पूरे कवर पर्ची मान्य. एक फ्लोरोसेंट माइक्रोस्कोप के तहत निरीक्षण तक 4 डिग्री सेल्सियस पर अंधेरे में स्लाइड रखें।
  4. संक्रमित चूहों में भड़काऊ सेल घुसपैठ
    1. बलिदान चूहों के रूप में चरण 3.3.1 में वर्णित है. जिगर लीजिए और वर्गों के रूप में चरण 3.3.4 में वर्णित बनाते हैं.
    2. जिगर में भड़काऊ कोशिकाओं की घुसपैठ का मूल्यांकन करने के लिए हेमेटोक्सीलिन और ईओसिन (एच एंड ई) के साथ अनुभाग को दाग।
    3. एक फ्लोरोसेंट माइक्रोस्कोप के तहत आगे विश्लेषण तक 4 डिग्री सेल्सियस पर अंधेरे में स्लाइड स्टोर।
    4. जिगर में भड़काऊ कोशिकाओं की घुसपैठ का पता लगाने के लिए एक फ्लोरोसेंट माइक्रोस्कोप के तहत स्लाइड कल्पना (चित्र 4)।
  5. संक्रमित जिगर के एचबीवी डीएनए का पता लगाने
    1. वायरल डीएनए का अलगाव।
    2. चूहों को यूथेनाइज करें और धारा 3.3 के अनुसार यकृत के नमूने एकत्र करें।
    3. Nonindet P-40 (एनपी-40) lysis बफर (50 एमएम Tris-HCL, 1 एमएम EDTA, 1% एनपी-40) में जिगर के ऊतकों एक प्रोटीज़ अवरोधक कॉकटेल युक्त Lyse.
    4. नाभिक और कोशिका के मलबे को हटाने के लिए 16,000 x ग्राम पर संक्षिप्त अपकेंद्रण।
    5. माइक्रोकोकल न्यूक्लिज (न्यूक्लेस एस7; 150 इकाइयों/एमएल) और कैसीएल2 (5 एमएम) के साथ कोशिकाद्रव्यी लाइसेट को 90 मिनट के लिए 37 डिग्री सेल्सियस पर इनक्यूबेट करें ताकि न्यूक्लिओकैप्सिड्स (एनसी) के बाहर न्यूक्लिइक एसिड को कम किया जा सके।
    6. 10 एमएम EDTA के अलावा द्वारा nuclease S7 निष्क्रिय.
    7. पॉलीथीन ग्लाइकोल (पीईजी) के साथ न्यूक्लिओकैप्सिड्स को निर्धारित करें, 0.5% सोडियम डोडेसिल सल्फेट (एसडीएस) द्वारा बाधित करें, और 0.6 मिलीग्राम/एमएल प्रोटीने के (पीके) के साथ 37 डिग्री सेल्सियस पर 1 एच के लिए डाइजेस्ट करें।
    8. फीनॉल क्लोरोफॉर्म निष्कर्षण और इथेनॉल वर्षा द्वारा वायरल न्यूक्लिक एसिड पुनर्प्राप्त करें।
    9. एक 1.2% agarose जेल पर निकाले वायरल डीएनए को हल करने और एक32 पी लेबल एचबीवी डीएनए जांच का उपयोग कर मानक दक्षिणी धब्बा विश्लेषण द्वारा पता लगाने.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

जैसा कि यहाँ दिखाया गया है, एचबीवी वायरल एजी-विशिष्ट iPSC-CD8+ टी कोशिकाओं को इन विट्रो संस्कृति प्रणाली द्वारा उत्पन्न किया जाता है। इन वायरल एजी-विशिष्ट iPSC-CD8+ टी कोशिकाओं के अधिनियम के बाद काफी हद तक एक murine मॉडल में एचबीवी प्रतिकृति को दबाने (पूरक फ़ाइल 1).. माउस iPSC MIDR retroviral निर्माण एक मानव-माउस संकर एचबीवी टीसीआर जीन एन्कोडिंग के साथ ट्रांसड्यूड कर रहे हैं (HBs183-191-विशिष्ट, s183), तो जीन-ट्रांसड्यूस iPSCs OP9-DL1/DL4 कोशिकाओं के साथ सह-संस्कृत कर रहे हैं पायदान ligands व्यक्त (दोनों डीएल1 और डीएल4) rFlt3L और rIL-7 की उपस्थिति में अणुओं. इन विट्रो सह-संस्कृति के 28 दिन, iPSC व्युत्पन्न कोशिकाओं काफी सीडी 3 और एजी विशेष टीसीआर (टी सेल मार्करों) व्यक्त करते हैं. CD3+CD8+ जनसंख्या का प्रवाह साइटोमेट्रिक विश्लेषण से पता चलता है कि एचबीवी टीसीआर ट्रांसडक्शन नाटकीय रूप से वायरल s183-विशिष्ट CD8+ T कोशिकाओं की पीढ़ी को बढ़ाता है (चित्र 1)।

इन विट्रो सह संस्कृति के 28 दिन, CD4-CD4+ एकल सकारात्मक (एसपी) iPSC-CD8+ टी कोशिकाओं को अलग कर रहे हैं और S183 पेप्टाइड के साथ स्पंदित टी depleted splenocytes द्वारा प्रेरित, और साइटोकिन उत्पादन का मूल्यांकन किया जाता है. आईपीएससी-सीटीएल आईएल-2 और आईएफएन-+ की बड़ी मात्रा का उत्पादन करते हैं, जैसा कि इंट्रासेल्यूलर धुंधला या एलिसा (चित्र 2) द्वारा पता लगाया गया है। एचबीवी संक्रमण एचएलए-ए2.1 ट्रांसजेनिक (एचएचडी) चूहों में चूहों की पूंछ नसों के माध्यम से पीएएवी/एचबीवी 1.2 डीएनए प्लाज्मिड के 10 डिग्री ग्राम के हाइड्रोडायनामिक इंजेक्शन द्वारा प्रेरित होता है। एचबीवी प्रतिकृति एचएचडी चूहों के सीरम में दिन 3-21 से पाया जाता है। डीएनए प्रतिकृति 6 दिन पर चोटियों और धीरे-धीरे वास्तविक समय पीसीआर विश्लेषण का उपयोग कर कम कर देता है (चित्र 3)।

अधिनियम के दो सप्ताह बाद, चूहों को पाव/एचबीवी 1.2 डीएनए प्लाज्मिड के हाइड्रोडायनामिक इंजेक्शन के साथ चुनौती दी जाती है। वायरल टिटर इंजेक्शन के बाद विभिन्न timepoints पर सीरम से वास्तविक समय पीसीआर द्वारा मापा जाता है। परिणाम ों से पता चलता है कि वायरल प्रतिकृति काफी नियंत्रण कोशिकाओं को प्राप्त करने वाले चूहों की तुलना में एचबीवी वायरल एजी-विशिष्ट टी कोशिकाओं को प्राप्त करने वाले चूहों में सभी timepoints पर कम है (चित्र 4)। एचबीवी सतह प्रोटीन अभिव्यक्ति भी उपचार के ऊपर सेटिंग में जिगर में जांच की है। एचबीवी इंजेक्शन के बाद चूहे को विभिन्न दिनों में इच्छामृत्यु दी जाती है और यकृत के नमूने हिस्टोलॉजिक परीक्षा के लिए अलग-अलग होते हैं। नमूने एचबीवी सतह प्रोटीन के लिए दाग और एक फ्लोरोसेंट माइक्रोस्कोप के तहत जांच कर रहे हैं। एचबीवी सतह प्रोटीन को एचबीवी वायरल एजी-विशिष्ट पूर्व-आईपीएसएससी-सीटीएल प्राप्त करने वाले चूहोंमें काफी कमी के रूप में देखा जाता है, जबकि नियंत्रण कोशिकाओं को प्राप्त करने वाले चूहों की तुलना में एचबीवी पृष्ठ प्रोटीन में काफी कमी आई है यह प्रयोग स्पष्ट रूप से दर्शाता है कि वायरल एजी-विशिष्ट iPSC-CD8+ टी कोशिकाओं के लिए murine मॉडल में HBV प्रतिकृति को कम करने की क्षमता है.

Figure 1
चित्र 1: एचबीवी वायरल एजी-विशिष्ट iPSC-CD8+ टी कोशिकाओं का उत्पादन।
माउस iPSCs निम्नलिखित retroviral निर्माण के साथ ट्रांसड्यूस कर रहे हैं: HBs183-91 TCR (MiDR-s183 TCR) या OVA257-264 TCR (MiDR-OVA TCR), और ट्रांसड्यूस्ड iPSCs Tlineage differentiation के लिए OP9-DL1/DL4 stromal कोशिकाओं के साथ सह-संस्कृत हैं. (क) रेट्रोवायरल निर्माण एम आई डी-एस183 टीसीआर का योजनाबद्ध प्रतिनिधित्व s183-विशिष्ट टीसीआर व्यक्त करता है। $ पैकेजिंग संकेत; 2A ] picornavirus स्वयं claving 2A अनुक्रम; LTR - लंबे टर्मिनल दोहराता है. () दिन 0, 7, 14, और 22 पर टी सेल विभेदकी का रूप विज्ञान। (ग)28 दिन के लिए आईपीएससी व्युत्पन्न कोशिकाओं के लिए फ्लो साइटोमेट्रिक विश्लेषण। CD3+CD8+ कक्ष (बाएं) CD8 और TCRV की अभिव्यक्ति के लिए संकेत दिया है और विश्लेषण के रूप में gated रहे हैं (दाएं). दिखाए गए डेटा तीन अलग-अलग प्रयोगों के प्रतिनिधि हैं. मान मतलब का प्रतिनिधित्व करते हैं - एसडी (* पी और lt; 0.01; युग्मित टी-परीक्षण)। कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Figure 2
चित्र 2: एचबीवी वायरल एजी-विशिष्ट iPSC-CD8+ टी कोशिकाओं का कार्यात्मक विश्लेषण।
इन विट्रो सह संस्कृति के 28 दिन, एसपी CD8+s183 TCR pentamer+ iPSC-टी कोशिकाओं को हल कर रहे हैं. IPSC-टी कोशिकाओं और CD8+ टी कोशिकाओं MiDR-s183 TCR के साथ ट्रांसड्यूस टी depleted splenocytes द्वारा प्रेरित कर रहे हैं (APCs) HHD चूहों से और s183 पेप्टाइड (FLLTRILTI) के साथ स्पंदित. (ए) आईएफएन-जेड के अंतरकोशिकीय अभिरंजन के बाद 7 ज (सीडी8+ कोशिकाओं पर गेट किया गया) (T/ (B) आईएफएन-जेड की एलिसा 40 ज के बाद दिखाए गए डेटा तीन अलग-अलग प्रयोगों के प्रतिनिधि हैं। मान मतलब का प्रतिनिधित्व करते हैं - SD (n.s., p और 0.05; युग्मित t-परीक्षण). कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Figure 3
चित्रा 3: हाइड्रोडायनामिक इंजेक्शन द्वारा एचएचडी चूहों में एचबीवी प्रतिकृति का प्रेरण।
एचएचडी चूहों को हाइड्रोडायनामिक टेल नस इंजेक्शन के माध्यम से एचबीवी प्लाज्मिड के साथ i.v. प्रशासनित किया जाता है। प्लाज्मिड का 10 डिग्री कुल शरीर द्रव्यमान पीबीएस का 8% के साथ इंजेक्ट किया जाता है। इंजेक्शन के बाद संकेत समय अंक पर, सीरम रक्त से अलग है और डीएनए वास्तविक समय पीसीआर के लिए निकाला जाता है। दिखाए गए डेटा तीन अलग-अलग प्रयोगों के प्रतिनिधि हैं. ये मान माध्य का प्रतिनिधित्व करते हैं - एसडी डेटा तीन स्वतंत्र प्रयोगों के प्रति समूह पांच चूहों के प्रतिनिधि हैं. कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

Figure 4
चित्र 4: वायरल एजी-विशिष्ट iPSC-CD8+ टी कोशिकाओं के अधिनियम द्वारा एचबीवी प्रतिकृति की कमी।
एचएचडी चूहों को वायरल एजी-विशिष्ट iPSC-CD8+ टी सेल प्रोजेक्टर (इन विट्रो कल्चर के 22 दिन) के साथ गोद लिया जाता है और सेल हस्तांतरण के बाद 2 सप्ताह में एचबीवी प्लाज्मिड के साथ प्रशासन किया जाता है। () सीरम एचबीवी प्रतियां। इंजेक्शन के बाद संकेत timepoints पर, सीरम रक्त से अलग है, और डीएनए वास्तविक समय पीसीआर विश्लेषण के लिए निकाला जाता है. दिखाए गए डेटा तीन अलग-अलग प्रयोगों के प्रतिनिधि हैं. मान मतलब का प्रतिनिधित्व करते हैं - एसडी. (बी) जिगर ऊतक ऊतक विज्ञान. एचबीवी संक्रमण के बाद 8 दिन में चूहे को इच्छामृत्यु दी जाती है। जिगर के नमूने अलग और हिस्टोलॉजिक परीक्षा के लिए दाग रहे हैं। ऊपरी पैनल संक्रमित चूहों में HBsAg प्रोटीन अभिव्यक्ति से पता चलता है (IHC धुंधला) और कम पैनल भड़काऊ सेल घुसपैठ से पता चलता है (HE-staining). डेटा तीन स्वतंत्र प्रयोगों के समूह प्रति पांच चूहों के प्रतिनिधि हैं. कृपया इस चित्र का एक बड़ा संस्करण देखने के लिए यहाँ क्लिक करें.

डीएनए टेम्पलेट 2 मिलीलीटर
डीएनए मास्टर संकरीकरण मिश्रण ((ताक डीएनए पॉलिमरेज, पीसीआर प्रतिक्रिया बफर, 10 एमएम MgCl2, और dNTP मिश्रण) 1 मिलीलीटर
25 एमएमएमजीसीएल2 0.8 मिलीलीटर
0.3 डिग्री सेल्सियस जांच 3 मिलीलीटर
प्रत्येक प्राइमर के 5 $M 3.2 मिलीलीटर
कुल 10 मिलीलीटर

तालिका 1: PCR प्रतिक्रिया मात्रा

तापमान समय
विकृतीकरण 95 डिग्री सेल्सियस 5 एस
अनीलन 53 डिग्री सेल्सियस 10 एस
एक्सटेंशन 72 डिग्री सेल्सियस 20 एस
5 डिग्री सेल्सियस

तालिका 2: PCR प्रोग्राम

पूरक फ़ाइल 1: इस फ़ाइल को डाउनलोड करने के लिए कृपया यहाँ क्लिक करें.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

यह प्रोटोकॉल एक murine मॉडल में HBV प्रतिकृति को रोकें ACT के रूप में उपयोग के लिए वायरल Ag-विशिष्ट iPSC-CTLs जनरेट करने के लिए एक विधि प्रस्तुत करता है। पुरानी एचबीवी संक्रमण में, वायरल जीनोम एक स्थिर मिनी गुणसूत्र बनाता है, सहसंयोजक रूप से बंद परिपत्र डीएनए (cccDNA) जो हेपाटोसाइट की उम्र भर जारी रह सकता है। वायरल मिनी गुणसूत्र की निकासी को लक्षित करने से पुरानी एचबीवी संक्रमण का इलाज हो सकता है। वर्तमान एंटीवायरल थेरेपी वायरस रिवर्स ट्रांसक्रिप्टेस को लक्षित करती है लेकिन शायद ही कभी सीसीडीएनए द्वारा संचालित एचबीवी प्रतिकृति पर प्रतिरक्षा नियंत्रण स्थापित करती है। एचबीवी-विशिष्ट सीडी 8+ सीटीएल संक्रमित हेपाटोसाइट्स की हत्या को मध्यस्थता कर सकता है और सीसीसीडीएनए की निकासी में तेजी ला सकता है। फिर भी, एचबीवी-विशिष्ट CTLs नष्ट कर रहे हैं, बेकार, या पुरानी एचबीवी संक्रमण के साथ रोगियों में थकावट के शिकार. एचबीवी-विशिष्ट सीटीएल के साथ अधिनियम पुरानी एचबीवी संक्रमण28,29के लिए एक अनुकूल उपचार है। भोली या केंद्रीय स्मृति टी सेल व्युत्पन्न टी लिम्फोसाइट्स (यानी, अत्यधिक प्रतिक्रियाशील प्रतिरक्षा कोशिकाओं) उनके महान प्रसार के कारण अधिनियम आधारित चिकित्सा के लिए आदर्श प्रभावक हैं, मौत के लिए कम प्रवृत्ति terminally विभेदित कोशिकाओं की तुलना में, और उत्कृष्ट होमोस्टैटिक साइटोकिन्स का जवाब देने की क्षमता। तथापि, रोगियों से सीटीएल की पर्याप्त संख्या प्राप्त करने में कठिनाइयों के कारण ऐसा अधिनियम अक्सर व्यवहार्य नहीं रहा है। यह पहले से पता चला है कि आई पी एस सी से एजी-विशिष्ट CTLs या टीregs के reprogramming सेल आधारित चिकित्सा के लिए इस्तेमाल किया जा सकताहै 20,23,27,30. यह रिपोर्ट वायरल एजी-विशिष्ट iPSC-CTLs उत्पन्न और एचबीवी प्रतिकृति के एक murine मॉडल में अधिनियम आधारित इम्यूनोथेरेपी के लिए इन कोशिकाओं का उपयोग करने के लिए एक विधि को दर्शाता है।

हालांकि वहाँ HBV प्रतिकृति के ट्रांसजेनिक माउस मॉडल हैं, इन मॉडलों को चुनौती दे रहे हैं क्योंकि ट्रांसजेनिक जीन उत्पादों द्वारा प्रेरित केंद्रीय सहिष्णुता चूहों एचबीवी एग्स के लिए प्रतिरक्षा सहिष्णु होने का कारण बनता है. इसके अतिरिक्त, ट्रांसजेनिक चूहे वायरल निकासी की निगरानी के लिए उपयुक्त नहीं हैं क्योंकि प्रत्येक माउस सेल31,32में एकीकृत एचबीवी जीनोम बना रहता है। इसके अलावा, संक्रमण को रोकने के लिए सफल टीके विकसित किए गए हैं, एचबीवी संक्रमण के बाद उपचार या इम्यूनोथेरेपी विकसित नहीं की गई है। इसके अलावा, एचबीवी रोगजनन के लिए प्रयोगात्मक दृष्टिकोण बाधित किया गया है क्योंकि एचबीवी संक्रमण की मेजबान रेंज पुरुषों और चिम्पांजी तक सीमित है, और एचबीवी के प्रचार के लिए इन विट्रो संस्कृति प्रणाली पर्याप्त नहीं है। CD8+ टी कोशिकाओं वायरल संक्रमण के विभिन्न प्रकार के खिलाफ effector कोशिकाओं का वादा कर रहे हैं; हालांकि, एचबीवी के खिलाफ टी सेल प्रतिक्रिया प्रचुर मात्रा में नहीं है। विशिष्टता, कार्य, और एक प्रतिरक्षा प्रतिक्रिया माउंट करने के लिए पर्याप्त संख्या की कमी का कारण हो सकता है. इस रिपोर्ट में हाइड्रोडायनामिक इंजेक्शन की विधि का पता चलता है जो चूहों में एचबीवी प्रतिकृति को कुशलतापूर्वक प्रेरित करता है। विधि एचबीवी प्लाज्मिड की एक बड़ी राशि के वितरण की अनुमति देता है सीधे जिगर में. मॉडल इंजेक्शन के बाद अलग अलग दिनों में एचबीवी MRNA, प्रोटीन, और डीएनए का पता लगाने के साथ अधिक से अधिक 8 सप्ताह के लिए निरंतर viremia दर्शाती है। चूहों में एचबीवी प्रतिकृति के लिए यह विधि एचबीवी इम्यूनोथेरेपी के लिए उपयोगी है।

सारांश में, एचबीवी प्रतिकृति सफलतापूर्वक हाइड्रोडायनामिक इंजेक्शन प्रक्रिया के माध्यम से चूहों में प्रेरित किया गया था, और वायरल एजी-विशिष्ट iPSC-CTLs एचबीवी प्रतिकृति के लिए इम्यूनोथेरेपी के रूप में इस्तेमाल किया गया। हालांकि, विधि की दो सीमाएँ हैं: (1) इन विट्रो टी सेल विभेदन के तीन सप्ताह से अधिक ACT के लिए उत्पन्न टी कोशिकाओं के अनुवाद अनुप्रयोगों को कम कर सकते हैं; और (2) एचबीवी हाइड्रोडायनामिक इंजेक्शन कुशलतापूर्वक जिगर में एचबीवी प्रतिकृति प्रेरित कर सकते हैं; हालांकि, यह ccDNA नहीं बना है, जो लगातार एचबीवी संक्रमण का मुख्य कारण है। फिर भी, विधि एचबीवी प्रतिकृति और उपचार के लिए एक वैकल्पिक दृष्टिकोण प्रदान करता है। एंटी-एचबीवी दवाओं और वायरल एजी-विशिष्ट आईपीएससी-सीटीएल के अधिनियम का उपयोग करने वाले एक संयोजन आहार एचआईवी जलाशयों को कम करने की संभावना है, जिसके परिणामस्वरूप पुरानी एचआईवी संक्रमण के लिए एक चिकित्सा होती है।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों को खुलासा करने के लिए कुछ भी नहीं है.

Acknowledgments

लेखकों HBs183-91 (s183) (FLLTRILTI) के लिए cDNA प्रदान करने के लिए टोरंटो जनरल अस्पताल अनुसंधान संस्थान से डॉ एडम जे Gehring धन्यवाद - विशिष्ट A2-प्रतिबंधित मानव-मौर संकर TCR जीन, और डॉ Pei-जेर चेन राष्ट्रीय ताइवान विश्वविद्यालय से प्रदान करने के लिए pAAV/HBV 1.2 निर्माण. यह काम राष्ट्रीय स्वास्थ्य अनुदान संस्थान R01AI121180, R01CA2221867 और R21AI109239 जे एस के लिए समर्थित है

Materials

Name Company Catalog Number Comments
HHD mice Institut Pasteur, Paris, France H-2 class I knockout, HLA-A2.1-transgenic (HHD) mice
iPS-MEF-Ng-20D-17 RIKEN Cell Bank APS0001
SNL76/7 ATCC SCRC-1049
OP9 ATCC CRL-2749
pAAV/HBV1.2 plasmid Dr. Dr. Pei-Jer Chen (National Taiwan University Hospital, Taiwan) HBV DNA construct
HBs183-91(s183) (FLLTRILTI)-specific TCR genes Dr. Adam J Gehring (Toronto General Hospital Research Institute, Toronto, Canada) FLLTRILTI-specific A2-restricted human-murine hybrid TCR genes (Vα34 and Vβ28)
OVA257–264-specific TCR genes Dr. Dario A. Vignali (University of Pittsburgh, PA) SIINFEKL-specific H-2Kb-restricted TCR genes
Anti-CD3 (17A2) antibody Biolegend 100236
Anti-CD44 (IM7) antibody BD Pharmingen 103012
Anti-CD4 (GK1.5) antibody Biolegend 100408
Anti-CD8 (53-6.7) antibody Biolegend 100732
Anti-IFN-γ (XMG1.2) antibody Biolegend 505810
Anti-TNF-a (MP6-XT22) antibody Biolegend 506306
α-MEM Invitrogen A10490-01
Anti-HBs antibody Thermo Fisher MA5-13059
ACK Lysis buffer Lonza 10-548E
Brefeldin A Sigma B7651
DMEM Invitrogen ABCD1234
FBS Hyclone SH3007.01
FACSAria Fusion cell sorter BD 656700
Gelatin MilliporeSigma G9391
GeneJammer Agilent 204130
HLA-A201-HBs183-91-PE pentamer Proimmune F027-4A - 27
HRP Anti-Mouse Secondary Antibody Invitrogen A27025
mFlt-3L Peprotech 250-31L
mIL-7 Peprotech 217-17
Nuclease S7 Roche 10107921001
Paraformaldehyde MilliporeSigma P6148-500G Caution: Allergenic, Carcenogenic, Toxic
Permeabilization buffer Biolegend 421002
Polybrene MilliporeSigma 107689
ProLong™ Gold Antifade Mountant with DAPI Invitrogen P36931
QIAamp MinElute Virus Spin Kit Qiagen 57704

DOWNLOAD MATERIALS LIST

References

  1. Scaglione, S. J., Lok, A. S. Effectiveness of hepatitis B treatment in clinical practice. Gastroenterology. 142, (6), 1360-1368 (2012).
  2. Osiowy, C. From infancy and beyond... ensuring a lifetime of hepatitis B virus (HBV) vaccine-induced immunity. Human Vaccines & Immunotherapeutics. 14, (8), 2093-2097 (2018).
  3. Gish, R. G., et al. Loss of HBsAg antigen during treatment with entecavir or lamivudine in nucleoside-naive HBeAg-positive patients with chronic hepatitis B. Journal of Viral Hepatitis. 17, (1), 16-22 (2010).
  4. Kurktschiev, P. D., et al. Dysfunctional CD8+ T cells in hepatitis B and C are characterized by a lack of antigen-specific T-bet induction. Journal of Experimental Medicine. 211, (10), 2047-2059 (2014).
  5. Fisicaro, P., et al. Antiviral intrahepatic T-cell responses can be restored by blocking programmed death-1 pathway in chronic hepatitis B. Gastroenterology. 138, (2), 682-693 (2010).
  6. Schurich, A., et al. The third signal cytokine IL-12 rescues the anti-viral function of exhausted HBV-specific CD8 T cells. PLoS Pathogens. 9, (3), 1003208 (2013).
  7. Gehring, A. J., et al. Engineering virus-specific T cells that target HBV infected hepatocytes and hepatocellular carcinoma cell lines. Journal of Hepatology. 55, (1), 103-110 (2011).
  8. Xia, Y., et al. Interferon-gamma and Tumor Necrosis Factor-alpha Produced by T Cells Reduce the HBV Persistence Form, cccDNA, Without Cytolysis. Gastroenterology. 150, (1), 194-205 (2016).
  9. Huang, L. R., Wu, H. L., Chen, P. J., Chen, D. S. An immunocompetent mouse model for the tolerance of human chronic hepatitis B virus infection. Proceedings of the National Academy of Sciences U.S.A. 103, (47), 17862-17867 (2006).
  10. Wong, P., Pamer, E. G. CD8 T cell responses to infectious pathogens. Annual Review of Immunology. 21, 29-70 (2003).
  11. Murray, J. M., Wieland, S. F., Purcell, R. H., Chisari, F. V. Dynamics of hepatitis B virus clearance in chimpanzees. Proceedings of the National Academy of Sciences USA. 102, (49), 17780-17785 (2005).
  12. Hinrichs, C. S., et al. Adoptively transferred effector cells derived from naive rather than central memory CD8+ T cells mediate superior antitumor immunity. Proceedings of the National Academy of Sciences U.S.A. 106, (41), 17469-17474 (2009).
  13. Hinrichs, C. S., et al. Human effector CD8+ T cells derived from naive rather than memory subsets possess superior traits for adoptive immunotherapy. Blood. 117, (3), 808-814 (2011).
  14. Kerkar, S. P., et al. Genetic engineering of murine CD8+ and CD4+ T cells for preclinical adoptive immunotherapy studies. Journal of Immunotherapy. 34, (4), 343-352 (2011).
  15. Kuball, J., et al. Facilitating matched pairing and expression of TCR chains introduced into human T cells. Blood. 109, (6), 2331-2338 (2007).
  16. van Loenen, M. M., et al. Mixed T cell receptor dimers harbor potentially harmful neoreactivity. Proceedings of the National Academy of Sciences USA. 107, (24), 10972-10977 (2010).
  17. Cameron, B. J., et al. Identification of a Titin-derived HLA-A1-presented peptide as a cross-reactive target for engineered MAGE A3-directed T cells. Science Translational Medicine. 5, (197), (2013).
  18. Fedorov, V. D., Themeli, M., Sadelain, M. PD-1- and CTLA-4-based inhibitory chimeric antigen receptors (iCARs) divert off-target immunotherapy responses. Science Translational Medicine. 5, (215), (2013).
  19. Maus, M. V., et al. T cells expressing chimeric antigen receptors can cause anaphylaxis in humans. Cancer Immunolology Research. 1, (1), 26-31 (2013).
  20. Haque, R., et al. Programming of regulatory T cells from pluripotent stem cells and prevention of autoimmunity. Journal of Immunology. 189, (3), 1228-1236 (2012).
  21. Vizcardo, R., et al. Regeneration of human tumor antigen-specific T cells from iPSCs derived from mature CD8(+) T cells. Cell Stem Cell. 12, (1), 31-36 (2013).
  22. Nishimura, T., et al. Generation of rejuvenated antigen-specific T cells by reprogramming to pluripotency and redifferentiation. Cell Stem Cell. 12, (1), 114-126 (2013).
  23. Lei, F., et al. In vivo programming of tumor antigen-specific T lymphocytes from pluripotent stem cells to promote cancer immunosurveillance. Cancer Research. 71, (14), 4742-4747 (2011).
  24. Kim, J. B., et al. Oct4-induced pluripotency in adult neural stem cells. Cell. 136, (3), 411-419 (2009).
  25. Lei, F., Haque, R., Xiong, X., Song, J. Directed differentiation of induced pluripotent stem cells towards T lymphocytes. Journal of Visualized Experiments. (63), e3986 (2012).
  26. Lei, F., Haque, M., Sandhu, P., Ravi, S., Ni, Y., Zheng, S., Fang, D., Jia, H., Yang, J. M., Song, J. Development and characterization of naive single-type tumor antigen-specific CD8+ T lymphocytes from murine pluripotent stem cells. OncoImmunology. 6, (2017).
  27. Haque, M., et al. Melanoma Immunotherapy in Mice Using Genetically Engineered Pluripotent Stem Cells. Cell Transplantation. 25, (5), 811-827 (2016).
  28. Tan, A. T., et al. Use of Expression Profiles of HBV DNA Integrated Into Genomes of Hepatocellular Carcinoma Cells to Select T Cells for Immunotherapy. Gastroenterology. (2019).
  29. Wu, L. L., et al. Ly6C(+) Monocytes and Kupffer Cells Orchestrate Liver Immune Responses Against Hepatitis B Virus in Mice. Hepatology. (2019).
  30. Haque, M., et al. Stem cell-derived tissue-associated regulatory T cells suppress the activity of pathogenic cells in autoimmune diabetes. Journal of Clinical Investigation Insights. (2019).
  31. Chisari, F. V., et al. Structural and pathological effects of synthesis of hepatitis B virus large envelope polypeptide in transgenic mice. Proceedings of the National Academy of Sciences USA. 84, (19), 6909-6913 (1987).
  32. Wirth, S., Guidotti, L. G., Ando, K., Schlicht, H. J., Chisari, F. V. Breaking tolerance leads to autoantibody production but not autoimmune liver disease in hepatitis B virus envelope transgenic mice. Journal of Immunology. 154, (5), 2504-2515 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics