Systematiskt, storskaliga syntetiska genetiska (gen-gen eller epistasis) interaktion skärmar kan användas för att utforska genetiska redundans och väg överhörning. Här beskriver vi en hög genomströmning kvantitativ syntetisk genteknik array screening kallas eSGA som vi utvecklat för att belysa epistatisk relationer och utforska genetiska interaktion nätverk<em> Escherichia coli</em>.
Fenotyper bestäms av en komplex serie av fysiska (t.ex. protein-protein) och funktionell (t.ex. gen-gen eller genetisk) interaktioner (GI) 1. Även fysiska interaktioner kan ange vilka bakteriella proteiner associerade som komplex, de inte nödvändigtvis avslöjar väg-nivå funktionella relationships1. GI skärmar, där tillväxten av dubbla mutanter som bär två borttagna eller inaktiverade gener mäts och jämförs med motsvarande enkla mutanterna, kan belysa epistatisk beroenden mellan loci och därmed ge möjlighet att söka och upptäcka nya funktionella relationer 2. Storskaliga GI kartor har rapporterats för eukaryota organismer som jäst 3-7, men GI information förblir gles för prokaryoter 8, vilket hindrar den funktionella notering av bakteriella genom. För detta ändamål har vi och andra utvecklade hög kapacitet kvantitativa bakteriella GI screeningmetoder 9, 10 </sup>.
Här presenterar vi de viktigaste stegen som krävs för att utföra kvantitativa E. E. coli Syntetisk Genetisk Array (eSGA) screeningsförfarande på arvsmassan skala 9, med naturliga bakteriella konjugering och homolog rekombination till systemiskt generera och mäta kondition stort antal dubbla mutanter i en koloni arrayformat. Kortfattat en robot används för att överföra genom konjugering, kloramfenikol (cm) – märkta mutantalleler från konstruerad HFR (Hög frekvens av rekombination) givare stammar "i en ordnad uppsättning av kanamycin (Kan) – märkta F-mottagare stammar. Vanligtvis använder vi förlust av funktion enstaka mutanter bär icke väsentliga gen deletioner (t.ex. "Keio-kollektion 11) och väsentliga gen hypomorphic mutationer (dvs. alleler som ger minskad proteinuttryck, stabilitet eller aktivitet 9, 12, 13) till fråga de funktionella sammanslutningar av icke-essentiella och essentiella gener, respectively. Efter konjugering och därpå följande genetiskt utbyte medierad genom homolog rekombination, är de resulterande dubbla mutanterna selekterades på fast medium innehållande båda antibiotika. Efter utväxt, plattorna digitalt avbildas och koloni storlekar kvantitativt värderade med hjälp av ett eget automatiserat system bildbehandling 14. GIS är avslöjas när tillväxten av en dubbel mutant är antingen mycket bättre eller sämre än förväntat 9. Försvårande (eller negativ) GIS resulterar ofta mellan förlust av funktion mutationer i par gener från kompensatoriska vägar som inkräktar på samma grundläggande processen 2. Här, är förlusten av en enda gen buffrad, så att antingen enda mutant är livskraftig. Dock är förlusten av både vägar skadlig och leder till syntetisk dödlighet eller sjukdom (t.ex. långsam tillväxt). Omvänt, kan lindra (eller positiv) interaktioner sker mellan gener i samma väg eller proteinkomplex 2 somradering av antingen gen sig ofta tillräckligt för att störa den normala funktionen av vägen eller komplexa så att ytterligare störningar inte minskar aktiviteten, och därmed tillväxten, ytterligare. Sammantaget kan systematiskt identifiera och analysera GI nätverk ger objektiva globala kartor över de funktionella sambanden mellan ett stort antal gener, som väg-information på missas av andra metoder kan härledas 9.
Vi har beskrivit en stegvis protokoll för att använda robotar eSGA screening för att undersöka bakteriella genfunktioner på väg nivå genom förhör GI. Detta tillvägagångssätt kan användas för att studera enskilda gener samt hela biologiska system i E. coli. Försiktigt köra de experimentella stegen som beskrivs ovan, inklusive alla lämpliga kontroller, och strikt analysera och självständigt validera GI uppgifterna är viktiga aspekter för framgång eSGA i att göra nya funktionella upptäckter…
The authors have nothing to disclose.
Detta arbete stöddes av medel från Genome Canada, Ontario Genomics Institute och den kanadensiska Institutes of Health Research bidrag till JG och AE AG är mottagare av Vanier Kanada Graduate Scholarship.
I. Antibiotics | 2 | 36471 Remove |
||||
Chloramphenicol | Bioshop | #CLR201 | 3 | 36472 Remove |
||
Kanamycin | #KAN201 | 4 | 36480 Remove |
|||
Ampicillin | # AMP201 | 5 | 36473 Remove |
|||
2. Luria-Bertani medium | 6 | 36474 Remove |
||||
LB powder | Bioshop | #LBL405 | 7 | 36478 Remove |
||
Agar | Bioshop | #AGR003 | 8 | 36481 Remove |
||
3. Bacterial Strains and Plasmids | 9 | 36475 Remove |
||||
Hfr Cavalli strain λred system (JL238) | Babu et al.14. | 10 | 36476 Remove |
|||
pKD3 | E. coli Genetic Stock Centre, Yale | 11 | 36477 Remove |
|||
Keio E. coli F- recipient collection | National BioResource Project (NBRP) of Japan11 | 12 | 36479 Remove |
|||
Hypomorphic E. coli F- SPA-tag strains | Open biosystems; Babu et al.14 | 13 | 36491 Remove |
|||
4. Primers | 14 | 36486 Remove |
||||
pKD3-based desalted constant primers | F1: 5′-GGCTGACATGGGAATTAGC-3′ R1: 5′-AGATTGCAGCATTACACGTCTT-3′ |
15 | 36482 Remove |
|||
Desalted custom primers | Cm-R: 5′-TTATACGCAAGGCGACAAGG-3′ Cm-F: 5′- GATCTTCCGTCACAGGTAGG-3′ |
16 | 36483 Remove |
|||
Desalted custom primers | F2 and R2: 20 nt constant regions based on pKD3 sequence and 45 nt custom homology regions F2 constant region: 5′-CATATGAATATCCTCCTTA-3′ R2 constant region: 5′-TGTGTAGGCTGGAGCTGCTTC-3’S1 and S2: 27 nt constant regions for priming the amplification of the SPA-Cm cassette and 45 nt custom homology regions S1 constant region: 5’AGCTGGAGGATCCATGGAAAAGAGAAG -3′ S2 constant region: 5′- GGCCCCATATGAATATCCTCCTTAGTT -3′ KOCO-F and KOCO-C: 20 nt primers 200 bp away from the non-essential gene deletion site or the essential gene SPA-tag insertion site |
17 | 36484 Remove |
|||
5. PCR and Electrophoresis Reagents | 18 | 36485 Remove |
||||
Taq DNA polymerase | Fermentas | # EP0281 | 19 | 36487 Remove |
||
10X PCR buffer | Fermentas | # EP0281 | 20 | 36488 Remove |
||
10 mM dNTPs | Fermentas | # EP0281 | 21 | 36489 Remove |
||
25 mM MgCl2 | Fermentas | # EP0281 | 22 | 36490 Remove |
||
Agarose | Bioshop | # AGA002 | 23 | 36492 Remove |
||
Loading dye | NEB | #B7021S | 24 | 36493 Remove |
||
Ethidium bromide | Bioshop | # ETB444 | 25 | 36497 Remove |
||
10X TBE buffer | Bioshop | # ETB444.10 | 26 | 36494 Remove |
||
Tris Base | Bioshop | # TRS001 | 27 | 36495 Remove |
||
Boric acid | Sigma | # T1503-1KG | 28 | 36496 Remove |
||
0.5 M EDTA (pH 8.0) | Sigma | # B6768-500G | 29 | 36498 Remove |
||
DNA ladder | NEB | #N3232L | 30 | 36499 Remove |
||
6. DNA isolation and Clean-up Kits | 31 | 36500 Remove |
||||
Genomic DNA isolation and purification kit | Promega | #A1120 | 32 | 36501 Remove |
||
Plasmid Midi kit | Qiagen | # 12143 | 33 | 36502 Remove |
||
QIAquick PCR purification kit | Qiagen | #28104 | 34 | 36512 Remove |
||
7. Equipment for PCR, Transformation and Replica-pinning | 35 | 36503 Remove |
||||
Thermal cycler | BioRad, iCycler | 36 | 36504 Remove |
|||
Agarose gel electrophoresis | BioRad | 37 | 36505 Remove |
|||
Electroporator | Bio-Rad GenePulser II | 38 | 36506 Remove |
|||
0.2 cm electroporation cuvette | Bio-Rad | 39 | 36507 Remove |
|||
42 °C water bath shaker | Innova 3100 | 40 | 36508 Remove |
|||
Beckman Coulter TJ-25 centrifuge | Beckman Coulter | 41 | 36519 Remove |
|||
32 °C shaker | New Brunswick Scientific, USA | 42 | 36509 Remove |
|||
32 °C plate incubator | Fisher Scientific | 43 | 36510 Remove |
|||
RoToR-HDA benchtop robot | Singer Instruments | 44 | 36511 Remove |
|||
96, 384 and 1,536 pin density pads | Singer Instruments | 45 | 36513 Remove |
|||
96 or 384 long pins | Singer Instruments | 46 | 36514 Remove |
|||
8. Imaging Equipments | 47 | 36515 Remove |
||||
Camera stand | Kaiser | 48 | 36516 Remove |
|||
Digital camera, 10 megapixel | Any Vendor | 49 | 36517 Remove |
|||
Light boxes, Testrite 16″ x 24″ units | Testrite | 50 | 36527 Remove |
|||
9. Pads or Plates Recycling | 51 | 36518 Remove |
||||
10% bleach | Any Vendor | 52 | 36520 Remove |
|||
70% ethanol | Any Vendor | 53 | 36521 Remove |
|||
Sterile distilled water | Any Vendor | 54 | 36522 Remove |
|||
Flow hood | Any Vendor | 55 | 36523 Remove |
|||
Ultraviolet lamp | Any Vendor | 56 | 36524 Remove |
|||
10. Labware | 57 | 36525 Remove |
||||
50 ml polypropylene tubes | Any Vendor | 58 | 36526 Remove |
|||
1.5 ml micro-centrifuge tubes | Any Vendor | 59 | 36528 Remove |
|||
250 ml conical flaks | VWR | # 29140-045 | 60 | 36529 Remove |
||
15 ml sterile culture tubes | Thermo Scientific | # 366052 | 61 | 36530 Remove |
||
Cryogenic vials | VWR | # 479-3221 | 62 | 36531 Remove |
||
Rectangular Plates | Singer Instruments | 63 | 36532 Remove |
|||
96-well and 384-well microtitre plates | Singer Instruments | Nunc | 64 | 36533 Remove |
||
Plate roller for sealing multi-well | Sigma | #R1275 | 65 | 36535 Remove |
||
plates | ABgene | # AB-0580 | 66 | 36534 Remove |
||
Adhesive plate seals | Fisher Scientific | # 13-990-14 | 67 | 36537 Remove |
||
-80 °C freezer | Any Vendor | 68 | 36536 Remove |