Waiting
Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove
Click here for the English version

Medicine

Генерация индуцированные плюрипотентные стволовые клетки мышечной дистрофией пациентов: эффективная интеграция без перепрограммирования мочи клеток, полученных

Published: January 28, 2015 doi: 10.3791/52032

Abstract

Дистрофические кардиомиопатия плохо понимал следствием мышечной дистрофии. Создание индуцированных плюрипотентных стволовых клеток (ИПСК) у пациентов с мышечной дистрофией является ценным источником для сотовой в пробирке модели болезни систем и может быть использовано для скрининга лекарственных средств исследований. Пациент-клетки, полученные из мочи были использованы в успешном перепрограммирования в индуцированных плюрипотентных стволовых клеток для моделирования дистрофические кардиомиопатию 1. Обращаясь соображений безопасности интеграции векторных систем, мы приводим протокол, используя неинтегрирующих вируса Сендай вектор для трансдукции Яманака факторы в клетки мочи, собранных от пациентов с мышечной дистрофией. Этот протокол генерирует полностью перепрограммировать клонов в течение 2-3 недель. В плюрипотентные клетки являются вектор-Free прохождением-13. Эти дистрофические иПСК могут быть дифференцированы в кардиомиоциты и используется либо для изучения механизмов болезни или для скрининга лекарственных средств.

Introduction

Кардиомиопатия является второй ведущей причиной смерти у пациентов с Дюшенна и Беккера мышечной дистрофии (MD). Хотя мутации в гене дистрофина с Х-хромосомой происходят в 1: 3500 новорожденных мальчиков, очень мало известно о молекулярных и клеточных событий, ведущих к прогрессирующей сердечной повреждения мышц. Человека индуцированных плюрипотентных стволовых клеток, полученных из мышечной больных дистрофией появились в качестве нового инструмента для изучения механизмов основного заболевания и использовать для наркотиков скрининга 1,2.

Ожидаемый дискомфорт биопсии кожи или образцов крови может отговорить молодых пациентов и / или их опекунов, чтобы дать согласие на участие в исследовании. Образцы мочи неинвазивный источником соматических клеток, которые исправимо методам перепрограммирования. Мы недавно показали, что клетки мочи, собранные от пациенты с мышечной дистрофией, можно культивировать и эффективно перепрограммировать в ИПСК с помощью ретровирусов трансдукции факторов Яманака (Oct3 / 4, Sox2, Klf4 и C-Myc; OSKM) 1. Недостатком ретровирусов доставки генов является случайным интеграция перепрограммирования генов в хромосомы хозяина. Чтобы преодолеть это ограничение, мы использовали неинтегрирующих вирус Сендай мочи перепрограммирования клеток.

Этот протокол Подробнее вируса перепрограммирование Сендай изолированных клеток мочи от мышечных больных дистрофией, которые затем могут быть дифференцированы в кардиомиоциты или другие типы клеток для дальнейшего исследования. Этот протокол также может быть адаптирована для других пациентов конкретных заболеваний.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

ПРИМЕЧАНИЕ: пациентов и / или их опекуны должны дать информированное согласие на участие в наблюдательным советом Institutional одобрил исследование.

1. Буферы и СМИ Подготовка

  1. Промывочный буфер: Для приготовления 100 мл промывочного буфера, добавляют 1 мл 100x пера / стрептококкового раствором (100 ед / мл пенициллина + 100 мкг / мл стрептомицина) до 99 мл фосфатного буферного солевого раствора (PBS).
  2. Мочевой клеток-предшественников (UPC) Medium: Для подготовки UPC среду, смешать равные объемы кератиноцитов бессывороточной (КСБ) Средняя + клеток-предшественников Medium.
    1. КСБ среда: Для приготовления среды кератиноцитов, добавить 5 нг / мл эпидермального фактора роста (EGF), 50 нг / мл экстракта бычьего гипофиза (BPE), 30 нг / мл холерного токсина, и ручка / стрептококк раствор (100 МЕ / мл пенициллина, 100 мкг / мл стрептомицина) до 500 мл КСФ среды.
    2. Клеток-предшественников Medium: Добавьте три четверти DMEM с одной четвертью Ham-F12 СМИ и дополнения 10% FBS, 0,4 мкг / мл гидрокортизона, 0,1нМ холерный токсин, 5 нг / мл инсулина, 1,8 х 10 -4 М аденин, 5 мкг / мл трансферрина, 2 х 10 -9 М трииодо тиронин, 10 нг / мл EGF, и ручка / стрептококк раствор.
  3. ЭСК Medium: Добавить 20% замену КО-сыворотки (K-SR), 1x MEM без незаменимых аминокислот, 2 мМ L-глутамина, 100 мкм β-меркаптоэтанола, 20 нг / мл bFGF и ручку / острый 400 мл DMEM / F12 средой.

2. образце мочи Коллекция

  1. Поручить пациентам пить жидкости за 30 мин до сбора мочи для того, чтобы достаточное количество (~ 30-40 мл) мочи может быть собрана.
  2. Дайте пациентов и / или их опекунов комплект для сбора мочи, содержащее следующие пункты: (1) письменные инструкции о том, как получить стерильный или чистый образец улов мочи (2) влажные антибактериальные туалетной и (3) 100 мл стерильной ЗАБОР чашки. Поручить пациентов, чтобы собрать пробы.
  3. Сразу же место образцы мочи на льду и передать LABORAТори в холодильнике. Сразу Обработайте мочи для выделения клеток. Если задержка неизбежна, хранить образец на льду до 4 ч с минимальной потерей жизнеспособности клеток.

3. Выделение и расширения мочи клеток

ПРИМЕЧАНИЕ: Выполните следующие действия в стерильных условиях в BSL2 бокс биологической безопасности.

  1. Использование стерильных пипеток, передает пробы мочи в стерильную 50-мл центрифужные пробирки. Центрифуга при 400 х г в течение 10 мин при комнатной температуре.
  2. Аспирируйте надосадочную жидкость, оставив 1 мл в пробирки; будьте осторожны, чтобы не нарушить клеточный осадок.
  3. Ресуспендируют и комбинировать гранулы из нескольких трубок в 7 мл промывочного буфера и повторить центрифугирования при 400 × г в течение 10 мин при комнатной температуре.
  4. Тщательно аспирата супернатант, оставляя осадок клеток и ~ 0,2-0,5 мл супернатанта. Ресуспендируют в 2-3 мл Мочевой клеток-предшественников (СКП) среде и передать суспензии в 4-6 ямах ООНс покрытием 24-луночного планшета.
  5. После 72 ч, дополнить культуру с 0,5 мл свежей среды UPC на лунку и изменить среду каждые 2-3 дня после. Эритроциты и клетки плоского эпителия, которые не крепятся к плите будут удалены с изменениями среды.
  6. Монитор культуру через 4-6 дней.
    Примечание: малое 2-4 колонии клеток начнут появляться. Клетки будут округлые или удлиненные которые представляют типа I или типа II почечной эпителиальных (RE) клеток соответственно 3.
  7. Изменение среды каждые 2-3 дня, так как только возникают клетки, они будут проходить фазу быстрого расширения.
  8. После того, как клетки достигают 80-90% слияния, около 9-15 дней после посева, отделить и прохождение клетки (15,000-18,000 клеток / см 2) на 2-4 скважин 24-луночного планшета для дальнейшего расширения. Отметить этот, как мобильный прохождения 1 (P1).
  9. Охарактеризовать клетки мочи для характеристики клона на основе анализа проточной цитометрии, immunohistochemческих окрашивание или через обратной транскриптазы-полимеразной цепной реакции (ОТ-ПЦР).
  10. Перепрограммирование изолированных клеток мочи (раздел 4) или заморозить их в Замораживание Средняя (DMEM с добавлением 10% сыворотки и 10% ДМСО) для долгосрочного cryostorage.

4. Моча перепрограммирования клеток с помощью вируса Сендай

ПРИМЕЧАНИЕ: Правильное обращение и использование средств индивидуальной защиты (средства индивидуальной защиты) рекомендуют при манипулировании трансфицирующих агентов. Выполните следующие действия в стерильных условиях в BSL2 бокс биологической безопасности. Правильная утилизация трансфекции агент и / или трансфицированные клетки рекомендуется, чтобы избежать риска опасности окружающей среды и здоровья. Для перепрограммирования мочи клеток, используйте Сендай перепрограммирования Kit с изменениями фидерными зависит от протокола производителя, как описано ниже.

  1. Для обеспечения высокой перепрограммирование эффективности, используя вирус Сендай, использование каналы 1-5 клеток в моче, которые быстроделения LY. Если клетки не размножаются хорошо или стать стареющей, отказаться от них, поскольку они не будут перепрограммировать эффективно.
  2. Семена 60000 клеток на лунку в двух лунках 6-луночного планшета с. Отметить этот как День -2. Регулировка плотности посева клеток (5 × 10 4 - 9 х 10 4 клеток на лунку) в случае необходимости, чтобы достичь 80-90% слияния с днем 0.
  3. На день 0 (48 ч после посева клеток), подготовить для перепрограммирования векторы Сэндай (SEV), содержащие каждый из четырех факторов OSKM. Добавить каждый из векторов в 1 мл подогретого UPC среды. Используйте МВД 1-1,5 (5-7,5 х 10 5 CIU), что является достаточным для клеток перепрограммирования мочи. Аспирируйте среды и медленно добавить 1 мл UPC + Сев в одну лунку клеток мочи. Используйте вторую скважину в качестве отрицательного контроля трансдукции.
  4. В День 1, замените носитель UPC + Сев со свежими UPC среды. Некоторые гибель клеток наблюдали после 24 ч из-за вирусной цитотоксичности.
  5. В зависимости от эффективности перепрограммировать Clonе формирования и компактный морфология, держать ежедневно не изменяя среду до дня 6 или 7.
  6. За день до диссоциации трансдуцированных клеток (день 5 или 6), готовят MEF фидерных пластины при посеве Mitomycin-C (10 мкг / мл в течение 3 ч), обработанные-MEFs при плотности 5 х 10 4 клеток / см 2, на 0,1 % желатина покрытием 100 мм 2 чашки для культивирования.
  7. На следующий день (день 6 или 7), отделить клетки с 0,25% трипсина, клетки вновь суспендируют в UPC среды и пластины 5 х 10 4 - 2 х 10 5 клеток / 100 мм 2 MEF подачи пластины.
  8. На следующий день, переключитесь на HES среды и изменения среды каждый день. Соблюдайте клетки под микроскопом, чтобы контролировать, трансформированные клетки.
    ПРИМЕЧАНИЕ: клетки образуют клоновых агрегаты с характерным булыжной морфологии и имеющие более высокий ядро ​​для цитоплазматической отношения (12-18 дней после трансдукции).
  9. В течение двух-трех недель после трансдукции, выберите колонии и передать новым пластин для Clonаль расширение.
  10. Выполнение окрашивание живых клеток для отбора клонов Ipsc путем инкубации клеток с TRA-1-81 антитела в течение 1 ч при 37 ° С в СО 2 инкубатор с последующим окрашиванием счетчика с конкретным флуоресцентный краситель конъюгированного вторичного антитела в течение 1 ч при 37 ° С в СО 2 инкубатор.
  11. Используйте 26 G 1½ дюйма иглу в кросс-Hatch большие TRA-1-81 положительных клонов IPSC в небольшие равные части размера (4-6 штук в Clone).
  12. Используйте стерильной пипеткой-наконечник, чтобы выбрать и передача 10-20 заштрихованной части из нескольких клонов в каждую лунку Matrigel (10 мкг / см 2) -покрытие 24-луночного планшета с ГЭК среды.
    Примечание: Предметы из одного клона покрытием по отдельности в одной скважине не расширить или поддерживать плюрипотентность.
  13. Переход из HES в IPSC среды 24-48 ч после перепрограммировать клоны крепятся к поверхности Matrigel.
  14. Во время технического обслуживания на Matrigel пластинок, покрытых вручную ГКРВPE-от любых дифференцированные клетки или загрязняющих MEF фидерных клеток с использованием пипетки наконечник для обогащения полностью перепрограммировать и плюрипотентных дистрофических IPSC (MD-IPSC) клонов.
  15. После индивидуальные клоны достигли ~ 100 размер мкм, расширить клонов диссоциации с 0,48 мМ ЭДТА (этилендиаминтетрауксусной кислоты) раствора в течение 3 мин и покрытие небольших клеточных агрегатов на MD-ИПСК, взвешенные в IPSC среде (с добавлением 5 мкМ Y27632, Rho-киназы ) на свежие Матригель (10 мкг / см 2) с покрытием 12-луночный планшет. Изменить IPSC среды ежедневно.
  16. Полное перепрограммирование каждого клона могут быть определены как анализа экспрессии генов генов OSKM и иммуногистохимического окрашивания маркеров плюрипотентности (Oct3 / 4 и TRA-1-81). Строгая оценка плюрипотентности потенциала должны быть использованы для подтверждения полностью перепрограммировать линии IPSC могут дифференцироваться в трех зародышевых листков. Это может быть достигнуто либо путем эмбриоидного тела (EB) образование и дифференциацию анализа или терAtoma формирование анализ.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Большинство клеток-предшественников, выделенных из мочи человека являются позитивными для uroepithelial предшественников и перицитами маркеров, таких как CD44, CD73 и CD146 (97.37%, 97.09% и 97,3% соответственно; и 1В). Эти клетки также выразил другие маркеры мезенхимальных, такие как альфа-гладкой мускулатуры актина и виментина (рис 1б). Анализ RT-PCR свидетельствует о смешанной популяции клеток в культурах в том, что имеет место слабая экспрессия Цитокератин-7 (CK-7) и Uroplakin (UP) -IA и -IIIa, маркеры uroepithelial линии (рис 1в).

Шаги к перепрограммированию обобщаются схематично на рисунке 2А. Типичные изображения демонстрируют морфологию клеток при различных временных точках по всему протоколу (фиг.2В). Клетки мочи превратиться из удлиненные, клетки тип II (день 0) в шаблон булыжной (4-й день) в течение перепрограммирования. Ву 12-й день, типичные плюрипотентные клоны (IPSC) рассматриваются и в состоянии поддерживать свою плюрипотентных морфологии под фидерных свободных условиях (IPSC-P2). Живая окрашивание клеток для TRA-1-81 определяет перепрограммировать клонов (Рис 2С).

Чтобы подтвердить образование вектора и трансгенных свободный плюрипотентных клонов, ОТ-ПЦР проводят с использованием праймеров против вирусного генома SeV и каждый из экзогенных факторов OSKM. До-регулирование эндогенных факторов перепрограммирования также могут быть подтверждены в этом шаге. Выражение не экзогенный ген больше не обнаруживается проход-13, но повышающая регуляция эндогенных факторов видно (фиг.3А). Иммунофлуоресцентного окрашивание подтверждает плюрипотентность экспрессия маркеров на ИПСК (Oct3 / 4 и TRA-1-81, рисунок 3б). Эндогенную экспрессию гена перепрограммирование видно в клетках мочи, может привести эти клетки перепрограммировать при более высоких эффективностей 1, по сравнению с другими источниками соматических клеток. В Експрессия гена дистрофина и белка проверяется иммунофлуоресцентного, вестерн-блот (ВБ) и ОТ-ПЦР анализ (Фигура 3С-Е). Иммунофлуоресцентного окрашивание диких центральных блоков типа и ИПСК для дистрофина показывают очевидную ядерную локализацию 11 в ИПСК, но очень немногие UCS выраженное положительное (3С). Чтобы проверить дистрофина выражение в клетках, анализ иммуноблот для дистрофина показало, что повсеместное дистрофина изоформы (Dp71) является преобладающим изоформы производится в диких ИПСК типа, в то время как дистрофические иПСК отсутствует экспрессия гена дистрофина была обнаружить выражение Dp71 (рисунок и 3D). Экзон удаления мутации дистрофина могут быть подтверждены в дистрофических ИПСК с использованием специфических праймеров, фланкирующих удаленные экзонов. Нет ПЦР-амплификации не обнаружено в дистрофических ИПСК в то время как дикие иПСК типа демонстрируют дистрофина стенограмму усиление (рис 3e).

в-страницы = "Всегда"> Рисунок 1
Рисунок 1. Характеристика отдельных мочи клеток (ПСК) показывает uroepithelial прародителя, мезенхимальные и клоны гладких мышц. () Цитометрический анализ ПСК исследовали с сопряженными антител против uroepithelial и перицитов маркеры CD44, CD73 и CD146. (B) иммунофлуоресцентного окрашивания ПСК с CD44, αSMA и Виментин. (C) экспрессии генов профиль ПСК, слабое выражение CK-7 и UP-Iа и UP-IIIa по сравнению с образцами положительного контроля, а экспрессия гена альфа-гладкой мускулатуры актина (αSMA) сравнимо с положительным контролем. Пожалуйста, нажмите здесь для просмотра большего размера этой цифры.

Загрузка / 52032 / 52032fig2highres.jpg "ширина =" 700px "/>
Рисунок 2. Перепрограммирование UC для создания ИПСК. (А) Схема обзор перепрограммирования шкале. (B) изображений, представляющих различные морфологии ПСК в течение трансдукции Сев, в день 0 (SeV трансдукции), День 4 (морфологический переход), 12-й день (плюрипотентные клоны появляются на MEFs) и характерный IPSC клон под фидерных без условий (IPSC -p2 на Matrigel). (C) Живая съемка ячейка для TRA-1-81 для определения плюрипотентных колоний при 17 день. Пожалуйста, нажмите здесь, чтобы увидеть увеличенную версию этой цифры.

Рисунок 3
Рисунок 3. Генерация вирусного генома и трансгенного Бесплатный ИПСК. ()Анализ экспрессии генов показал присутствие в геноме SeV и OSKM трансгенов при прохождении 2 (Ipsc-P2) и их исчезновение по прохождении 13 (Ipsc-P13), а выражение эндогенный ген сохраняется в течение. (B) фазового контраста изображения и иммунофлюоресценции сравнению Oct3 / 4 и TRA-1-81 окрашивание центральных блоков и, как следствие ИПСК. (С) Дистрофин обнаружен с помощью иммунофлуоресценции в ИПСК дикого типа по сравнению с диким типом ПСК и (г) удельная дистрофина изоформы (Dp71) может быть подтверждено WB. Анализ (E) RT-PCR используется для подтверждения конкретного дистрофина экзона делеция в дистрофических ИПСК по сравнению с дикого типа центральных блоков и ИПСК. Пожалуйста, нажмите здесь, чтобы увидеть увеличенную версию этой цифры.

Название реагента / Материал / Оборудование Компания Номер по каталогу Комментарии
GAPDH-Forward Primer IDT Inc. Посл приведены в комментариях GTGGACCTGACCTGCCGTCT
GAPDH-обратный праймер IDT Inc. Посл приведены в комментариях GGAGGAGTGGGTGTCGCTGT
CK7-Forward Primer IDT Inc. Посл приведены в комментариях TGGTGCTGAAGAAGGATGTG
CK7-обратный праймер IDT Inc. Посл приведены в комментариях CACGCTGGTTCTTGATGTTG
Up-IA-праймера IDT Inc. Посл приведены в комментариях ACGTCCTACACCCACCGTGA
Up-IA-обратный праймер IDT Inc. Посл приведены в комментариях ACCCCACGTGTAGCTGTCGAT
Up-IIIA-праймера IDT Inc. Посл гИвен в комментариях ACAAACAGAGGGTGGGAGGA
CAG
Up-IIIA-обратный праймер IDT Inc. Посл приведены в комментариях AGAAGGGCAGGGAGCCCAGG
αSMA-Forward Primer IDT Inc. Посл приведены в комментариях ACCCACAATGTCCCCATCTA
αSMA-обратный праймер IDT Inc. Посл приведены в комментариях TGATCCACATCTGCTGGAAG
Oct3 / 4 (экзогенные) -Forward Primer * IDT Inc. * Жизнь Tech-Cytotune комплект CCCGAAAGAGAAAGCGAACCAG
Oct3 / 4 (экзогенные) -Reverse Primer * IDT Inc. * Жизнь Tech-Cytotune комплект AATGTATCGAAGGTGCTCAA
Sox2 (экзогенные) -Forward Primer * IDT Inc. * Жизнь Tech-Cytotune комплект ATGCACCGCTACGACGTGAG
CGC
Sox2 (экзогенные) -Reversе Primer * IDT Inc. * Жизнь Tech-Cytotune комплект AATGTATCGAAGGTGCTCAA
Klf4 (экзогенные) -Forward Primer * IDT Inc. * Жизнь Tech-Cytotune комплект TTCCTGCATGCCAGAGGAGCCC
Klf4 (экзогенные) -Reverse Primer * IDT Inc. * Жизнь Tech-Cytotune комплект AATGTATCGAAGGTGCTCAA
CMYC (экзогенные) -Forward Primer * IDT Inc. * Жизнь Tech-Cytotune комплект TAACTGACTAGCAGGCTTGTCG
CMYC (экзогенные) -Reverse Primer * IDT Inc. * Жизнь Tech-Cytotune комплект TCCACATACAGTCCTGGATGAT
GATG
SeV (экзогенные) -Forward Primer * IDT Inc. * Жизнь Tech-Cytotune комплект GGATCACTAGGTGATATCGAGC
SeV (экзогенные) -Reverse Primer * IDT Inc. * Жизнь Tech-Cytotune комплект CCAGACAAGAGTTTAAGAGA
TATGTATC
Oct3 / 4 (эндогенных) -Forward Primer IDT Inc. Посл приведены в комментариях CAGTGCCCGAAACCCACAC
Oct3 / 4 (эндогенных) -Reverse Primer IDT Inc. Посл приведены в комментариях GGAGACCCAGCAGCCTCAAA
Sox2 (эндогенных) -Forward Primer IDT Inc. Посл приведены в комментариях CAAGATGCACAACTCGGAGA
Sox2 (эндогенных) -Reverse Primer IDT Inc. Посл приведены в комментариях GTTCATGTGCGCGTAACTGT
Dystrophin-Forward Primer IDT Inc. Посл приведены в комментариях GGCAAAAACTGCCAAAAGAA
Dystrophin-обратный праймер IDT Inc. Посл приведены в комментариях GACCTGCCAGTGGAGGATTA

Таблица 1. Список PriМер последовательностей.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Моделирование сердечно-сосудистых заболеваний с помощью ИПСК становится общий подход, чтобы понять генетический вклад 4-6. Некоторые непредвиденные трудности получения образцов клеток у пациентов, особенно детей младшего возраста, можно избежать, предлагая возможность неинвазивного подхода, такие как сбор мочи. В этой молодой популяции пациентов, часто бывает трудно собрать объем мочи, достаточного для получения достаточного количества клеток в моче для перепрограммирования. Коучинг молодых пациентов пить больше жидкости за 30 мин до сбора мочи улучшает успех изоляции мочи клеток. Однако, повторите сбора мочи может быть необходимо в этой группе населения. Мы объединили и приспособлены две различные протоколы 3,7, с тем, чтобы оптимизировать развязку и культуру ПСК у пациентов с мышечной дистрофией.

Индуцированные плюрипотентные стволовые клетки были получены либо из фибробластов кожи или клеток мочи от мышечной дистрофии patienTS 1,2. Тем не менее, оба протокола перепрограммирования полагались на лентивирусы ввести факторы перепрограммирования в соматических клетках. Это интеграции вируса способ доставки может быть проблематичным, если трансген случайно интегрируется в геном хозяина и вызывает либо трансгенный реактивации или мутагенеза (обзор в 8). Таким образом, мы улучшены этих методов с использованием вирус Сендай дл трансдукции в OSKM трансгенов в клетках мочи в не интегрирующего образом 9.

Этот метод с использованием вируса Сендай перепрограммировать UCS предлагает преимущество не встраивается в подходе с более высокой эффективностью трансдукции 9,10. Моча клетки, собранные из мышечных больных дистрофии перепрограммировать в течение 2-3 недель после трансдукции. Эти перепрограммирования кинетика сопоставимы с UC перепрограммирования с использованием Lentiviral трансдукции 1. Хотя этот протокол можно масштабировать до установления подачи без метод перепрограммирования мочи клеток, бытьчисле эффективный метод, используя Сэндай вируса трансдукции клеток мочи, выделенных из мышечных больных дистрофией. Этот метод описан опирается на MEFs как фидерной слоя для того, чтобы полностью установить плюрипотентных MD клон До перехода фидерных условиях свободного при прохождении 2.

Ядерного распределение Dp71 изоформы белка дистрофина Уже давно установлено, в различных эмбриональных моделей клеточной стадии 11,12. Это повсеместно выражение Dp71 в ядерной матрицы фракции ранних предшественников / зачаточном состоянии клеток свидетельствует об их роли в области ядерной архитектуры и регуляции клеточного цикла 12. Наши перепрограммировать дикие иПСК типа выразить Dp71; Однако его отсутствие в дистрофических ИПСК не ингибирует перепрограммирование или плюрипотентных потенциал дистрофических клеток. В заключение отметим, что ген дистрофические мутации сохраняются в перепрограммировать ИПСК; что делает его эффективным инструментом для моделирования дистрофические кардиомиопатии.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Materials
4 Oz. Specimen Cup with Lid STL Medical Supply M9AMSAS340 For Urine Sample Collection
15 ml BD-Falcon Tubes Fisher Scientific 352097
50 ml BD-Falcon Tubes Fisher Scientific 352098
Round Glass Coverslips Fisher Scientific 12-545-81
CytoTune-iPS Sendai Reprogramming Kit Life Technologies A1378-001
PBS, pH 7.4 Life Technologies 10010-023
Pen-Strep w/o Glutamine  Life Technologies 15140-122 Warm in 37 °C water bath before use
RPMI Medium 1640 Life Technologies 11875-093 Warm in 37 °C water bath before use
B-27 Supplement w/Insulin (50x) Life Technologies 17504-044 Warm in 37 °C water bath before use
B-27 Supplement w/o Insulin (50x) Life Technologies 0050129SA Warm in 37 °C water bath before use
DMEM/F12 (1:1) Life Technologies 11330-032 Warm in 37 °C water bath before use
Versene, 1:5,000 Life Technologies 15040066 Warm in 37 °C water bath before use
bFGF (10 µg) Life Technologies 13256-029 Warm in 37 °C water bath before use
Cell Counter Cartridges Life Technologies C10228
Knockout Serum (500 ml Bottle) Life Technologies 10828-028 Warm in 37 °C water bath before use
Recovery Cell Culture Freezing Medium Life Technologies 12648-010
Keratinocyte-SFM (1x), Liquid Life Technologies 17005-042 Warm in 37 °C water bath before use
DMEM, High Glucose, Glutamax Life Technologies 10566-016 Warm in 37 °C water bath before use
Ham's F-12 Nutrient Mix  Life Technologies 11765-054 Warm in 37 °C water bath before use
EGF Recombinant Human Protein, Liquid Form Life Technologies PHG0311L Warm in 37 °C water bath before use
Insulin, Human Recombinant, Zinc Soln Life Technologies 12585-014 Warm in 37 °C water bath before use
TeSR-E8 Stem Cell Technologies 5940 Warm in 37 °C water bath before use
ROCK Inhibitor (Y-27632) Selleck S1049 Warm in 37 °C water bath before use
Matrigel BD Biosciences 354277 hESC Qualified Matrix, LVED Free
RNeasy Mini Kit  Qiagen 74104
iScript cDNA Synthesis Kit Bio-Rad 170-8890
DreamTaq Green PCR Master Mix (2x) Thermo-Scientific K1081
FBS-Qualified Sigma Aldrich F6178 Warm in 37 °C water bath before use
Adenine Bioreagent Sigma Aldrich A2786-5G Warm in 37 °C water bath before use
Cholera Toxin from Vibrio cholerae Sigma Aldrich C8052-.5MG Warm in 37 °C water bath before use
Hydrocortisone Sigma Aldrich H0888-1G Warm in 37 °C water bath before use
Holo-transferrin from human Sigma Aldrich T0665-50MG Warm in 37 °C water bath before use
3,3',5-Triiodo-L-thyronine sodium salt Sigma Aldrich T6397-100MG Warm in 37 °C water bath before use
DAPI  Santa Cruz Biotechnology SC-3598
Fluoromount Aquous mounting medium Sigma Aldrich F4680
16% Paraformaldehyde Alfa-Aesar 43368
Antibodies
Mouse anti CD44 - labeled with FITC  BD Biosciences 560977
Mouse anti CD146 - labeled with PE BD Biosciences 561013
Mouse anti CD73 - labeled with PE BD Biosciences 561014
Mouse anti-α-smooth muscle actin Sigma Aldrich A2547
Mouse anti-Vimentin Abcam ab8978-100
Mouse Anti - TRA-1-81 Life Technologies 411100
Rabbit anti Oct 3/4 Santa Cruz Biotechnology SC-9081
Mouse Anti Dystrophin Leica Biosystems NCL-DYSB

DOWNLOAD MATERIALS LIST

References

  1. Guan, X., et al. Dystrophin-deficient cardiomyocytes derived from human urine: New biologic reagents for drug discovery. Stem Cell Research. 12 (2), 467-480 (2014).
  2. Dick, E., et al. Exon Skipping and Gene Transfer Restore Dystrophin Expression in Human Induced Pluripotent Stem Cells-Cardiomyocytes Harboring DMD Mutations. Stem Cells Dev. 22 (20), 2714-2724 (2013).
  3. Zhou, T., et al. Generation of human induced pluripotent stem cells from urine samples. Nat Protoc. 7 (12), 2080-2089 (2012).
  4. Bellin, M., Marchetto, M. C., Gage, F. H., Mummery, C. L. Induced pluripotent stem cells: the new patient. Nat Rev Mol Cell Biol. 13 (11), 713-726 (2012).
  5. Carvajal-Vergara, X., et al. Patient-specific induced pluripotent stem-cell-derived models of LEOPARD syndrome. Nature. 465 (7299), 808-812 (2010).
  6. Sun, N., et al. Patient-Specific Induced Pluripotent Stem Cells as a Model for Familial Dilated Cardiomyopathy. Science Translational Medicine. 4 (130), 130ra147 (2012).
  7. Zhang, Y., et al. Urine derived cells are a potential source for urological tissue reconstruction. J Urol. 180 (5), 2226-2233 (2008).
  8. Bayart, E., Cohen-Haguenauer, O. Technological overview of iPS induction from human adult somatic cells. Curr Gene Ther. 13 (2), 73-92 (2013).
  9. Malik, N., Rao, M. S. A review of the methods for human iPSC derivation. Methods Mol Biol. 997, 23-33 (2013).
  10. Nakanishi, M., Otsu, M. Development of Sendai virus vectors and their potential applications in gene therapy and regenerative medicine. Curr. Gene Ther. 12 (5), 410-416 (2012).
  11. González-Ramírez, R., Morales-Lázaro, S. L., Tapia-Ramírez, V., Mornet, D., Cisneros, B. Nuclear and nuclear envelope localization of dystrophin Dp71 and dystrophin-associated proteins (DAPs) in the C2C12 muscle cells: DAPs nuclear localization is modulated during myogenesis. J Cell Biochem. 105 (3), 735-745 (2008).
  12. Villarreal-Silva, M., Centeno-Cruz, F., Suárez-Sánchez, R., Garrido, E., Cisneros, B. Knockdown of dystrophin Dp71 impairs PC12 cells cycle: localization in the spindle and cytokinesis structures implies a role for Dp71 in cell division. PloS One. 6 (8), e23504 (2011).

Tags

Медицина выпуск 95 биологии стволовых клеток мочи клеток полученных (UCS) индуцированные плюрипотентные стволовые клетки (ИПСК) перепрограммировать вирус Сендай (SeV) вирусный трансдукции IPSC полученных Кардиомиоциты (холодильников) регенеративная медицина мышечная дистрофия (MD ) дистрофические кардиомиопатия.
Генерация индуцированные плюрипотентные стволовые клетки мышечной дистрофией пациентов: эффективная интеграция без перепрограммирования мочи клеток, полученных
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Afzal, M. Z., Strande, J. L.More

Afzal, M. Z., Strande, J. L. Generation of Induced Pluripotent Stem Cells from Muscular Dystrophy Patients: Efficient Integration-free Reprogramming of Urine Derived Cells. J. Vis. Exp. (95), e52032, doi:10.3791/52032 (2015).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
Simple Hit Counter