This protocol entails detailed procedures for isolation of urine derived cells from muscular dystrophy patients; their efficient and rapid reprogramming through Sendai virus transduction.
Dystrophic cardiomyopathy is a poorly understood consequence of muscular dystrophy. Generating induced Pluripotent Stem Cells (iPSCs) from patients with muscular dystrophy is an invaluable cellular source for in vitro disease model systems and can be used for drug screening studies. Patient-derived urine cells have been used in successful reprogramming into induced pluripotent stem cells in order to model dystrophic cardiomyopathy1. Addressing the safety concerns of integrating vector systems, we present a protocol using a non-integrating Sendai virus vector for transduction of Yamanaka factors into urine cells collected from patients with muscular dystrophy. This protocol generates fully reprogrammed clones within 2–3 weeks. The pluripotent cells are vector-free by passage-13. These dystrophic iPSCs can be differentiated into cardiomyocytes and used either to study disease mechanisms or for drug screening.
Cardiomyopathy is the second leading cause of death in patients with Duchenne and Becker muscular dystrophy (MD). Although mutations in the X-linked dystrophin gene occur in 1:3,500 male births, very little is known about the molecular and cellular events leading to progressive cardiac muscle damage. Human induced pluripotent stem cells derived from muscular dystrophy patients have emerged as a novel tool to study the underlying disease mechanisms and to use for drug screening1,2.
The anticipated discomfort of skin biopsies or blood samples may dissuade young patients and/or their guardians to give consent for study participation. Urine samples are a non-invasive source of somatic cells that are amendable to reprogramming methods. We have recently shown that urine cells collected from muscular dystrophy patients may be cultured and efficiently reprogrammed into iPSCs using retroviral transduction with the Yamanaka factors (Oct3/4, Sox2, Klf4, and c-Myc; OSKM)1. The disadvantage of retroviral gene delivery is the random integration of the reprogramming genes into the host chromosomes. To overcome this limitation, we have used the non-integrating Sendai virus for urine cell reprogramming.
This protocol details the Sendai virus reprogramming of isolated urine cells from muscular dystrophy patients which can then be differentiated into cardiomyocytes or other cell types for further study. This protocol can also be adapted for other patient specific diseases.
NOTE: Patients and/or their guardians should give informed consent to participate in an Institutional Review Board approved study.
1. Buffers and Media Preparations
2. Urine Sample Collection
3. Isolation and Expansion of Urine Cells
NOTE: Perform the following steps under sterile conditions in a BSL2 Biological Safety Cabinet.
4. Urine Cell Reprogramming Using Sendai Virus
NOTE: The proper handling and the use of PPE (personal protective equipment) is recommended while manipulating the transfecting agents. Perform the following steps under sterile conditions in a BSL2 Biological Safety Cabinet. The proper disposal of transfecting agent and/or transfected cells is recommended to avoid risk of environmental and health hazards. For urine cell reprogramming, use a Sendai Reprogramming Kit with modifications to the manufacturer’s feeder-dependent protocol as detailed below.
Most progenitor cells isolated from human urine are positive for uroepithelial progenitor and pericyte markers such as CD44, CD73, and CD146 (97.37%, 97.09%, and 97.3% respectively; Figure 1A and 1B). These cells also expressed other mesenchymal markers such as alpha-smooth muscle actin and vimentin (Figure 1B). RT-PCR analysis gives evidence of a mixed population of cells in the cultures in that there is weak expression of Cytokeratin-7 (CK-7) and Uroplakin (UP)-Ia & -IIIa, markers of uroepithelial lineage (Figure 1C).
The reprogramming steps are summarized by schematic in Figure 2A. Representative images demonstrate the morphology of the cells during different time points throughout the protocol (Figure 2B). The urine cells transform from elongated, type II cells (Day 0) into a cobblestone pattern (Day 4) during reprogramming. By Day 12, typical pluripotent clones (iPSC) are seen and are able to maintain their pluripotent morphology under feeder free conditions (iPSC-P2). Live cell staining for TRA-1-81 identifies reprogrammed clones (Figure 2C).
To confirm the generation of vector and transgene free pluripotent clones, RT-PCR is performed using primers against the SeV viral genome and each of the exogenous OSKM factors. The up-regulation of endogenous reprogramming factors can also be confirmed at this step. The exogenous gene expression is no longer detected by passage-13, but the up-regulation of endogenous factors is seen (Figure 3A). Immunofluorescent staining confirms pluripotency marker expression on iPSCs (Oct3/4 and TRA-1-81; Figure 3B). The endogenous reprogramming gene expression seen in urine cells may lead these cells to reprogram at higher efficiencies1, as compared to other somatic cell sources. The expression of dystrophin gene and protein is verified by immunofluorescence staining, western blot (WB) and RT-PCR analyses (Figure 3C-E). Immunofluorescent staining of wild type UCs and iPSCs for dystrophin demonstrate evident nuclear localization11 in iPSCs, but very few UCs expressed positive (Figure 3C). To verify dystrophin expression in the cells, immunoblot analysis for dystrophin revealed that the ubiquitous dystrophin isoform (Dp71) is the predominant isoform produced in wild type iPSCs, while dystrophic iPSCs lacking dystrophin gene expression has undetectable Dp71 expression (Figure 3D). The exon deletion mutations of dystrophin can be confirmed in the dystrophic iPSCs using specific primers flanking the deleted exons. No PCR amplification is detected in the dystrophic iPSCs whereas wild type iPSCs demonstrate dystrophin transcript amplification (Figure 3E).
Figure 1. Characterization of isolated Urine Cells (UCs) shows uroepithelial progenitor, mesenchymal and smooth muscle lineages. (A) Flow cytometric analysis of UCs probed with conjugated antibodies against uroepithelial and pericyte markers CD44, CD73 and CD146. (B) Immunofluorescent staining of UCs with CD44, αSMA and Vimentin. (C) Gene expression profile of UCs show weak expression of CK-7 and UP-Ia and UP-IIIa as compared to positive control samples while gene expression of alpha-smooth muscle actin (αSMA) is comparable to positive control. Please click here to view a larger version of this figure.
Figure 2. Reprogramming of UC to generate iPSCs. (A) Schematic overview of the reprogramming timeline. (B) Images representing different morphologies of UCs during the SeV transduction, at Day 0 (SeV transduction), Day 4 (morphological transition), Day 12 (pluripotent clones emerging on MEFs) and the characteristic iPSC clone under feeder-free conditions (iPSC-P2 on Matrigel). (C) Live cell imaging for TRA-1-81 to identify pluripotent colonies at Day 17. Please click here to view a larger version of this figure.
Figure 3. Generation of Viral Genome and Transgene Free iPSCs. (A) Gene expression analysis shows the presence of the SeV genome and OSKM transgenes at passage 2 (iPSC-P2) and their disappearance by passage 13 (iPSC-P13) while endogenous gene expression persists throughout. (B) Phase contrast images and immunofluorescence comparing Oct3/4 and TRA-1-81 staining in UCs and resultant iPSCs. (C) Dystrophin is detected by immunofluorescence in wild-type iPSCs compared to wild-type UCs, and (D) the specific dystrophin isoform (Dp71) can be confirmed by WB. (E) RT-PCR analysis is used to confirm the specific dystrophin exon deletion in the dystrophic iPSCs compared to wild-type UCs and iPSCs. Please click here to view a larger version of this figure.
Name of Reagent/Material/Equipment | Company | Catalog Number | Comments |
GAPDH-Forward Primer | IDT Inc. | Seq given in comments | GTGGACCTGACCTGCCGTCT |
GAPDH-Reverse Primer | IDT Inc. | Seq given in comments | GGAGGAGTGGGTGTCGCTGT |
CK7-Forward Primer | IDT Inc. | Seq given in comments | TGGTGCTGAAGAAGGATGTG |
CK7-Reverse Primer | IDT Inc. | Seq given in comments | CACGCTGGTTCTTGATGTTG |
Up-Ia-Forward Primer | IDT Inc. | Seq given in comments | ACGTCCTACACCCACCGTGA |
Up-Ia-Reverse Primer | IDT Inc. | Seq given in comments | ACCCCACGTGTAGCTGTCGAT |
Up-IIIa-Forward Primer | IDT Inc. | Seq given in comments | ACAAACAGAGGGTGGGAGGA CAG |
Up-IIIa-Reverse Primer | IDT Inc. | Seq given in comments | AGAAGGGCAGGGAGCCCAGG |
αSMA-Forward Primer | IDT Inc. | Seq given in comments | ACCCACAATGTCCCCATCTA |
αSMA-Reverse Primer | IDT Inc. | Seq given in comments | TGATCCACATCTGCTGGAAG |
Oct3/4 (Exogenous)-Forward Primer* | IDT Inc. | *Life Tech-Cytotune kit | CCCGAAAGAGAAAGCGAACCAG |
Oct3/4 (Exogenous)-Reverse Primer* | IDT Inc. | *Life Tech-Cytotune kit | AATGTATCGAAGGTGCTCAA |
Sox2 (Exogenous)-Forward Primer* | IDT Inc. | *Life Tech-Cytotune kit | ATGCACCGCTACGACGTGAG CGC |
Sox2 (Exogenous)-Reverse Primer* | IDT Inc. | *Life Tech-Cytotune kit | AATGTATCGAAGGTGCTCAA |
Klf4 (Exogenous)-Forward Primer* | IDT Inc. | *Life Tech-Cytotune kit | TTCCTGCATGCCAGAGGAGCCC |
Klf4 (Exogenous)-Reverse Primer* | IDT Inc. | *Life Tech-Cytotune kit | AATGTATCGAAGGTGCTCAA |
cMyc (Exogenous)-Forward Primer* | IDT Inc. | *Life Tech-Cytotune kit | TAACTGACTAGCAGGCTTGTCG |
cMyc (Exogenous)-Reverse Primer* | IDT Inc. | *Life Tech-Cytotune kit | TCCACATACAGTCCTGGATGAT GATG |
SeV (Exogenous)-Forward Primer* | IDT Inc. | *Life Tech-Cytotune kit | GGATCACTAGGTGATATCGAGC |
SeV (Exogenous)-Reverse Primer* | IDT Inc. | *Life Tech-Cytotune kit | ACCAGACAAGAGTTTAAGAGA TATGTATC |
Oct3/4 (Endogenous)-Forward Primer | IDT Inc. | Seq given in comments | CAGTGCCCGAAACCCACAC |
Oct3/4 (Endogenous)-Reverse Primer | IDT Inc. | Seq given in comments | GGAGACCCAGCAGCCTCAAA |
Sox2 (Endogenous)-Forward Primer | IDT Inc. | Seq given in comments | CAAGATGCACAACTCGGAGA |
Sox2 (Endogenous)-Reverse Primer | IDT Inc. | Seq given in comments | GTTCATGTGCGCGTAACTGT |
Dystrophin-Forward Primer | IDT Inc. | Seq given in comments | GGCAAAAACTGCCAAAAGAA |
Dystrophin-Reverse Primer | IDT Inc. | Seq given in comments | GACCTGCCAGTGGAGGATTA |
Table 1. List of Primer Sequences.
Modeling cardiovascular diseases using iPSCs is becoming a common approach to understand the genetic contribution4-6. Some unanticipated difficulties of obtaining cell samples from patients, especially young children, can be avoided by offering the option of a non-invasive approach such as a urine collection. In this young patient population, it is often difficult to collect a volume of urine sufficient to yield enough urine cells for reprogramming. Coaching the young patients to drink fluids 30 min prior to the urine collection improves the success of urine cell isolation. However, repeat urine collections may be necessary in this population. We have combined and adapted two different protocols3,7 in order to optimize the isolation and culture of UCs from patients with muscular dystrophy.
Induced pluripotent stem cells have been generated from either skin fibroblasts or urine cells from muscular dystrophy patients1,2. However, both reprogramming protocols relied on lentiviruses to introduce the reprogramming factors into the somatic cells. This integrating virus delivery method can be problematic if the transgene randomly integrates into the host genome and causes either transgene reactivation or mutagenesis (reviewed in 8). Therefore, we improved upon these techniques by using the Sendai virus to transduce the OSKM transgenes into the urine cells in a non-integrating manner9.
This method using Sendai virus to reprogram UCs offers the advantage of a non-integrating approach with a higher transduction efficiency9,10. Urine cells collected from muscular dystrophy patients are reprogrammed within 2–3 weeks post-transduction. These reprogramming kinetics are comparable to UC reprogramming using lentiviral transduction1. Although this protocol can be scaled to establish feeder-free method for urine cell reprogramming, being an efficient method using Sendai-virus transduction of urine cells isolated from muscular dystrophy patients. This method described relies on MEFs as a feeder-layer in order to fully establish the pluripotent MD clone prior to transfer to feeder-free conditions at passage 2.
The nuclear distribution of the Dp71 isoform of the dystrophin protein has long been established in different embryonic stage cell models11,12. This ubiquitous expression of Dp71 in nuclear matrix fraction of early progenitor/embryonic stage cells suggests their role in nuclear architecture and cell cycle regulation12. Our reprogrammed wild type iPSCs express Dp71; however, its absence in dystrophic iPSCs does not inhibit the reprogramming or pluripotent potential of dystrophic cells. In conclusion, the dystrophic gene mutations are conserved in reprogrammed iPSCs; making it an efficient tool to model dystrophic cardiomyopathy.
The authors have nothing to disclose.
Development of this protocol was supported by the Advancing a Healthier Wisconsin and the National Center for Advancing Translational Sciences, National Institutes of Health, through Grant Number 8UL1TR000055. Its contents are solely the responsibility of the authors and do not necessarily represent the official views of the NIH.
List of Materials | |||
Name of Reagent/Material/Equipment | Company | Catalog Number | Comments |
4 Oz. Specimen Cup with Lid | STL Medical Supply | M9AMSAS340 | For Urine Sample Collection |
15 mL BD-Falcon Tubes | Fisher Scientific | 352097 | |
50 mL BD-Falcon Tubes | Fisher Scientific | 352098 | |
Round Glass Coverslips | Fisher Scientific | 12-545-81 | |
CytoTune-iPS Sendai Reprogramming Kit | Life Technologies | A1378-001 | |
PBS, pH 7.4 | Life Technologies | 10010-023 | |
Pen-Strep w/o Glutamine | Life Technologies | 15140-122 | Warm in 37 °C water bath before use |
RPMI Medium 1640 | Life Technologies | 11875-093 | Warm in 37 °C water bath before use |
B-27 Supplement w/Insulin (50x) | Life Technologies | 17504-044 | Warm in 37 °C water bath before use |
B-27 Supplement w/o Insulin (50x) | Life Technologies | 0050129SA | Warm in 37 °C water bath before use |
DMEM/F12 (1:1) | Life Technologies | 11330-032 | Warm in 37 °C water bath before use |
Versene, 1:5000 | Life Technologies | 15040066 | Warm in 37 °C water bath before use |
bFGF (10 µg) | Life Technologies | 13256-029 | Warm in 37 °C water bath before use |
Cell Counter Cartridges | Life Technologies | C10228 | |
Knockout Serum (500 mL Bottle) | Life Technologies | 10828-028 | Warm in 37 °C water bath before use |
Recovery Cell Culture Freezing Medium | Life Technologies | 12648-010 | |
Keratinocyte-SFM (1X), Liquid | Life Technologies | 17005-042 | Warm in 37 °C water bath before use |
DMEM, High Glucose, Glutamax | Life Technologies | 10566-016 | Warm in 37 °C water bath before use |
Ham's F-12 Nutrient Mix | Life Technologies | 11765-054 | Warm in 37 °C water bath before use |
EGF Recombinant Human Protein, Liquid Form | Life Technologies | PHG0311L | Warm in 37 °C water bath before use |
Insulin, Human Recombinant, Zinc Soln | Life Technologies | 12585-014 | Warm in 37 °C water bath before use |
TeSR-E8 | Stem Cell Technologies | 5940 | Warm in 37 °C water bath before use |
ROCK Inhibitor (Y-27632) | Selleck | S1049 | Warm in 37 °C water bath before use |
Matrigel | BD Biosciences | 354277 | hESC Qualified Matrix, LVED Free |
RNeasy Mini Kit | Qiagen | 74104 | |
iScript cDNA Synthesis Kit | Bio-Rad | 170-8890 | |
DreamTaq Green PCR Master Mix (2X) | Thermo-Scientific | K1081 | |
FBS-Qualified | Sigma Aldrich | F6178 | Warm in 37 °C water bath before use |
ADENINE BIOREAGENT | Sigma Aldrich | A2786-5G | Warm in 37 °C water bath before use |
CHOLERA TOXIN FROM VIBRIO CHOLERAE | Sigma Aldrich | C8052-.5MG | Warm in 37 °C water bath before use |
HYDROCORTISONE | Sigma Aldrich | H0888-1G | Warm in 37 °C water bath before use |
HOLO-TRANSFERRIN FROM HUMAN | Sigma Aldrich | T0665-50MG | Warm in 37 °C water bath before use |
3,3',5-TRIIODO-L-THYRONINE SODIUM SALT | Sigma Aldrich | T6397-100MG | Warm in 37 °C water bath before use |
DAPI | Santa Cruz Biotechnology | SC-3598 | |
Fluoromount Aquous mounting medium | Sigma Aldrich | F4680 | |
16% Paraformaldehyde | Alfa-Aesar | 43368 | |
List of Antibodies | |||
Name of Reagent/Material/Equipment | Company | Catalog Number | Comments |
Mouse anti CD44 – labelled with FITC | BD Biosciences | 560977 | |
Mouse anti CD146 – labelled with PE | BD Biosciences | 561013 | |
Mouse anti CD73 – labelled with PE | BD Biosciences | 561014 | |
Mouse anti-α-smooth muscle actin | Sigma Aldrich | A2547 | |
Mouse anti-Vimentin | Abcam | ab8978-100 | |
Mouse Anti – TRA-1-81 | Life Technologies | 411100 | |
Rabbit anti Oct 3/4 | Santa Cruz Biotechnology | SC-9081 | |
Mouse Anti Dystrophin | Leica Biosystems | NCL-DYSB |