A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Functional Complementation Analysis (FCA): A Laboratory Exercise Designed and Implemented to Supplement the Teaching of Biochemical Pathways

17.5K views

DOI:

10.3791/53850

June 24th, 2016

In This Article

Summary

The validation of enzymatic activities involved in biochemical pathways can be elucidated using functional complementation analysis (FCA). Described in this manuscript is the FCA assay demonstrating the enzymatic activity of enzymes involved in the metabolism of amino acids, bacterial stringent response and bacterial peptidoglycan biosynthesis.

Abstract

Functional complementation assay (FCA) is an in vivo assay that is widely used to elucidate the function/role of genes/enzymes. This technique is very common in biochemistry, genetics and many other disciplines. A comprehensive overview of the technique to supplement the teaching of biochemical pathways pertaining to amino acids, peptidoglycan and the bacterial stringent response is reported in this manuscript. Two cDNAs from the model plant organism Arabidopsis thaliana that are involved in the metabolism of lysine (L,L-diaminopimelate aminotransferase (dapL) and tyrosine aminotransferase (tyrB) involved in the metabolism of tyrosine and phenylalanine are highlighted. In addition, the bacterial peptidoglycan anabolic pathway is highlighted through the analysis of the UDP-N-acetylmuramoyl-L-alanyl-D-glutamate-meso-2,6-diaminopimelate ligase (murE) gene from the bacterium Verrucomicrobium spinosum involved in the cross-linking of peptidoglycan. The bacterial stringent response is also reported through the analysis of the rsh (relA/spoT homolog) bifunctional gene responsible for a hyper-mucoid phenotype in the bacterium Novosphingobium sp. Four examples of FCA are presented. The video will focus on three of them, namely lysine, peptidoglycan and the stringent response.

Introduction

Functional complementation in the context of elucidating the function(s)/role(s) of a gene is defined as the ability of a particular homologous or orthologous gene to restore a particular mutant with an observable phenotype to the wild-type state when the homologous or orthologous gene is introduced in cis or trans into the mutant background. This technique has been widely used to isolate and identify the function(s)/role(s) of many genes. One particular example is the isolation and identification of orotidine-5-phosphate decarboxylase from Candida albicans using the ura3 mutant of S. cerevisiae and the pyrF mutant of E. coli.1 The authors have used this technique to elucidate the function of genes that are involved in the metabolism of amino acids, peptidoglycan and the stringent response in their research programs and have incorporated this technique into their teaching programs in the Biotechnology and Molecular Bioscience (BMB) program at the Rochester Institute of Technology (RIT).

The authors teach Fundamentals of Plant Biochemistry/Pathology (FPBP) (Hudson) and Bioseparations: Principles and Practices (BPP) (Hudson/Savka), two upper division elective laboratory based courses in the BMB Program at the RIT. Since some of the topics that are discussed in the courses are affiliated with their research interests, the authors have incorporated many of the techniques and experimental tools that are used in their respective research programs into these two laboratory-based courses. One such example is functional complementation as a laboratory exercise to reinforce the lecture materials pertaining to amino acid metabolism from plants, peptidoglycan and the stringent response metabolism from bacteria.

Three of the amino acid pathways from plants that are discussed in the FPBB course are that of lysine (lys), tyrosine (tyr) and phenylalanine (phe). The lys pathway is highlighted in the course because of the importance of the amino acid as an essential amino acid for all animals particularly humans since animals lack the genetic machinery to synthesize lys de novo. In addition, it was recently discovered that plants employ a pathway for the synthesis of lys that is significantly different from that of bacteria. This discovery was partially facilitated by functional complementation of the E. coli diaminopimelate (dap) mutants using a gene that encodes the enzyme L,L-diaminopimelate aminotransferase (DapL) from the model plant Arabidopsis thaliana.2 The variant pathways for the synthesis of lys through the intermediate diaminopimelate are shown in Figure 1. In addition, the synthesis of lys facilitates through the aspartate derived family of amino acids which is highly regulated.3 In addition to their importance in protein synthesis, the pathways for tyr and phe are highlighted given their importance in serving as precursor compounds for the anabolism of phenylpropanoid compounds involved the synthesis of plant defense compounds such as: alkaloids, lignins, flavonoids, isoflavonoids, hydroxycinnamic acid among others.4 The tyr and phe pathways are also highlighted to show the difference between the plant and bacterial anabolic pathways. In bacteria, the enzyme tyrosine aminotransferase (TyrB) is involved in the anabolism of both amino acids, whereas in plants, the enzyme is primarily involved in the catabolism of tyr and phe and is not involved in the anabolism of these amino acids. (Figure 2).4

The differences between Gram positive and Gram negative bacteria regarding the structure of peptidoglycan (PG) are highlighted in the FPBP course. The PG of Gram negative bacteria is of interest regarding plant pathology based on to the fact that most plant pathogens are Gram negative. A recent review regarding the top 10 bacterial phyto-pathogens revealed that all are Gram negative. The bacteria were from the genera: Pseudomonas, Ralstonia, Agrobacterium, Xanthomonas, Erwinia, Xylella, Dickeya and Pectobacterium.5 One of the chemical differences when comparing the PG stem of Gram negative and Gram positive bacteria is the difference between the cross-linking amino acids of both types. The initial step for that different cross-linking of PG occurs in the cytoplasmic step of PG anabolism and is facilitated by the enzyme UDP-N-acetylmuramoyl-L-alanyl-D-glutamate-meso-2,6-diaminopimelate ligase (MurE) (Figure 3A). MurE catalyzes the addition of a particular diamine compound at third position of the peptide stem.6 In most Gram negative bacteria, the penultimate lys precursor, meso-diaminopimelate (m-DAP) serves as the cross-linking amino acid and lys serves the same role in the PG of most Gram positive bacteria (Figure 3B).7 This is due to the fact that both m-DAP and lys possess two amine groups and are capable of forming two peptide bonds for peptide stem cross-linking.

In the Bioseparations: Principles and Practices (BPP) course, the differences between open and closed systems for the cultivation of bacteria and how nutrient levels will change significantly in both systems due to environmental changes are discussed. These events are linked to regulatory changes called a "shift down" or "shift up" triggered by starvation or an adequate supply of amino acids or energy. The "shift down" response can occur when a bacterial culture is transferred from a rich and complex medium to a chemically defined medium with a single carbon source. This change in environment leads to the rapid cessation of tRNA and rRNA synthesis. This cessation results in the lack of ribosomes, protein and DNA synthesis even though the biosynthesis of amino acids are upregulated.

Following the "shift down" response, the existing ribosomes are used to produce new enzymes to synthesize the amino acids no longer available in the medium or environment. After a period of time, rRNA synthesis and new ribosomes are assembled and the population of bacterial cells begins to grow although at a reduced rate. The course of events is termed the "stringent response" or "stringent control" and is an example of global cellular regulation and can be thought of as a mechanism for adjusting the cell's biosynthetic machinery to compensate for the availability of the required substrates and energy needs.8 The stringent response thus enables bacteria to respond rapidly to fluxes of nutrients in the environment and contributes and enhances the ability of bacteria to compete in environments that can change rapidly with regards to nutrient and or substrate availability.8-9

The stringent response has an integral role in gene expression when the availability of amino acids, carbon, nitrogen, phosphate, and fatty acids are limited.8,10-14 This stringent response is coordinated by two nucleotides, guanosine tetraphosphate (ppGpp) and guanosine pentaphosphate (pppGpp) commonly referred together as the alarmone (p)ppGpp. For example, when amino acids are limited-which can lead to a bottleneck in protein synthesis-the alarmone, guanosine 3,5-(bis) pyrophosphate (ppGpp), derived from anabolism of guanosine 3-diphosphate 5-triphosphate (pppGpp) accumulates in the cell. The change in (p)ppGpp level is involved in expression of genes that regulate the response to overcome the lack of substrates in the environment that are directly involved in cell growth and development. Two of the genes that are involved in this process are called relA and spoT. RelA is a ribosome-associated (p)ppGpp synthetase that is involved in the response to the accumulation of uncharged tRNAs that is the result of amino acid limitation. SpoT functions as a bifunctional (p)ppGpp synthetase and hydrolase. The synthetase activity of SpoT is involved in the response to the lack of carbon and fatty acid starvation.8 The RelA/SpoT homologs are widespread in plants and bacteria and are referred to as Rsh for RelA/SpoT homologs.8,10-12,16 A recent manuscript showed that there is a specific Rsh protein involved in the synthesis of these alarmones from the bacterium Novosphingobium sp Rr 2-17.17

Here we present four biochemical pathways tethered to the functional complementation assays. The complementation assays outlined in this manuscript provides an avenue to explore employing this in vivo assay as a means of identifying and or characterizing enzymes that are predicted to have unknown/putative function(s) or as teaching tools to supplement the teaching of biochemical pathways.

Access restricted. Please log in or start a trial to view this content.

Protocol

NOTE: The authors are willing to provide bacterial strains and recombinant plasmids to facilitate the incorporation of functional complementation analysis for teaching purposes for individuals who are interested. The plasmids that were used to facilitate functional complementation experiments are listed in Table 1.

1. Construction of Plasmids for Functional Complementation

  1. Cloning of Diaminopimelate Aminotransferase (dapL) for Functional Complementation.
    1. Amplify the dapL open reading frame (ORF) from the V. spinosum and cDNAs from A. thaliana and C. reinhardtii by PCR. Use 1 cycle at 94 °C for 2 min, followed by 30 cycles of 94 °C for 15 sec, 60 °C for 30 sec and 72 °C for 2 min. Include 12 pmoles of each primer, 1 mM MgSO4, 0.5 mM each of the 4 deoxynucleotide triphosphates, and 0.5 ng of template DNA and 1 unit of Pfx DNA polymerase.
      NOTE: The complete description pertaining to the recombinant cloning of three dapL orthologs from the plant A. thaliana (At-dapL), the bacterium Verrucomicrobium spinosum (Vs-dapL) and the alga Chlamydomonas reinhardtii (Cr-dapL) has been previously published.2,18-20
      NOTE: The primers used for the cloning of the dapL orthologs are as follows:
      VsdapL F- 5'-CCCCGAATTCATGGCCCTCATCAACGAAAACTTCCTCAAG-3'
      VsdapL R 5'- CCCCGTCGACCTACTTCAGCGCGGCGATACGGCGGCAGAC-3'
      AtdapL F- 5'-GGGGCATTGGAAGGAGATATAACCATGGCAGTCAATACTTGCAAATGT-3'
      AtdapL R-5'- GGGGGTCGACTCATTTGTAAAGCTGCTTGAATCTTCG-3'
      CrdapL F-5'-CCCCCGAATTCATGCAGCTCAACGTGCGGTCCACCGCCAGC-3'
      CrdapL R-5'- CCCCCAAGCTTCTAGTTACGCTTGCCGTAGGCCTCCTTAAA-3'
    2. Clone the PCR fragments into the plasmid pET30A to produce the recombinant plasmids, pET30A::VsdapL, pET30A::AtdapL and pET30A::CrdapL using the primers, restriction enzymes and T4 DNA ligase.
      1. Briefly, incubate 50 ng of insert and 20 ng of vector in 1x ligase buffer and 1 unit of T4 DNA ligase overnight at 17 °C. Transform ligation into E. coli Dh5α cells and screen for colonies on LB plates supplemented with 50 µg/ml−1 kanamycin by incubating at 37 °C for 24 hr.18-20
    3. To create the plasmid for functional complementation, digest pET30A::VsdapL and pET30A::AtdapL plasmids with the restriction enzymes XbaI and SalI and XbaI and HindIII for the pET30A::CrdapL. Ligate the inserts into the plasmid pBAD33 using T4 DNA ligase to produce the plasmids pBAD33::VsdapL; pBAD33::AtdapL and pBAD33::CrdapL.
      1. Incubate 50 ng of insert and 20 ng of vector in 1x ligase buffer and 1 unit of T4 DNA ligase overnight at 17 °C. Transform ligation into E. coli Dh5α cells and screen for colonies on LB plates supplemented with 34 µg/ml−1 kanamycin by incubating 37 °C for 24 hr.20
  2. Cloning of Tyrosine Aminotransferase (tyrB) from A. thaliana for Functional Complementation.
    NOTE: The complete details regarding the cloning of the cDNA from A. thaliana annotated by the locus tags At5g36160 has been described previously.4
    1. Amplify the cDNA by PCR. Use 1 cycle at 94 °C for 2 min, followed by 30 cycles of 94 °C for 15 sec, 60 °C for 30 sec and 72 °C for 2 min. Include 12 pmoles of each primer, 1 mM MgSO4, 0.5 mM each of the four deoxynucleotide triphosphates, and 0.5 ng of template DNA and 1 unit of Pfx DNA polymerase.
      NOTE: The primers used for the cloning of the At5g36160 are as follows:
      AttyrB F- 5'-CCCCGAATTCATGGGAGAAAACGGAGCCAAGCGAT-3'
      AttyrB R- 5'- CCCCGAATTCATGGGAGAAAACGGAGCCAAGCGAT-3'
    2. Clone the fragment into the plasmid pET30A to produce the recombinant plasmids pET30A::At5g36160 by digesting the PCR fragment with EcoR1 and Sal1; ligate in the fragment into pET30A using T4 DNA ligase as described below.4
    3. To create the functional complementation plasmid, digest the pET30A::At5g36160 with the restriction enzymes XbaI and HindIII, and ligate the insert into pBAD33 using the same restriction enzyme sites to produce the recombinant plasmid pBAD33::At5g3160 using T4 DNA ligase.
      1. Incubate 50 ng of insert and 20 ng of vector in 1x ligase buffer and 1 unit of T4 DNA ligase overnight at 17 °C. Transform the ligation into E. coli Dh5α cells and screen for colonies on LB plates supplemented with 34 µg/ml−1 chloramphenicol by incubating 37 °C for 24 hr.4
  3. Cloning of UDP-N-acetylmuramoyl-L-alanyl-D-glutamate-meso-2,6-diaminopimelate Ligase (murE) from V. spinosum for Functional Complementation.
    NOTE: The cloning of the murE ORF from V. spinosum has been described previously.18
    1. Amplify the open reading frame by PCR. Use 1 cycle at 94 °C for 2 min, followed by 30 cycles of 94 °C for 15 sec, 60 °C for 30 sec and 72 °C for 2 min. Include 12 pmoles of each primer, 1 mM MgSO4, 0.5 mM each of the four deoxynucleotide triphosphates, 0.5 ng of template DNA and 1 unit of Pfx DNA polymerase. Then clone into the plasmid pET100D to produce the plasmid pET100D::VsmurE.
      NOTE: The primers used for the cloning of the VsmurE are as follows:
      VsMurE F- 5'- CACCATGACCATTTTGCGCGATCTTATCGAGGGT -3'
      VsMurE R- 5'- GTCGACTCACTGACGGTCATCCCTCCTTTGGCGTGC-3'
    2. To produce the plasmid for functional complementation, digest the pET100D::VsmurE
      With the restriction enzymes XbaI and Sal1 and ligate the insert into pBAD33 to produce the recombinant plasmid pBAD33::VsmurE using T4 DNA ligase.
      1. Incubate 50 ng of insert and 20 ng of vector in 1x ligase buffer, along with 1 unit of T4 DNA ligase, overnight at 17 °C. Transform ligation into E. coli Dh5α cells and screen for colonies on LB plates supplemented with 34 µg/ml−1 chloramphenicol by incubating 37 °C for 24 hr.8
  4. Cloning of relA/spoT (rsh) from Novosphingobium sp for Functional Complementation.
    NOTE: The cloning of the rsh from Novosphingobium sp. has been described previously.17
    1. Amplify the rsh ORF in addition to 599 nucleotides upstream of the initiation start site and 46 nucleotides downstream at the termination site by PCR. Use 1 cycle at 94 °C for 2 min, followed by 30 cycles of 94 °C for 15 sec, 60 °C for 30 sec and 72 °C for 2 min. Include 12 pmoles of each primer, 1 mM MgSO4, 0.5 mM each of the four deoxynucleotide triphosphates, 0.5 ng of template DNA and 1 unit of Taq DNA polymerase. Then clone into the plasmid pCR2.1 to produce pCR2.1::Nsprsh.
      1. Incubate 1 µl of amplified PCR fragment, 1 µl of pCR2.1 vector, 1 µl of salt solution and 1 µl of water. Incubate at 25 °C for 5 min and 2 µl of ligation into E. coli cells, and screen for colonies on LB plates supplemented with 50 µg/ml−1 kanamycin by incubating 37 °C for 24 hr.
        NOTE: The primers used for the cloning of the rsh are as follows:
        rsh F- 5'- GTTGAAAAACGCCGAATAGC -3'
        rsh R- 5'- GAGACCTGTGCGTAGGTGGT -3'
      2. For functional complementation, digest the plasmid pCR2.1::Nsprsh with EcoR1 and ligate the insert into the broad host range pRK290 to produce the recombinant plasmid pRK290::Nsprsh using T4 DNA ligase.
        1. Incubate 50 ng of insert and 20 ng of vector in 1x ligase buffer and 1 unit of T4 DNA ligase overnight at 17 °C. Transform ligation into E. coli Dh5α cells and screen for colonies on LB plates supplemented with 10 µg/ml−1 tetracycline by incubating 37 °C for 24 hr.17

2. Preparation of Electro-competent Bacterial Cells to Facilitate Transformation

NOTE: The preparation of electro-competent cells is based on the protocol 26 for 1.0 L of culture that can be scaled down to a smaller volume (i.e., 250 ml). Please note that this protocol can be used to make all the strains competent that are described in this manuscript to facilitate FCA.22

  1. Inoculate 50 ml of liquid medium with a single colony into a flask and grow over night, making sure to check the genotype of the mutant before commencing this step (Table 2).
  2. On day two, inoculate 1.0 L of the appropriate medium (LB for E. coli mutants and PD for Novosphingobium sp) with the 50 ml of the overnight culture, and grow to an OD600 to 0.4-0.6 (log phase) at 30 °C.
  3. Harvest cells by centrifuging at 5,000 x g for 15 min at 4 °C, decant the supernatant, and resuspend the pellet in 500 ml of sterile ice-cold pure H2O.
  4. Centrifuge the cells at 5,000 x g for 20 min at 4 °C, decant the supernatant and resuspend the pellet in 250 ml of sterile ice-cold 10% glycerol.
  5. Centrifuge the cells at 5,000 x g for 20 min at 4 °C, decant the supernatant, and resuspend the pellet in 2.0 ml of 10% glycerol.
  6. Aliquot the cells by transferring 50 µl into micro-centrifuge tubes and immediately freeze by placing the tubes in a dry-ice-ethanol bath. Store the competent cells at -80 °C for electroporation.

3. Electroporation of Bacterial Cells with Complementation Plasmids

  1. For electroporation, add 1.0 µl (10-50 ng) of recombinant plasmid to an aliquot (50 µl) of competent cells and place on ice for 5 min.
  2. Transfer the mixture via pipetting to an electroporation cuvette and set the electroporation apparatus to the following setting: 25 µF capacitance, 2.5 kV, and 200 ohm resistance and deliver a pulse.
  3. Add 1.0 ml of recovery media (LB) to the electroporation cuvette and transfer using a pipette to a 15 ml conical tube. Recover with gentle rotation for 60 min in a shaking incubator.
  4. Plate 100 µl of the culture from the recovery step onto the agar plates to select for transformants by pipetting and spreading using a sterile spreader.
    NOTE: Make sure to check Table 1 and Table 2 before commencing this step to check the antibiotics and genotypes to make the proper agar plates.

4. Transformation of AOH1 to Facilitate Functional Complementation Using L,L-diaminopimelate Aminotransferase (dapL)

  1. For complementation analysis, transform AOH1 with the empty vector (pBAD33), and with the DapL expression vectors in separate transformation events using the electroporation protocol outlined in section 3.0.
  2. Select transformants by plating on LB agar medium supplemented with 50 µg/ml−1 DAP and 34 µg/ml−1 chloramphenicol and 50 µg/ml−1 kanamycin.
  3. Test for functional complementation by replica-plating colonies by streaking onto LB medium with 0.2% (w/v) arabinose with and without 50 µg/ml−1 DAP and 34 µg/ml−1 kanamycin.
  4. Incubate plates at 30 °C for 24 hr and observe results.
    NOTE: The result should show that the mutant is only able to grow on DAP free media only when the dapL gene is expressed in the mutant background when compared to the vector only control.

5. Transformation of TKL-11 to Facilitate Functional Complementation Using UDP-N-acetylmuramoylalanyl-D-glutamyl-2,6-meso-diaminopimelate Ligase (murE)

  1. Transform the mutant with the empty vector (pBAD33) and with the MurE expressing vector (pBAD33::VsmurE) using the protocol outlined in section 3.0.
  2. Plate and select transformants on LB agar medium supplemented with 50 µg/ml−1 thymine and 34 µg/ml−1 chloramphenicol and incubate the plates at 30 °C for 24 hr.
  3. Test for complementation by streaking or plating colonies from both the control and the experimental transformations onto two LB medium plus 0.2% (w/v) arabinose and 50 µg/ml−1 thymine.
  4. Incubate one plate at 30 °C and the other at 42 °C for 24 hr to visually assess the growth phenotype.
    NOTE: The results should show that the mutant is able to grow at 42 °C only when the murE gene is expressed in the mutant background compared to the vector only control.

6. Transformation of DL39 to Facilitate Functional Complementation Using Tyrosine Aminotransferase (tyrB)

  1. Transform DL39 with either pBAD33 or pBAD33::At5g36160, and select transformants on LB agar plates supplemented with 50 µg/ml−1 tyrosine, 50 µg/ml−1 phenylalanine, and 34 µg/ml−1 chloramphenicol using the protocol outlined in section 3.0.
  2. Replica-plate colonies on minimal (M9) media with 50 µg/ml−1 phenylalanine and 50 µg/ml−1 tyrosine, 50 µg/ml−1 aspartate, 50 µg/ml−1 leucine, 50 µg/ml−1valine, 50 µg/ml−1 isoleucine, 10 µg/ml−1 uracil 0.5% (w/v) glycerol, 0.2% (w/v) arabinose. Also replica-plate colonies on plates lacking phenylalanine and tyrosine by streaking the same colony of both plates.
  3. Incubate plates at 30 °C for 48 hr to observe growth phenotype.
    NOTE: The result should show that the mutant is only able to grow on phenylalanine and tyrosine free media, only when the tyrB gene is expressed in the mutant background when compared to the vector only control.

7. Transformation of Hx699 to Facilitate Functional Complementation of the Hypomucoid Phenotype of Novosphingobium sp. Strain Hx699

  1. Transform wild-type strain Novosphingobium sp. (Rr2-17) and the mutant Hx699 with pRK290 and pRK290::rshNsp in 2 separate transformation events using the transformation protocol outlined in section 3.0.
  2. Plate the transformations on potato dextrose (PD) agar supplemented with 10 µg/ml−1 tetracycline, and incubate for at least 24 hr or until transformants appear.
  3. Streak both transformations in an "X" pattern on fresh PD agar plates and incubate at 30 °C for at least 4 days. Observe the phenotypes of the vector only, and experiment by visually examining the growth phenotype of both plates.
    NOTE: The result should show that the hypo-mucoid phenotype is complemented when rsh is expressed in the mutant background when compared to the vector only control.

Access restricted. Please log in or start a trial to view this content.

Results

The bacterial strains that are employed in the various functional complementation analyses are listed in Table 2.

Functional complementation analysis: L,L-diaminopimelate aminotransferase (dapL)

The E. coli double mutant AOH1dapD::Kan2, dapE6) harbors a mutation in the dapE gene and a complete deletion of the dapD gene (

Access restricted. Please log in or start a trial to view this content.

Discussion

Many of the courses that are integral to the Biotechnology and Molecular Bioscience curriculum at the Rochester Institute of Technology have a laboratory component in addition to the lecture portion of the course. The curriculum for the academic year 2014-2015 contains a total of 48 courses, 29 of which contain a laboratory component which represent approximately 60%. One such course is Fundamentals of Plant Biochemistry and Pathology (FPBP), a blended lecture/ laboratory course and Bioseparations: Principles and Practic...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors declare that they have no competing financial interests.

Acknowledgements

AOH and MAS acknowledges the College of Science and the Thomas H. Gosnell School of Life Sciences at the Rochester Institute of Technology for support. This work was supported in part by United States National Science Foundation (NSF) award to AOH MCB-1120541.

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
E. coli mutantsHudson/Savka lab or CGSC (http://cgsc.biology.yale.edu/)
ElectroporatorBiorad-USA1652100
Electroporation CuvettesBiorad-USA1652082
Temperature controlled incubatorGeneric
MicrocentrifugeGeneric
Luria AgarThermofisher Scientific22700025
Luria BrothThermofisher Scientific12795084
M9 MediumSigma-Aldrich63011
Potato Dextrose MediumFisher Scientfic DF0013-15-8
KanamycinSigma-AldrichK1377
DiaminopimelateSigma-Aldrich92591
ThymineSigma-AldrichT0376
ChloramphenicolSigma-AldrichC0378
TyrosineSigma-AldrichT3754
PhenlylalanineSigma-AldrichP2126
AspartateSigma-AldrichA9256
ValineSigma-AldrichV0500
LeucineSigma-AldrichL8000
IsoleucineSigma-AldrichI2752
UracilSigma-AldrichU0750
GylcerolSigma-AldrichG5516
ArabinoseSigma-AldrichA3256
TetracylineSigma-Aldrich87128
Taq DNA polymeraseThermofisher Scientific10342-020
Platinum pfx DNA polymeraseThermofisher Scientific11708-013
T4 DNA ligaseThermofisher Scientific15224-041
E. coli Dh5-alphaThermofisher Scientific18258012
E. coli Top10Thermofisher ScientificC4040-03
pET100D/topo vectorThermofisher ScientificK100-01
pCR2.1 VectorThermofisher ScientificK2030-01

References

  1. Gillum, A. M., Tsay, E. Y., Kirsch, D. R. Isolation of the Candida albicans gene for orotidine-5'-phosphate decarboxylase by complementation of S. cerevisiae ura3 and E. coli pyrF mutations. Mol Gen Genet. 198, 179-182 (1984).
  2. Hudson, A. O., Singh, B. K., Leustek, T., Gilvarg, C. An L,L-diaminopimelate aminotransferase defines a novel variant of the lysine biosynthesis pathway in plants. Plant Physiol. 140, 292-301 (2006).
  3. Jander, G., Joshi, V. Aspartate-derived amino acid biosynthesis in Arabidopsis thaliana. The Arabidopsis Book. Last, R. L. , American Society for Plant Biologists. Rockville, MD. (2009).
  4. Prabhu, P., Hudson, A. O. Identification and partial characterization of an L-Tyrosine aminotransferase from Arabidopsis thaliana. Biochemistry Research International. , 549572(2010).
  5. Mansfield, J., Genin, S., Magori, S., Citovsky, V., Sriariyanum, M., Ronald, P., Dow, M., Verdier, V., Beer, S. V., Machado , M. A., Toth, I., Salmond, G., Foster, G. D. Top 10 pathogenic bacteria in molecular pathology. Molecular Plant Pathology. 13, 614-629 (2012).
  6. McGroty, S. E., Pattaniyil, D. T., Patin, D., Blanot, D., Ravichandran, A. C., Suzuki, H., Dobson, R. C., Savka, M. A., Hudson, A. O. Biochemical Characterization of UDP-N-acetylmuramoyl-L-alanyl-D-glutamate: meso-2,6-diaminopimelate ligase (MurE) from Verrucomicrobium spinosum DSM 4136T. PLoS ONE. 8 (6), e66458(2013).
  7. Hutton, C. A., Perugini, M. A., Gerrard, J. A. Inhibition of lysine biosynthesis: an evolving antibiotic strategy. Mol Biosyst. 3, 458-465 (2007).
  8. Potrykus, K., Cashel, M. (p)ppGpp: still magical. Annu Rev Microbiol. 62, 35-51 (2008).
  9. Dalebroux, Z. D., Svensson, S. L., Gaynor, E. C., Swanson, M. S. ppGpp Conjures Bacterial Virulence. Microbiology and Molecular Biology Reviews. 74, 171-199 (2010).
  10. Cashel, M., Gentry, D. J., Hernandez, V. J., Vinella, D. The stringent response. Escherichia coli and Salmonella typhimurium: cellular and molecular biology. Neidhardt, F. C., Curtiss, R. III, Ingraham, J. L., Lin, E. C. C., Low, K. B., Magasanik, B., Reznikoff, W. S., Riley, M., Schaechter, M., Umbarger, H. E. , 2nd, ASM Press. Washington, DC. 1458-1496 (1996).
  11. Chatterji, D., Ojha, A. K. Revisiting the stringent response, ppGpp and starvation signaling. Curr. Opin. Microbiol. 4, 160-165 (2001).
  12. Jain, V., Kumar, M., Chatterji, D. ppGpp: stringent response and survival. J. Microbiol. 44, 1-10 (2006).
  13. Kramer, G. F., Baker, J. C., Ames, B. N. Near-UV stress in Salmonella typhimurium: 4-thiouridine in tRNA, ppGpp, and pppGpp as components of an adaptive response. J. Bacteriol. 170, 2344-2351 (1988).
  14. Braeken, K., Moris, M., Daniels, R., Vanderleyden, J., Michiels, J. New horizons for (p)ppGpp in bacterial and plant physiology. Trends Microbiol. 14, 45-54 (2006).
  15. Joseleau-Petit, D., Vinella, D., D'Ari, R. Metabolic alarms and cell division in Escherichia coli. J. Bacteriol. 181, 9-14 (1999).
  16. Mittenhuber, G. Comparative genomics and evolution of genes encoding bacterial (p) ppGpp synthetases/hydrolases (the Rel, RelA, and SpoT proteins). J. Mol. Microbiol. Biotechnol. 3, 585-600 (2001).
  17. Gan, H. M., Buckley, L., Szegedi, E., Hudson, A. O., Savka, M. A. Identification of an rsh Gene from a Novosphingobium sp. Necessary for Quorum-Sensing Signal Accumulation. J. Bacteriol. 191, 2551-2560 (2009).
  18. Nachar, V. R., Savka, F. C., McGroty, S. E., Donovan, K. A., North, R. A., Dobson, R. C., Buckley, L. J., Hudson, A. O. Genomic and biochemical analysis of the diaminopimelate and lysine biosynthesis pathway in Verrucomicrobium spinosum: Identification and partial characterization of L,L-diaminopimelate aminotransferase and UDP-N-acetylmuramoylalanyl-D-glutamyl-2,6-meso-diaminopimelate ligase. Front. Microbiol. 3, 183(2012).
  19. Hudson, A. O., Giròn, I., Dobson, R. C. J. Crystallization and preliminary X-ray diffraction analysis of L,L-diaminopimelate aminotransferase (DapL) from Chlamydomonas reinhardtii. Acta Cryst. 67, 140-143 (2011).
  20. Dobson, R. C. J., Gir òn, I., Hudson, A. O. L,L-Diaminopimelate Aminotransferase from Chlamydomonas reinhardtii: A Target for Algaecide Development. PLoS ONE. 6 (5), e20439(2011).
  21. Guzman, L. M., Belin, D., Carson, M. J., Beckwith, J. Tight regulation, modulation, and high-level expression by vectors containing the arabinose pBAD promoter. J. Bacteriol. 177, 4121-4130 (1995).
  22. Sambrook, J., Russell, D. W. Molecular Cloning: A laboratory manual. , 3rd, Cold Spring Harbor Laboratory Press. New York. (2001).
  23. Lugtenberg, E. J., van Schijndel-van Dam, A. Temperature-sensitive mutants of Escherichia coli K-12 with low activity of the diaminopimelic acid adding enzyme. J. Bacteriol. 110, 41-46 (1972).
  24. Mavrides, C., Orr, W. Multispecific aspartate and aromatic amino acid aminotransferases in Escherichia coli. J. Biol Chem. 250, 4128-4133 (1975).
  25. Gelfand, D. H., Steinberg, R. A. Escherichia coli mutants deficient in the aspartate and aromatic amino acid aminotransferases. J. Bacteriol. 130, 429-440 (1977).
  26. Whitaker, R. J., Gaines, C. G., Jensen, R. A. A multispecific quintet of aromatic aminotransferases that overlap different biochemical pathways in Pseudomonas aeruginosa. J. Biol Chem. 257, 13550-13556 (1982).
  27. Raskin, D. M., Judson, N., Mekalanos, J. J. Regulation of the stringent response in the essential function if the conserved bacterial G protein CgtA in Vibrio cholera. Proc Natl Acad Sci, USA. 104, 4636-4641 (2007).
  28. Ditta, G., Stanfield, S., Corbin, D., Helinski, D. R. Broad host range DNA cloning system for Gram-negative bacteria: construction of a gene bank of Rhizobium meliloti. Proc Natl Acad Sci, USA. 77, 7347-7351 (1980).
  29. Watanabe, A., Suzuki, M., Ujiie, S., Gomi, K. Purification and enzymatic characterization of a novel β-1,6-glucosidase from Aspergillus oryzae. J Biosci Bioeng. , (2015).
  30. Song, J. T., Lu, H., McDowell, J. M., Greenberg, J. T. A key role for ALD1 in activation of local and systemic defenses in Arabidopsis. Plant J. 40, 200-212 (2004).
  31. Rost, B., Liu, J., Nair, R., Wrzeszczynski, K. P., Ofran, Y. Automatic prediction of protein function. Celuular and Molecular Life Sciences. 60, 2637-2650 (2003).
  32. Norris, S. R., Shen, X., Penna, D. D. Complementation of the Arabidopsis pds1 mutation with the gene encoding p-Hyrdoxyphenylpyruvate dioxygenase. Plant Physiol. 117, 1317-1323 (1998).
  33. Mohler, W. A., Blau, H. M. Gene expression and cell fusion analyzed by lacZ complementation in mammalian cells. Proc Natl Acad Sci, USA. 93, 12423-12427 (1996).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Tags

Enzyme Activity AssayGene Function AnalysisElectroporation TransformationBacterial Mutant SelectionIn Vivo ConditionsAmino Acid MetabolismPeptidoglycan SynthesisStringent Response PathwayArabidopsis Thaliana