Login processing...

Trial ends in Request Full Access Tell Your Colleague About Jove

Developmental Biology

Мембранный потенциал монокристалла монокристалла в живых эмбрионах данио

doi: 10.3791/55297 Published: June 26, 2017
* These authors contributed equally

Introduction

Анализ системных компонентов in vivo позволяет ученым наиболее достоверно исследовать клеточное поведение. Это особенно справедливо, когда на исследуемую активность в значительной степени влияют взаимодействия клеток и клеток (как контактные, так и бесконтактные), как в нервной системе, где изменения напряжения мембраны приводят к общению между возбудимыми клетками. Понимание информации, закодированной этими электрическими сигналами, является ключом к пониманию того, как нервная система работает как в физиологических, так и в болезненных состояниях.

Для изучения электрических свойств клеток в самых неинвазивных физиологических условиях недавно были разработаны несколько генетически закодированных индикаторов напряжения 1 . В отличие от предыдущих поколений оптических датчиков напряжения (в основном чувствительных к напряжению красителей) 2 , GEVI позволяют проводить анализ in vivo интактной нейронной системы иИх выражение может быть ограничено конкретными типами клеток или группами.

Зародыш рыбок данио - это «субстрат» in vivo, чтобы воспользоваться большим потенциалом, связанным с GEVI. Фактически, благодаря своей оптической ясности и упрощенной, но эволюционно консервативной нервной системе, модель данио дает возможность простой идентификации и манипулирования каждым сотовым компонентом в сети. Действительно, применение GEVI Mermaid 3 на основе FRET привело к идентификации предсимптомных изменений поведения спинного моторного нейрона в модели бокового склероза далеких дам (ALS) 4 .

В следующем протоколе in vivo описано, как контролировать электрические свойства нейронов спинного мозга в интактных эмбрионах рыбок данио, выражающих Русалку в нейроно-специфическом манере. Более того, он демонстрирует, как фармакологически индуцированный чанGes в таких электрических свойствах могут быть связаны с изменением частоты эмбриональных спонтанных обмоток, стереотипной двигательной активности, которая характеризует поведение движения рыбок данио на самых ранних стадиях развития.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Генерация плазмиды pHuC_Mermaid

ПРИМЕЧАНИЕ. Русалка - это биосенсор, созданный путем спаривания домена, чувствительного к напряжению (VSD) Ciona intestinalis (теперь Ciona robusta ) 5 датчиков напряжения, содержащих фосфатазу (Ci-VSP) с партнером FRET-флуорофорами Umi-Kinoko Green (mUKG: донор) и мономерной версией оранжево-флуоресцентного белка Kusabira Orange (mKOk: акцептор). Для этого биодатчика конформационные изменения домена VSD, вызванные деполяризацией мембраны, увеличивают близость донорных и акцепторных флуоресцентных белков, тем самым увеличивая перенос энергии между ними (увеличивая отношение FRET) 3 . VSD обеспечивает эффективную локализацию биосенсора на плазматической мембране. Нейронная экспрессия биосенсора (в спинном мозге, сигнал обнаруживается как в интернейронах, так и в моторных нейронах) достигается путем клонирования Mermaid opEn frame (ORF) под пан-нейронным промотором Zeb 6 .

  1. Амплифицировать путем полимеразной цепной реакции (ПЦР) ORM русалки из плазмиды pCS4 + Mermaid 3 с ДНК-полимеразой Pfu (корректура) с использованием универсального праймера T3 и праймера Mermaid Sma I (5'TATCCCGGGATTCGACGGTTCAGATTTTA), чтобы вставить рестрикционный сайт Sma I вверх по течению От ORF Русалки.
    1. Используйте следующую смесь ПЦР: 0,5 мкл ДНК-полимеразы Пфу, 7,5 мкл специфического 10-бутового буфера, 1 мкл 10 мМ dNTP, 2,5 мкл диметилсульфоксида (ДМСО), 0,5 мкл (50 нг) препарата плазмиды и 1 мкл Мкл 20 мкМ исходных растворов каждого праймера в общем объеме 50 мкл.
    2. Нагревают смесь ПЦР в течение 15 с при 95 ° С, заправляют ее в течение 15 с при 50 ° С и удлиняют ее в течение 4 мин при 72 ° С в течение всего 35 циклов.
  2. Гель-очистить конкретный тупойПЦР-продукт с использованием коммерческого набора для очистки геля в соответствии с протоколом производителя.
  3. Клонировать фрагмент ДНК в тупой вектор pCMV-SC по протоколу производителя.
  4. Линеаризуют плазмиду, положительную по Mermaid (названную pCMV-SC_Mermaid) с рестрикционным ферментом Sma I для последующего введения промотора HuC.
    1. Настройте реакцию рестрикции следующим образом: 0,5 мкл (10 U) рестрикционного фермента Sma I, 2 мкл набора 10x буфера и 5 мкг плазмидной ДНК в общем объеме 20 мкл. Инкубируйте реакцию при 25 ° С в течение 1 часа.
  5. Гель-очистить расщепленную плазмиду, используя коммерческий набор для очистки геля по протоколу производителя.
  6. ПЦР-амплифицируют HuC-промотор (pHuC), ДНК-полимеразу Pfu и геномную ДНК данио-рыбок в качестве матрицы, используя пару HuC-специфических праймеров (HuCprom-forw1_SalI: 5'-GTAGTCGACCAGACTTGTCAAAAGGGTCCA и HuCproM-rev1: 5'-TCCATTCTTGACGTACAAAGATG) и охватывая область в 13050 пар вверх по течению от ATG.
    1. Настроить смесь ПЦР, используя следующую схему: 0,5 мкл ДНК-полимеразы Pfu, 7,5 мкл специфического 10-кратного буфера, 1 мкл 10 мМ dNTP, 2,5 мкл ДМСО, 200 нг геномной ДНК и 1 мкл 20 мкМ Исходные растворы каждого праймера в общем объеме 50 мкл.
    2. После начальной стадии 2 мин при 95 ° С нагревают ПЦР-смесь в течение 15 с при 95 ° С, заправляют ее в течение 15 с при 50 ° С и удлиняют ее в течение 4 мин при 72 ° С в течение всего 35 циклов ,
  7. Гель-очистите специфический тупой продукт ПЦР с использованием коммерческого набора для очистки геля в соответствии с протоколом производителя.
  8. Лигируют эквимолярное количество очищенного pCMV-SC_Mermaid (стадия 1.5) и ДНК pHuC (этап 1.7) с использованием 1 мкл ДНК-лигазы T4 и 1 мкл специфического 10X-буфера в общем объеме 10 мкл. Инкубируйте реакцию в течение 16 ч при4 ° С.
  9. Превратите аликвоту компетентных клеток с 5 мкл реакции лигирования (шаг 1.8) в соответствии с инструкциями производителя.
  10. Выберите pHuC-положительные клоны (pHuC_Mermaid) промотором, вставленным в правильную ориентацию двойным расщеплением Sal I- Eco RV (сайт рестрикции Sal I был вставлен перед фрагментом промотора на стадии 1.6, тогда как сайт рестрикции Eco RV Расположен ниже по потоку от области полиаденилирования PolyA плазмиды pCMV-SC).
    1. Настройте реакцию рестрикции следующим образом: 0,5 мкл (10 U) как рестрикционных ферментов Sal I, так и Eco RV, 2 мкл набора 10X-буфера и 1 мкг ДНК pHuC_Mermaid в общем объеме 20 мкл. Инкубируйте реакцию при 37 ° С в течение 1 часа. Запустите реакции на агарозный гель.

2. Микроинъекция эмбрионов

  1. Перенести удобренные, напримерGs, полученных из штамма дикого типа (AB) или Sod1-G93R для взрослых рыбок данио 4 в 10-миллиметровую чашку Петри с использованием пластиковой пипетки.
  2. Промойте эмбрионы в холодной (4 ° C) рыбной воде и сразу же микроинъектируйте их в желток с 200 пг плазмиды pHuC_Mermaid с использованием микроинъектора (полное и подробное описание процедуры микроинъекции см. В ссылках 7 и 8).
  3. Используя пластиковую пипетку, перенесите эмбрионы в чашку Петри и инкубируйте их в рыбной воде при 28 ° C до тех пор, пока они не достигнут желаемой стадии развития (20-24 ч после оплодотворения, hpf) для следующих анализов.

3. Спонтанный анализ намотки хвоста

ПРИМЕЧАНИЕ. Оцените спонтанное поведение намотки хвоста у эмбрионов 20-24 hpf с или без лекарственного рилузола.

  1. Перенесите эмбрион в 90-миллиметровую круглую чашку Петри, наполненную рыбной водой, содержащую 0,2% ДМСО (машина рилузола), и вручную дехронизируйте ее с помощью twO щипцы ювелира с острыми кончиками. Инкубируйте эмбрион в течение 5 мин.
  2. Обнаружение хвостового намотки при RT в течение 1 мин видеозаписи с использованием цифровой камеры, установленной на стереомикроскопе. Приобретите временные ряды с временным разрешением 30 кадров / с.
  3. Рассчитайте частоту спонтанных хвостовых обмоток, подсчитав количество изгибов (как контралатеральных, так и ипсилатеральных) за единицу времени.
  4. Чтобы оценить влияние препарата рилузол, осторожно используйте пластиковую пипетку Пастера для переноса эмбриона на новую миску Петри 90 мм, наполненную рыбной водой, содержащей 5 мкМ рилузола.
    1. Инкубируйте эмбрион в течение 5 минут перед записью 1-минутного видео и проведением поведенческого анализа, как указано выше.

4. Настройка изображения для визуализации визуализации Mermaid Biosensor в живых эмбрионах: одновременное обнаружение сигналов донора и акцептора

  1. Установите эмбрионы 20 - 24 hpf в 1% агарозу с низкой температурой плавления в воде рыбы на37 ° C внутри 35-миллиметровой стеклянной тарелки. Ориентируйте эмбрионы по бокам. Подождите, пока агароза застынет при комнатной температуре.
  2. Перенесите изображение на тарелку перевернутого конфокала, установленного на инвертированном микроскопе. Определите двигательные нейроны, выражающие биосенсор с 20-кратным увеличением (0,7 числовая апертура, NA) путем возбуждения mUKG с длиной волны 488 нм аргонового лазера и регистрации его излучения между 495 и 525 нм.
  3. Для измерения FRET возбудите mUKG, донора пары FRET, с длиной волны 488 нм. Одновременно обнаруживают с резонансным сканером, работающим на частоте 8000 Гц в двунаправленном режиме, флуоресценцию, излучаемую донором (между 495 и 525 нм) и флуоресценцию, излучаемую акцептором mKOk (между 550 и 650 нм, каналом FRET). Если возможно, используйте лазер с длиной волны 473 нм.
    ПРИМЕЧАНИЕ. Эффективность возбуждения донора будет несколько снижена (85% вместо 93% с 488 нм), но перекрестное возбуждение акцептора будет(От 17% с 488 нм до 9% с лазерной линией 473 нм).
  4. Чтобы уменьшить фототоксичность и отбеливание флуорофором, минимизируйте освещенность образца, уменьшив мощность лазерной линии (на окне пути луча программного обеспечения для сбора данных).
  5. Оптимизируйте возбуждение для соответствия параметрам усиления и смещения, которые заданы в начале эксперимента и сохраняются постоянными на протяжении всего сеанса. Чтобы установить смещение, измените цвет изображения на значения интенсивности (используя таблицу поиска Q), а при сканировании с выключенным лазером поверните ручку смещения (умное смещение) так, чтобы фоновые пиксели слегка увеличились Выше нуля. С помощью той же справочной таблицы, включив лазер во время сканирования, поверните ручку усиления (интеллектуальное усиление), чтобы максимизировать отношение сигнал / шум, избегая насыщенных пикселей.
  6. Используя открытые отверстия (2 воздушные единицы), приобретайте 16-битные изображения, чтобы обеспечить достаточный динамический диапазон для количественногоАнализов. Избегайте усреднения, чтобы увеличить скорость сбора и минимизировать фотообесцвечивание.
  7. В окне получения программного обеспечения в раскрывающемся меню выберите размер поля изображения размером 512 x 64 пикселя (размер пикселя: 605 нм).
  8. В окне режима сбора данных выберите xyt (время простоя на одной плоскости xy) в раскрывающемся меню и запишите изменения в напряжении нейронного нерва эмбриона, приобретя одну плоскость xy, установив параметры сбора для записи одного изображения каждые 30 Мс в течение 1 мин.
  9. Чтобы оценить влияние введения рилузола на деполяризацию мембран в одном и том же нейроне, приобретите новый набор данных через 5 мин после добавления рыбной воды, содержащей 5 мкМ рилузола.
  10. Для анализа FRET используйте макрос ImageJ Biosensor_FRET (выражающий одноцепочечные биосенсоры FRET.
  11. Оцените соотношение FRASE базальной мембраны каждого нейрона при t 1 как ((среднее значение FRET - фон FRET) / (средний уровень донора - фон донора)), где FRET и DonИли средняя интенсивность - средняя интенсивность флуоресценции, вычисленная в той же интересующей области (ROI), проведенной вокруг ячейки для каждого полученного канала, а FRET и фон донора - средняя интенсивность флуоресценции, рассчитанная в ROI поля зрения без флуоресцентного образца.
    ПРИМЕЧАНИЕ. Подробное пошаговое описание использования плагина можно найти на веб-сайте www.med.unc.edu/microscopy/resources/imagej-plugins-and-macros/biosensor-fret .
  12. Используйте графическое программное обеспечение для сравнения частоты, амплитуды и продолжительности деполяризации между различными экспериментальными парадигмами. Сравните две группы, используя непарный t- критерий Стьюдента, и считайте средние значения статистически различными при P <0,05.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Экспрессирующий вектор, несущий кодирующую последовательность биосенсора на основе FRET на основе FRET под контролем пан-нейронального промотора pHuC, который стимулирует синтез белка исключительно в нервной системе, доставляли в одноцелевые оплодотворенные яйца с помощью микроинъекции в Для получения переходных трансгенных эмбрионов ( рис. 1 , Левая панель). После освоения метода микроинъекции процент положительных эмбрионов на Mermaid был близок к 100%. Среди них были рассмотрены только эмбрионы, выражающие правильное количество биосенсора Mermaid на плазматической мембране для анализа FRET / получения изображения.

Спонтанные спирали, двигательные реакции, которые состоят исключительно из полного сокращения тела, приводящего кончик хвоста к голове 9 , 10 , были записаны на этапе 20-24 hpf в обычной рыбной среде ( рис. 1 , центральная панель и видео 1 ) и после инкубации в 5 мкМ рилузола ( видео 2 ). Статистический анализ изменений частоты спонтанных хвостовых обмоток, вызванных лекарственным рилузолом, сообщается в другом месте 4 .

Чтобы проверить, были ли изменения электрической активности нейронов спинного мозга в основе индуцированных рилузолом изменений частоты спонтанного нависания, мембранный потенциал в эмбриональных спинальных моторных нейронах изучался неинвазивным образом, измеряя интенсивность флуоресценции Отношение пары доноров / акцепторов FRET биосенсора Mermaid (отношение FRET: Рисунок 1 , правая панель). Были идентифицированы первичные спинальные моторные нейроны, экспрессирующие биосенсор ( рис. 2А ), и были зарегистрированы их базальные спонтанные деполяризационные активности ( Ng> Рисунок 2B и Видео 3 и 4 ). Вместе с уменьшением частоты движений намотки хвоста администрация рилузола уменьшала частоту спонтанных событий деполяризации ( рис. 2C ).

Рисунок 1
Рисунок 1: Схема работы экспериментальной процедуры. Эмбрионы с одной клеткой собирают и немедленно микроинъектируют плазмидой pHuC_Mermaid, чтобы экспрессировать биосенсор Mermaid FRET-напряжения в пан-нейронном режиме. При 20-24 hpf с инкубацией при 28 ° C одиночные эмбрионы переносятся под стереомикроскоп, и их спонтанная активность намотки хвоста, с и без лекарственного рилузола, присутствующего в рыбной воде, записывается и анализируется видео. Те же эмбрионы подвергаются анализу FRET in vivo для измерения изменений потенциала мембран моторных нейронов.Href = "http://ecsource.jove.com/files/ftp_upload/55297/55297fig1large.jpg" target = "_ blank"> Нажмите здесь, чтобы просмотреть увеличенную версию этого рисунка.

фигура 2
Рисунок 2: Анализ FRET в Vivo для измерения изменений мембранного потенциала моторного нейрона. ( A ) эмбрионы дикого типа данио с мозаичной экспрессией биосенсора на основе FRET Mermaid в спинальном нейроне. (A) Изображение яркого поля показывает площадь ствола данио, идентифицированную черным ящиком (sc: спинной мозг, мс: myoseptum, m: myotome). Накладывая на (a) обнаруженный сигнал флуоресценции (b), можно четко визуализировать эффективную экспрессию биосенсора в первичном спинальном двигательном нейроне (ПМ). Показанный донор (c) и обнаруженный канал FRET (d) показаны с соответствующими зелеными и пурпурными поисковыми таблицами (LUT)на правой стороне. Все эмбрионы установлены в черепно-каудальной ориентации. Шкала шкалы = 10 мкм. ( B ) Карта отношения FRET показывает коэффициент FRET, рассчитанный каждые 0,03 с в одном и том же двигательном нейроне. Он показывает основную спонтанную деполяризационную активность, которую подвергается клетке. Для биосенсора Mermaid увеличение коэффициента FRET происходит, когда потенциал мембраны увеличивается. Шкала шкалы = 10 мкм. ( C ) Типичный пример спонтанных средних изменений отношения FRET, происходящих в спинальном моторном нейроне эмбриона Sod1-G93R рыбок данио в течение 1 мин записи. Применение рилузола снижает частоту спонтанной деполяризации. Нажмите здесь, чтобы просмотреть увеличенную версию этого рисунка.

Фильм 1
Фильм 1:Спонтанная хвостовая намотка в 24-hpf диких тимберных эмбрионах . Репрезентативная запись, показывающая спонтанное намотку хвоста в эмбрионе эмбриона дикого типа 24 hpf, инкубированном в рыбной воде. Нажмите здесь, чтобы посмотреть это видео. (Щелкните правой кнопкой мыши, чтобы загрузить.)

Фильм 2
Фильм 2: Спонтанная хвостовая намотка в 24- hpf диризловом дирижале Дикого типа . Репрезентативная запись, показывающая спонтанное накопление хвоста в эмбрионе дикого типа с 24 hpf, инкубированном в 5 мкмоль рилузола (+ R). По сравнению с контролем, эмбрионы + R показали значительное снижение частоты спонтанного поведения наматывания хвоста на 24 hpf. Нажмите здесь, чтобы посмотреть это видео. (RigHt-click для загрузки.)

Фильм 3
Фильм 3: базальная спонтанная деполяризация активности первичного моторного нейрона в спинном мозге дикого типа эмбрионов-данио на 20 ч. Биосенсор Mermaid настолько чувствителен, что он может обнаруживать быстрые изменения потенциала мембран моторных нейронов в спинномозговых клетках интактных эмбрионов. Нажмите здесь, чтобы посмотреть это видео. (Щелкните правой кнопкой мыши, чтобы загрузить.)

Фильм 4
Фильм 4: Спонтанная деполяризация связана с мышечным сокращением. Вторичный моторный нейрон в спинном мозге эмбриона дикого типа данио на 20 л.с. подвергается спонтанной деполяризации. В этом случае каждый деПоляризация связана с сокращением мышц рыбок данио, организованных в функционально синхронизированном синцитии на этой стадии развития. Нажмите здесь, чтобы посмотреть это видео. (Щелкните правой кнопкой мыши, чтобы загрузить.)

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Представленный здесь протокол позволил нам исследовать связь между электрическими свойствами нервных нейронов эмбрионов эмбрионов рыбок данио и спонтанным нависанием, самой ранней стереотипной двигательной активностью, которая появляется около 17 hpf эмбрионального развития и длится до 24 hpf 10 .

Наш подход предоставляет исследователям инструмент для изучения нейронной системы интактных эмбрионов, полностью сохраняя сложность взаимодействия между клетками в развивающейся функциональной сети. Изображение in vivo эмбрионов рыбок данио проводилось просто иммобилизацией их путем погружения в легкоплавкую агарозу. Изучение изменений в потенциале клеточной мембраны с использованием биосенсора представляет собой одно из основных преимуществ этого метода. Канонические электрофизиологические подходы, в которых физиологически доступны нейроны путем удаления обертывающих тканей 11 , являются процедурамиКоторые могут изменить электрические свойства исследуемых клеток. Кроме того, подход биосенсора на основе FRET позволяет изучать электрические свойства клеток без использования анестетиков ( т. Е. Tricaine, блокатор натриевых каналов), избегая любого потенциального нарушения, связанного с введением химических веществ ( то есть рилузола здесь), что Может иметь решающее значение в экспериментальном плане. Этот метод позволил нам сосредоточиться на модуляции как электрической активности, так и частоты спонтанных хвостовых обмоток, поведенческой реакции, которая предотвращает, в большинстве случаев, электрофизиологические записи без введения анестетиков. Наконец, использование GEVI предлагает самый высокий временный экспериментальный контроль, поскольку он позволяет работать на определенной стадии эмбрионального развития. Наши сеансы визуализации / записи охватывали очень ограниченное временное окно, позволяя точно сравнивать этапы развития различных эмбрионов в реальном времени. ВсеОбычные электрофизиологические записи, наоборот, обычно проводятся в больших и менее точных временных промежутках.

Однако изменение измерительного напряжения по методам визуализации является сложным из-за характера самого сигнала, который может варьироваться в зависимости от скорости, частоты и размера изменений мембранного потенциала. Идеальный датчик напряжения должен сочетать быструю реакцию, высокую чувствительность и высокое излучение фотонов. Для большинства GEVI на основе FRET изменения отношения изменяются в зависимости от изменений напряжения мембраны, но амплитуда изменений коэффициента флуоресценции тесно связана с продолжительностью событий деполяризации. Недавно были разработаны и охарактеризованы новые ГЭВИ, что позволило выбрать лучший зонд по отношению к типу экспериментальной модели, модели и устройства формирования изображений.

Биосенсоры напряжения являются интегральными мембранными белками. При трансфецировании в культивируемые клетки или экспрессиюD в живых организмах, флуоресценция локализованного датчика плазменной мембраны будет в определенной степени связана с флуоресценцией датчика в других внутриклеточных компартментах, где белок может быть неправильно локализован или агрегирован, тем самым генерируя фоновый сигнал. Уровень экспрессии и правильную локализацию мембраны каждой конструкции следует контролировать в упрощенных экспериментальных моделях ( т. Е. Трансфицировать клеточные линии или первичные культуры) перед использованием биосенсоров в живых организмах.

В настоящей экспериментальной установке другой потенциальный критический шаг протокола может быть представлен эффективностью процедуры трансгенеза. При необходимости процент плазмид-положительных клеток может быть значительно увеличен за счет использования системы транспонирования 12 Tol2. Еще одним важным аспектом, который необходимо учитывать, является потеря флуоресцентной эмиссии в донорском флуорофоре и потеря в FRET sigВо время сеанса визуализации из-за интенсивного освещения. Этого следует избегать, минимизируя освещенность образца, уменьшая мощность используемой лазерной линии. Аналогично, усиление и смещение фотоумножителей должны быть тщательно настроены в начале каждого сеанса записи, чтобы достичь наилучшего отношения сигнал-шум в полученных изображениях, а также избежать насыщенных пикселей. Все эти параметры могут варьироваться в зависимости от типа исследуемой ячейки, характеристик биодатчика и инструментов, используемых для получения изображения (широкополосные флуоресцентные микроскопы также могут использоваться, как недавно описано 13 ). Однако исследователю следует всегда учитывать, что при визуализации in vivo уровень шума может влиять на конкретный сигнал датчика больше, чем при записи in vitro . Наконец, если доступно, контрольные измерения с использованием мутантных зондов, которые не реагируют на напряжение, были бы удобным способомДля оценки уровня системного шума и / или артефактов.

Использование эмбрионов рыбок данио представляет собой ключевую особенность этого подхода благодаря их способности реагировать на генетические манипуляции и микроскопические исследования. Фактически, эти характеристики обеспечивают переходный трансгенезис и анализ FRET на основе электрических свойств нейронов. По нашему мнению, с наилучшими комбинациями промотора и биосенсора потенциально можно было бы выборочно анализировать электрическую активность любого интересующего клеточного типа и параллельно проводить такую ​​активность с эмбриональным фенотипом.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Low Melting Point Agarose  Sigma-Aldrich A9414
DMSO  Sigma-Aldrich W387520
Riluzole Sigma-Aldrich R116
Pfu Ultra HQ DNA polymerase  Agilent Technologies - Stratagene Products Division 600389
T3 Universal primer  Sigma-Aldrich
Wizard SV Gel and PCR Clean-Up system Promega A9280
Universal SmaI primer  Eurofins
StrataClone Mammalian Expression Vector System / pCMV-SC blunt vector  Agilent Technologies - Stratagene Products Division  240228
SmaI  New England Biolabs R0141S
T4 DNA ligase Promega M1801
SalI New England Biolabs R0138S
EcoRV New England Biolabs R0195S
35 mm, glass-bottomed imaging dish  Ibidi 81151
forceps Sigma-Aldrich F6521
Stereomicroscope Leica Microsystems M10 F
Digital camera Leica Microsystems DFC 310 FX
Leica Application Suite 4.7.1 software  Leica Microsystems
QuickTime Player, v10.4 Apple
Confocal microscope (inverted) Leica Microsystems TCS SP5
Microinjector  Eppendorf  Femtojet
ImageJ macro Biosensor_FRET 
GraphPad Prism 6.0c  GraphPad Software, Inc

DOWNLOAD MATERIALS LIST

References

  1. Knöpfel, T., Gallero-Salas, Y., Song, C. Genetically encoded voltage indicators for large scale cortical imaging come of age. Curr Opin Chem Biol. 27, 75-83 (2015).
  2. Chemla, S., Chavane, F. Voltage-sensitive dye imaging: Technique review and models. J Physiol Paris. 104, (1-2), 40-50 (2010).
  3. Tsutsui, H., Karasawa, S., Okamura, Y., Miyawaki, A. Improving membrane voltage measurements using FRET with new fluorescent proteins. Nat Methods. 5, (8), 683-685 (2008).
  4. Benedetti, L., et al. INaP selective inhibition reverts precocious inter- and motorneurons hyperexcitability in the Sod1-G93R zebrafish ALS model. Sci Rep. 6, 24515 (2016).
  5. Pennati, R., et al. Morphological differences between larvae of the Ciona intestinalis species complex: hints for a valid taxonomic definition of distinct species. PLoS ONE. 10, (5), 0122879 (2015).
  6. Park, H. C., et al. Analysis of upstream elements in the HuC promoter leads to the establishment of transgenic zebrafish with fluorescent neurons. Dev Biol. 227, (2), 279-293 (2000).
  7. Yuan, S., Sun, Z. Microinjection of mRNA and morpholino antisense oligonucleotides in zebrafish embryos. J Vis Exp. (27), (2009).
  8. Rosen, J. N., Sweeney, M. F., Mably, J. D. Microinjection of zebrafish embryos to analyze gene function. J Vis Exp. (25), (2009).
  9. Drapeau, P., et al. Development of the locomotor network in zebrafish. Prog Neurobiol. 68, (2), 85-111 (2002).
  10. Brustein, E., et al. Steps during the development of the zebrafish locomotor network. J Physiol Paris. 97, (1), 77-86 (2003).
  11. Drapeau, P., Ali, D. W., Buss, R. R., Saint-Amant, L. In vivo recording from identifiable neurons of the locomotor network in the developing zebrafish. J Neurosci Methods. 88, 1-13 (1999).
  12. Kawakami, K. Tol2: a versatile gene transfer vector in vertebrates. Genome Biol. 8, Suppl 1S7 (2007).
  13. Sungmoo, L., et al. Imaging Membrane Potential with Two Types of Genetically Encoded Fluorescent Voltage Sensors. J Vis Exp. (108), e53566 (2016).
Мембранный потенциал монокристалла монокристалла в живых эмбрионах данио
Play Video
PDF DOI DOWNLOAD MATERIALS LIST

Cite this Article

Benedetti, L., Ghilardi, A., Prosperi, L., Francolini, M., Del Giacco, L. Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos. J. Vis. Exp. (124), e55297, doi:10.3791/55297 (2017).More

Benedetti, L., Ghilardi, A., Prosperi, L., Francolini, M., Del Giacco, L. Biosensing Motor Neuron Membrane Potential in Live Zebrafish Embryos. J. Vis. Exp. (124), e55297, doi:10.3791/55297 (2017).

Less
Copy Citation Download Citation Reprints and Permissions
View Video

Get cutting-edge science videos from JoVE sent straight to your inbox every month.

Waiting X
simple hit counter