Introducing a Gene Knockout Directly Into the Amastigote Stage of Trypanosoma cruzi Using the CRISPR/Cas9 System

Summary

Here, we describe a protocol to introduce a gene knockout into the extracellular amastigote of Trypanosoma cruzi, using the CRISPR/Cas9 system. The growth phenotype can be followed up either by cell counting of axenic amastigote culture or by proliferation of intracellular amastigotes after host cell invasion.

Abstract

Trypanosoma cruzi is a pathogenic protozoan parasite that causes Chagas’ disease mainly in Latin America. In order to identify a novel drug target against T. cruzi, it is important to validate the essentiality of the target gene in the mammalian stage of the parasite, the amastigote. Amastigotes of T. cruzi replicate inside the host cell; thus, it is difficult to conduct a knockout experiment without going through other developmental stages. Recently, our group reported a growth condition in which the amastigote can replicate axenically for up to 10 days without losing its amastigote-like properties. By using this temporal axenic amastigote culture, we successfully introduced gRNAs directly into the Cas9-expressing amastigote to cause gene knockouts and analyzed their phenotypes exclusively in the amastigote stage. In this report, we describe a detailed protocol to produce in vitro derived extracellular amastigotes, and to utilize the axenic culture in a CRISPR/Cas9-mediated knockout experiment. The growth phenotype of knockout amastigotes can be evaluated either by cell counts of the axenic culture, or by replication of intracellular amastigote after host cell invasion. This method bypasses the parasite stage differentiation normally involved in producing a transgenic or a knockout amastigote. Utilization of the temporal axenic amastigote culture has the potential to expand the experimental freedom of stage-specific studies in T. cruzi.

Introduction

Trypanosoma cruzi is the causative agent of Chagas’ disease, which is prevalent mainly in Latin America¹. T. cruzi has distinctive life cycle stages as it travels between an insect vector and a mammalian host². T. cruzi replicates as an epimastigote in the midgut of a blood-sucking triatomine bug and differentiates into an infectious metacyclic trypomastigote in its hindgut before being deposited on a human or animal host. Once the trypomastigote gets into the host body through the bite site or through a mucous membrane, the parasite invades a host cell and transforms into a flagella-less....

Protocol

NOTE: An overview of the entire experimental flow is depicted in Figure 1.

Figure 1: Overview of the knockout experiment using EA. Tissue culture-derived trypomastigotes are harvested and differentiated into EA. gRNA is transfected into Cas9-expressing amastigotes by electroporation, and growt....

Results

Isolation of trypomastigotes by the swim-out procedure

To harvest fresh trypomastigotes from contaminating old EAs by swim-out procedure, cell pellets need to be incubated at least for 1 h. Incubating the pellets for more than 2 h does not significantly increase the number of trypomastigotes swimming in the solution (Figure 2B). In this particular experiment, the percentage of trypomastigote in the initial mixture was 38%, and the percentage after.......

Discussion

We demonstrated that the axenic culture of T. cruzi amastigotes can be utilized in CRISPR/Cas9-mediated gene knockout, by electroporating gRNA directly into Cas9-expressing EA. This way, the essentiality of the target gene specifically in amastigote stage can be evaluated without going through other developmental stages.

Another beneficial aspect of amastigote transfection is the convenience in testing for a large number of target genes. Once the co-culture of Cas9-expressing T. c.......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
20% formalin solution	FUJIFILM Wako Pure Chemical	068-03863	fixing cells
25 cm2 double seal cap culture flask	AGC Techno Glass	3100-025
75 cm2 double seal cap culture flask	AGC Techno Glass	3110-075
All-in One Fluorescence Microscope	Keyence	BZ-X710
Alt-R CRISPR-Cas9 crRNA (for Control)	IDT	custom made	target sequence = GGACGGCACCTTCATCTACAAGG
Alt-R CRISPR-Cas9 crRNA (for TcCGM1)	IDT	custom made	target sequence = TAGCCGCGATGGAGAGTTTATGG
Alt-R CRISPR-Cas9 crRNA (for TcPAR1)	IDT	custom made	target sequence = CGTGGAGAACGCCATTGCCACGG
Alt-R CRISPR-Cas9 tracrRNA	IDT	1072532	to anneal with crRNA
Amaxa Nucleofector device	LONZA	AAN-1001	electroporation
Basic Parasite Nucleofector Kit 2	LONZA	VMI-1021	electroporation
BSA	Sigma-Aldrich	A3294	component of the medium for in vitro amastigogenesis
Burker-Turk disposable hemocytometer	Watson	177-212C	cell counting
Coster 12-well Clear TC-Treated Multiple Well Plates	Corning	3513
DMEM	FUJIFILM Wako Pure Chemical	044-29765	culture medium
Fetal bovine serum, Defined	Hyclone	SH30070.03	heat-inactivate before use
G-418 Sulfate Solution	FUJIFILM Wako Pure Chemical	077-06433	selection of transformant
Hemin chloride	Sigma-Aldrich	H-5533	component of LIT medium
Hoechst 33342	Thermo Fisher Scientific	H3570	staining of nuclei
Liver infusion broth, Difco	Becton Dickinson	226920	component of LIT medium
MES	FUJIFILM Wako Pure Chemical	349-01623	component of the medium for in vitro amastigogenesis
PBS (–)	FUJIFILM Wako Pure Chemical	166-23555
Propidium Iodide	Sigma-Aldrich	P4864-10ML	staining of dead cells
RPMI 1646	Sigma-Aldrich	R8758	medium for metacyclogenesis