Isolating Brown Adipocytes from Murine Interscapular Brown Adipose Tissue for Gene and Protein Expression Analysis

Summary

This study describes a new method of isolating murine brown adipocytes for gene and protein expression analysis.

Abstract

Brown adipose tissue (BAT) is responsible for non-shivering thermogenesis in mammals, and brown adipocytes (BAs) are the functional units of BAT. BAs contain both multilocular lipid droplets and abundant mitochondria, and they express uncoupling protein 1 (UCP1). BAs are categorized into two sub-types based on their origin: embryo derived classical BAs (cBAs) and white adipocytes derived BAs. Due to their relatively low density, BAs cannot be isolated from BAT with traditional centrifugation method. In this study, a new method was developed to isolate BAs from mice for gene and protein expression analysis. In this protocol, interscapular BAT from adult mice was digested with Collagenase and Dispase solution, and the dissociated BAs were enriched with 6% iodixanol solution. Isolated BAs were then lysed with Trizol reagent for simultaneous isolation of RNA, DNA, and protein. After RNA isolation, the organic phase of the lysate was used for protein extraction. Our data showed that 6% iodixanol solution efficiently enriched BAs without interfering with follow-up gene and protein expression studies. Platelet-derived growth factor (PDGF) is a growth factor that regulates the growth and proliferation of mesenchymal cells. Compared to the brown adipose tissue, isolated BAs had significantly higher expression of Pdgfa. In summary, this new method provides a platform for studying the biology of brown adipocytes at a single cell-type level.

Introduction

Both mice and humans have two types of adipose tissues: white adipose tissue (WAT) and brown adipose tissue (BAT)¹. WAT stores energy in the form of triglycerides in white adipocytes, and the brown adipocytes (BAs) of BAT dissipate chemical energy as heat². Based on their developmental origin, BAs are further categorized into classical BAs (cBAs) that formed during embryo development and white adipocytes derived BAs (beige/brite cells, converted from white adipocytes under stress conditions)³. BAs are multilocular and express the thermogenic protein uncoupling protein 1 (UCP1)⁴. Interscapular BAT (iBAT) depot is one of the primary cBAs depots in small mammals⁵, whereas beige cells are dispersed within WAT⁶.

Due to their nature of dissipating energy, BAs have received much attention as a therapeutic target for reducing obesity⁷. To exploit BAs for the purpose of treating obesity, it is essential to understand the molecular mechanisms that control BAs function, survival, and recruitment. Adipose tissues including BAT and WAT are heterogeneous. Except for adipocytes, adipose tissues contain many other cell types, such as endothelial cells, mesenchymal stem cells and macrophages⁸. Although genetic tools to specifically deplete candidate genes in mice BAs are available, such as UCP1::Cre line⁹, techniques for purifying BAs from BAT or WAT are limited, making it hard to study BAs at a single-cell type level. Additionally, without obtaining pure BAs, the relationship between BAs and non-BAs will not be clearly delineated. For instance, platelet-derived growth factor receptor alpha (PDGFRα) has been used as a marker for undifferentiated mesenchymal cells, and it is expressed in the endothelial and interstitial cells of BAT. In cold stressed BAT, PDGFRα positive progenitor cells give rise to new BAs¹⁰. PDGFRα is activated by its ligand PDGF, a growth factor that regulates the growth and proliferation of mesenchymal cells¹¹; however, it is unclear whether BAs influence the behavior of PDGFRα positive progenitor cells by secreting PDGF.

Recently, a BAs isolation protocol has been published, which is based on fluorescence-activated cell sorting (FACS)¹². In this protocol, 3% bovine serum albumin (BSA) solution was used to separate BAs from non-BAs, and the enriched BAs were further purified by FACS. The application of this protocol is limited by the requirement of FACS process, which relies on both equipment and FACS operation experiences. In this study, a new protocol for isolating BAs from BAT was developed. The BAs isolated by this protocol can be directly used for gene and protein expression studies. Furthermore, data from this study suggest that BAs are a major PDGF resource.

Protocol

All mice were maintained in pathogen-free conditions, and all procedures were approved by Masonic Medical research Institutional Animal Care and Use Committee (IACUC). UCP1::Cre⁹ and Rosa 26^tdTomato mice lines¹³ were reported previously. All mice were kept at room temperature with a 12 h light/dark cycle.

1. Preparing the Solutions and brown adipose tissue (BAT)

1. Prepare digestion solution and separation solution in 15 mL centrifuge tubes.
2. 10 mL of BAT Digestion solution: To 10 mL of sterile phosphate-buffered saline (PBS), add 3.5 mg/mL Dispase II, 1 mg/mL Collagenase II and 10 mM CaCl₂ to make BAT digestion solution.
3. 10 mL of 12% iodixanol solution (separation solution): Mix 1 mL of 10x PBS, 2 mL of 60% iodixanol, 0.01 mL of 1 M MgCl₂, 0.025 mL of 1 M KCl, 0.1 mL of 0.2 M ethylenediaminetetraacetic acid (EDTA) and 6.865 mL of ddH₂O to obtain 12% iodixanol.
4. Euthanize one adult mouse with CO₂ overdose. Briefly, fill the mouse cage with 100% CO₂ at a displacement rate of 10-30% cage volume per min. 5 min later, confirm death by checking for the absence of visibly breathing.
5. Dissect the animal and collect interscapular BAT. Remove WAT and muscle layers under a stereo microscope.
6. To have sufficient digestion, cut each BAT lobe into ~ 3 mm³ parts and place them into a clean 50 mL flask with a metal stir bar and 5 mL digestion solution. Before starting digestion, let the flask containing BAT and digestion buffer sit on ice for 1 h.
   ​NOTE: In the following steps, around 80 mg BAT was used for brown adipocytes isolation.

2. BAs isolation procedure

1. Place the flask on a magnetic stirrer that is enclosed in an incubator. Set the stirring speed at 60 rpm and the temperature of the incubator at 35 °C, respectively. The digestion will last for around 30 min. If the BAT slices form clumps around the stirrer bar during digestion, use a 1 mL pipette tip to disrupt the aggregated tissues.
2. Place a 70 µm strainer filter on top of a clean 50 mL centrifuge tube. Pipette around 4 mL cell suspension through the strainer. Wash the strainer with 4 mL of 12% iodixanol solution. Pipette up and down to mix the cells and the iodixanol solution. Transfer the cell mixture into two clear 5 mL polystyrene test tubes.
   NOTE: At the end of digestion, the digestion solution should be cloudy, indicating sufficient digestion. Use fresh digestion solution every time. Once prepared, the digestion solution should be used within 2 h.
3. Repeat step 2.2 and 2.3 once more if the digestion is not sufficient.
4. Leave the clear polystyrene tubes containing the separation solution and BAs on ice for 1 h. The BAs will form a layer on the top.
5. Take out 20 µL of the isolated BAs for microscope examination.

3. RNA and protein isolation from BAs

1. Pipette the BAs layer into two 1.7 mL microcentrifuge tubes for RNA and protein isolation. Carefully remove the excessive iodixanol solution without disrupting the BAs layer.
2. Add 1 mL Trizol to simultaneously isolate RNA, DNA, and protein into the cell solution. Mix sufficiently to lyse the cells.
3. Add 200 µL of Chloroform to separate the phases.
4. Centrifuge the tube for 9,981 x g for 10 min at 4 °C.
5. After centrifugation, use the aqueous phase for RNA isolation. In this study, total RNA was used for reverse transcription, and quantitative RT-PCR was carried out with Real-Time PCR. Primer sequences are listed in Table of Materials.
6. Transfer 300 µL of the organic phase into a 2 mL microcentrifuge tube.
7. To the organic phase, add 2.5 volume 100% ethanol and vortex for 10 s.
8. Add 200 µL of 1-Bromo-3-chloropropane and vortex for 10 s.
9. Add 600 µL of double distilled water and vortex for 10 s.
10. Let the mixed solution stand for 10 min at room temperature.
11. Centrifuge at 9,981 x g for 10 min at 4 °C. At this step, the phases will be separated. The protein phase is localized in the middle layer.
12. Remove the top aqueous solution. Add 1 mL 100% ethanol into the remaining solution.
13. Centrifuge for 10 min, 9,981 x g, 4 °C. After centrifugation, the protein pellet will form. Discard the supernatant.
14. Wash the pellet with 1 mL 100% ethanol.
15. Centrifuge for 10 min, 9981 x g, 4 °C. Save the pellet and discard the supernatant.
16. Air-dry the pellet for 10 min at room temperature.
17. Measure the weight of the wet pellet. Add in 1% SDS solution at a ratio of 20 µL/mg pellet.
18. Dissolve the pellet by putting the tube in a heated shaker. Set the temperature at 55 °C, and the speed at 11 x g. It usually takes 5-10 min to completely dissolve the protein pellet.
    NOTE: The concentration of the dissolved protein can be measured by BCA assay¹⁴.

Results

Preparation of interacapular BAT for brown adipocytes isolation
The brown adipocytes (BAs) isolation process is depicted in Figure 1A. The whole process, from preparing BAT and digestion/separation solutions to obtaining isolated BAs will take around 4 h.

In adult mice, abundant BAT exists in the interscapular region. This interscapular BAT (iBAT) is covered by muscle layers and WAT (Figure 1B). Before starting th...

Discussion

In this study, a new method of isolating BAs for gene and protein expression analysis was developed.

In a published BAs isolation protocol, 3% BSA solution was used to enrich BAs¹². Nevertheless, the enriched BAs achieved by this published protocol could not be directly used for protein expression analysis. This is because the concentrated BSA existing in the BAs solution interferes with following-up protein extraction. When the BAs enriched in the 3% BSA solution were ...

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
Antibodies
Antigen	Company	Catalog
PPARγ	LSBio	Ls-C368478
PDGFRa	Santa Cruz	sc-398206
UCP1	R&D system	IC6158P
Chemical and solutions
Collagenase, Type II	Thermo Fisher Scientific	17101015
1-Bromo-3-chloropropane	Sigma-Aldrich	B62404
Bovine Serum Albumin (BSA)	Goldbio	A-421-10
Calcium chloride	Bio Basic	CT1330
Chloroform	IBI Scientific	IB05040
Dispase II, protease	Sigma-Aldrich	D5693
EDTA	Bio Basic	EB0107
Ethanol	IBI Scientific	IB15724
LiQuant Universal Green qPCR Master Mix	LifeSct	LS01131905Y
Magnesium Chloride Hexahydrate	Boston BioProducts	P-855
OneScrip Plus cDNA Synthesis SuperMix	ABM	G454
OptiPrep (Iodixanol)	Cosmo Bio USA	AXS-1114542
PBS (10x)	Caisson Labs	PBL07
PBS (1x)	Caisson Labs	PBL06
Pierce BCA Protein Assay Kit	Thermo Fisher Scientific	23227
Potassium Chloride	Boston BioProducts	P-1435
SimplyBlue safe Stain	Invitrogen	LC6060
Sodium dodecyl sulfate (SDS)	Sigma-Aldrich	75746
Trizol reagent	Life technoologies	15596018
Primers
Gene name (Species)	Forward	Reverse
Pdgfra (Mouse)	CTCAGCTGTCTCCTCACAgG	CAACGCATCTCAGAGAAAAGG
Pdgfa (Mouse)	TGTGCCCATTCGCAGGAAGAG	TTGGCCACCTTGACACTGCG
36B4(Mouse)	TGCTGAACATCTCCCCCTTCTC	TCTCCACAGACAATGCCAGGAC
Ucp1	ACTGCCACACCTCCAGTCATT	CTTTGCCTCACTCAGGATTGG
Equipment
Name	Company	Application
Keyence BZ-X700	Keyence	Imaging brown adipocytes
Magnetic stirrer	VWR	Dissociate BAT
QuantStudio 6 Flex Real-Time PCR System	Applied Biosystem	Quantitative PCR
The Odyssey Fc Imaging system	LI-COR	Western blot immaging