효소 복제 DNA의 직접 관찰 어세을 스트레칭 단일 분자 DNA를 사용하여

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

우리는 박테리오 파지 복제 시스템의 단백질에 의해 매개 개인의 DNA 분자의 실시간 복제를 관찰하는 방법을 설명합니다.

Cite this Article

Copy Citation | Download Citations

Kulczyk, A. W., Tanner, N. A., Loparo, J. J., Richardson, C. C., van Oijen, A. M. Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay. J. Vis. Exp. (37), e1689, doi:10.3791/1689 (2010).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

우리는 박테리오 파지 복제 시스템의 단백질에 의해 매개 개인의 DNA 분자의 실시간 복제를 관찰하는 방법을 설명합니다. 선형 λ DNA는 한 가닥의 끝 부분에 비오틴과 같은 스트랜드의 다른 끝에 dig​​oxigenin의 잔기을 가지고 수정됩니다. biotinylated 결국은 기능화 유리 coverslip과 작은 구슬로 digoxigeninated 끝에 첨부되어 있습니다. 흐름 세포의 표면에 이러한 DNA - 비즈 tethers의 조립이 층류가 구슬에 드래그 힘을 발휘에 적용할 수 있습니다. 결과적으로 DNA가와 병렬 유량 (그림 1)에 의해 결정됩니다 강제에 coverslip의 표면 가까이에 뻗어있다. DNA의 길이는 비드의 위치를​​ 모니터링하여 측정됩니다. 단일 및 이중 좌초된 DNA 사이의 길이 차이는 분기점에서 복제 단백질의 활동에 대한 실시간 정보를 얻을 활용하고 있습니다. 비드의 위치를​​ 측정하는 것은 긴장을 풀기 DNA와 중합 (그림 2)의 속도와 processivities의 정확한 결정을하실 수 있습니다.

Protocol

1. DNA 복제 템플릿

반응에 대한 DNA가 복제 포크를 형성 oligonucleotides의 어닐링에 의해 수정된 선형 λ의 DNA입니다. 또한, 비오틴은 λ의 DNA 중 한 가닥의 끝 부분에 첨부하고, digoxigenin의 잔기가 같은 스트랜드 1 상대방에 첨부되어 있습니다.

자료 : 박테리오 파지 λ의 DNA, Oligonucleotides : biotinylated 포크 팔 (A : 5' - 비오틴 - AAAAAAAAAAAAAAAAGAGTACTGTACGATCTAGCATCAATCACAGGGTCAGGTTCGTTATTGTCCAACTTGCTGTCC - 3 '), λ - 보완 포크 팔 (B : 5' - GGGCGGCGACCTGGACAGCAAGTTG GACAATCTCGTTCTATCACTAATTCACTAATGCAGGGAGGATTTCAGATATGGCA - 3'), 포크 프라이머 (C : 5 ' - TGCCATATCTGAAATCCTCCCTGC - 3 '), λ - 보완 digoxigenin 엔드 (D : 5' - AGGTCG CCGCCCAAAAAAAAAAAA - digoxigenin - 3'), T4 DNA Ligase의, T4 폴리 뉴클레오 타이드의 키나제, 열 차단.

  1. T4 폴리 뉴클레오 타이드의 키나제를 사용하여 oligonucleotides B와 D의 5 '끝이 Phosphorylate.
  2. oligonucleotides A와 B의 10 배 초과하고, T4 DNA ligase의 버퍼에 oligonucleotide C의 100 배 초과를 추가하여 한 단계에서 λ의 DNA에 oligonucleotides에게 A, B 및 C를 어닐링.
  3. 65 ° C 열 블록에서 가열하여 혼합합니다. 일단 가열, 열 블록을 끄고 제대로 oligonucleotides를 어닐링을 천천히 냉각 수 있습니다.
  4. 혼합물에 T4 DNA ligase의를 추가하고 2 시간 동안 실온에서 알을 품다. T4 DNA Ligase의은 oligonucleotides A와 B, 그리고 λ의 DNA의 결합 정확한를 catalyze 것입니다.
  5. 마지막으로, T4 DNA ligase의 버퍼에있는 내 DNA에 관하여 oligonucleotide D의 100 배 초과를 추가하여 DNA 복제 템플릿 oligonucleotide D를 어닐링.
  6. ° C 30 열 블록에 분, 룸 온도 냉각을 위해 천천히 열을 차단을 해제하여 45 혼합물을 품어.
  7. 최종 DNA 복제 템플릿은 이제 사용할 준비가되었습니다. 우리는 4 1.4 NM의 농도에서 템플릿을 저장할 ° C를 몇 주 동안.

2. 염주

비즈는 digoxigenin에 대한 특이성이있는 팹의 조각과 함께 작용합니다. 그들은 다음 DNA 복제 템플릿 2에 첨부하실 수 있습니다.

자료 : Tosyl 활성화 구슬, α - digoxigenin 팹 조각, 버퍼 : 0.1 M H3BO3 산도 9.5, 버퍼 B : 0.1 M PBS 산도 7.4, 0.1 % W / V BSA, 버퍼 C : 0.2 M 트리스 - HCL pH는 8.5 (25 ° C), 0.1 % W / V BSA, 자기 구분자, 회전.

  1. 구슬의 주식 솔루션을 Resuspend하고 eppendorf 튜브에 작은 나누어지는을 전송. 솔루션 나올 때까지 자성 분리 및 부화의 슬롯에 튜브를 삽입 후 pipetting으로 뜨는 제거합니다.
  2. 항체 결합에 대한 tosyl 그룹 활성화되는, 버퍼 추가합니다. pipetting하여 부드럽게 혼합하고 자성 분리와 버퍼를 제거합니다.
  3. 버퍼에 다시 팹의 조각과 resuspend 구슬을 추가, 철저하게 혼합하고, 37 ° C 사용하여 회전을 16~24시간을 품어. 부화 후, 별도의 구슬은 자기 기호를 사용하여 버퍼를 제거합니다.
  4. 5 분 4 ° C에서 버퍼 B 및 부화를 추가하여 구슬을 씻으십시오. 자기 분리기를 사용하여 버퍼를 제거합니다. 두 번 세척 반복합니다.
  5. 무료 tosyl 그룹을 차단하는 4 시간 37 버퍼 C와 부화 ° C를 추가합니다. 별도의 구슬은 자기 기호를 사용하여 버퍼를 제거합니다.
  6. 버퍼 B 및 사용에 대한 나누어지는 두 번 씻으십시오. 비즈는 4 저장할 수 있습니다 ° C가에 대한 실질적인 품질의 손실 (우리 주식 솔루션 1이 포함되어 있습니다 - 2x10 9 구슬 / ML)를하지 않고 일년 이상.

3. 기능화 Coverslips

유리 coverslip에 DNA의 첨부 파일을 허용하려면, 유리 먼저 다음 biotinylated PEG 분자에 결합하는 aminosilane와 작용합니다. 이 코팅은 표면에 3,4와 함께 DNA와 복제 단백질의 특이 현상이 상호 작용을 줄일 수 있습니다.

재료 : 유리 coverslips, 스테 이닝 항아리, 3 aminopropyltriethoxysilane, 메톡시 - PEG5k - NHS 에스테르, 비오틴 - PEG5k - NHSester, 아세톤, 1M 코, 에탄올, 오븐, 목욕 sonicator을

  1. 단지를 얼룩 및 에탄올과 함께 항아리를 채우는 그들을 배치하여 유리 coverslips을 철저히 청소. 단지를 씻어 1 M 코로 작성, 30 분 Sonicate. 모두 세척을 반복합니다.
  2. 첫 번째 작용화 반응 들면, 물의 모든 흔적은 삭제해야합니다. 10 분 아세톤과 sonicate로 항아리를 채우십시오. 빈과 아세톤로 다시 작성하십시오.
  3. 아세톤의 실란 시약의 2 % V / V 솔루션을 준비합니다. 얼룩 단지 추가 2 분 선동. 이 반응은 커플 유리에 aminosilane의 알콕시 그룹을 다음 커플링 단계 반응 아민을 떠나. 물을 큰 초과로 반응을 끄다.
  4. 110에서 그들을 베이킹하여 coverslips을 건조 °; 30 분 오븐에 C.
  5. 100 MM NaHCO 3 산도 8.2의 비오틴 PEG 혼합물 : 50:1 메톡시를 준비합니다. 0.2 % 주위 W / V biotinylated PEG을 목표로.
  6. 마른 silanized coverslip 및 장소 위에 다른 coverslip에 PEG 혼합물의 피펫 100 μL. 유리 coverslip 스페이서를 포함하면 coverslips의 분리를 허용합니다.
  7. 3 시간 동안 PEG 솔루션에 coverslips 부화 후 coverslips의 각 쌍을 분리하고 물로 씻어 광범위. 한 번만 측면이 PEG와 코팅 될 것이다 coverslips가 측면을 유지하는 작용주의하십시오.
  8. 건조기의 진공 하에서 공기와 상점과 coverslips 건조. 표면은 적어도 한 달 동안 안정적으로 유지하므로 coverslips 수십는 일괄로 작성하고 필요에 따라 사용할 수 있습니다.

4. 흐름 챔버 준비

실험 기능화 coverslip, 양면 테이프, 석영 튜브 슬라이드와 함께 건설 간단한 흐름 챔버를 사용하여 수행됩니다. 하나의 흐름 챔버는 각 단일 분자 실험 2,4에 대한 준비가되어 있습니다.

재료 : 양면 테이프, 면도날, 튜브, 빠른 건조 에폭시를위한 구멍이있는 석영 슬라이드, 기능화 coverslip, streptavidin 용액 (PBS 1 MG / ML 25 μL), 튜브, 차단 버퍼 (5 ​​배 : 20 MM 트리스 산도 7.5, 2 MM EDTA (에틸렌 다이아 민 테트라 초산), 50 MM NaCl, 0.2 MG / ML BSA, 0.005 % 트윈 - 20), 작업 버퍼 (1X : 20 MM 트리스 - HCL 산도 7.5, 2 MM EDTA (에틸렌 다이아 민 테트라 초산), 50 MM NaCl).

  1. 차단 버퍼 이후 단계에 대한 기포를 제거하기 위해 건조기에서 버퍼를 작업 20 ML 5 ML을 혼합하여 배치 시작.
  2. PEG - 기능화 coverslip을 가지고 표면을 통해 PBS로 희석된 streptavidin 솔루션의 확산 125. streptavidin은 표면 biotins를 바인딩할 수 있도록, 챔버의 다른 부분을 준비하는 동안 실온에서 20 분 동안 부화 이것을 둡니다.
  3. 석영 슬라이드의 크기를 일치하도록 양면 테이프의 조각을 잘라 버릴거야. 흐름 챔버의 외곽선이 테이프에 그릴 수 있도록 테이프에 튜브의 구멍의 위치를​​ 표시합니다.
  4. 3mm 전체 센터 채널 및 두 구멍을 포함하는 사각형을 만듭니다. 우린 두 후미 두 콘센트 Y 모양의 채널 유동 회의소를 사용합니다.
  5. 채널에 노 접착제 protrudes 있는지 바로 깨끗한 상처를 만드는 그려진 윤곽을 따라 잘라.
  6. 석영 철저하게 사용하는 아세톤 또는 이전 유량 셀 구조에서 접착제를 제거하기 위해 에탄올을 청소하십시오.
  7. 채널 개요 최고의 정렬을 찾아 접착제 후원의 한쪽을 제거하고 조심스럽게 석영 슬라이드에 테이프를 넣으십시오. 입구와 콘센트 구멍이 남아 차단을 해제해야로서 제대로 테이프를 정렬하기 위해주의하십시오.
  8. 흐름 세포의 입구 및 출구에 대한 튜브의 길이를 자르고. 그것은 튜브가 챔버 바닥에 대한 평면 눌러 않도록 대해 30 ° 각도로 튜브의 끝을 잘라하는 데 도움이됩니다. 다음 단계에서 흐름 세포에 쉽게 부착 그들을 중지할 지원 (예 : 튜브 랙)의 일종에 튜브를 삽입합니다.
  9. 물로 깨끗이 streptavidin - 코팅 coverslip을 씻어 압축 공기를 사용하여 건조. 한 측면이 작용입니다 기억하십시오. 테이프 백업의 다른 측면을 제거하고 coverslip 위에 석영 슬라이드를 놓으십시오.
  10. 가볍게 접착제에 갇혀있는 공기를 밖으로 밀어 coverslip을 누르십시오. 이것은 흐름 채널로 받고있는 공기 방울을 방지하는 데 도움이됩니다.
  11. 에폭시와 챔버의 측면을 봉쇄. 에폭시와 장소에서 석영과 인감 구멍에 상처 튜브를 삽입합니다. 이것은 몇 분 동안 건조해야합니다.
  12. 일단 건조, 튜브 중 하나를 통해 degassed 차단 버퍼의 일부를 당겨 표면을 차단하고 시작합니다. 21 게이지 바늘은 0.76 mm의 튜브 내부에 완벽하게 맞는 데요. 공기 방울을 제거하기 위해 몇 시간을 플러시하고, 챔버가 최소 절반 시간 동안 부화 수 있습니다.

5. 단일 분자 복제 실험

일단 DNA의 템플릿과 기능화 구슬을 준비하고, 흐름 챔버가 준비되었으며, 단일 분자 실험을 수행할 수 있습니다.

자료 : 준비 흐름 챔버, 차단 버퍼 (5 ​​배 : 20 MM 트리스 - HCL 산도 7.5, 2 MM EDTA (에틸렌 다이아 민 테트라 초산), 50 MM NaCl, 1 MG / ML BSA, 0.025 % 트윈 - 20), 작업 버퍼 (1X : 20 MM 트리스 - HCL 산도 7.5, 2 MM EDTA (에틸렌 다이아 민 테트라 초산), 50 MM NaCl), (1X 또는 10mM MgCl 2없이 T7 복제 버퍼 : 40 MM 트리스 - HCL 산도 7.5, 50 MM K - 글루 탐 산염, 2 MM EDTA (에틸렌 다이아 민 테트라 초산), 100 μg / ML BSA, 10 MM DTT, 600 μm의 dNTPs), 복제 단백질, 10X 목적, CCD 카메라, 희토류 영구 자석, 주사기 펌프, airspring, 섬유의 조명기, 컴퓨터 이미지 수집 소프트웨어와 함께 반전 광학 현미경.

  1. 흐름 세포가 차단되고 나면 그것은 실험을 시작할 준비가되어 있습니다.
  2. 흐름 세포를 가지고 현미경 스테이지에 배치하십시오. 무대 클립 장소에서 챔버 잡고그리고 흐름 채널 CCD 카메라와 정렬로 배치되었는지 확인합니다.
  3. 큰 직경의 튜브 커넥터 또는 바늘을 사용하여 airspring에 흐름 세포 콘센트 튜브를 연결합니다. airspring은 어떤 흐름 부정을 안정화하는 데 사용됩니다. 50 ML 플라스틱 관은 물 45ml로 가득 차 있습니다. 튜브의 뚜껑은 에폭시로 밀봉합니다. 세 구멍 뚜껑에 피어싱하고, 튜브의 세 가지는 튜브에 삽입됩니다. 에폭시를 사용하여 튜브는 다음 입력하거나 회피로부터 공기를 방지, 뚜껑을 봉쇄하고 있습니다. airspring은 주사기 펌프하고, 흐름 세포의 배출구 튜브에 연결되어 있습니다.
  4. 버퍼를 차단의 흐름 세포의 유입 튜브를 삽입하고 튜브에 공기를 제거하는 주사기에 다시 가져옵니다. 콘센트 튜브의 부드러운 영화는 흐름 세포에 갇혀있는 공기 방울을 취소 도움이 될 것입니다.
  5. 일단 모든 기포가 제거되었습니다, 바늘로 입구 튜브 중 하나, 그리고 1800하여 굽힘 및 접착제 테이프와 튜브를 확보하여 콘센트 튜브 중 하나를 차단합니다.
  6. degassed 차단 버퍼 1 ML 10 시까지 재고 DNA 템플릿을 희석. DNA (0.01-0.05 20 분 ML / 분 잘 동작)의 좋은 표면 범위를 허용하는 중간 유량의 챔버로 흐름. 이것은 coverslips의 각 배치에 대해 표면에있는 또는 실험을 위해 얼마나 많은 원하는 얼마나 많은 DNA 분자에 따라 다양한하실 수 있습니다.
  7. 2 - 4x10 6 구슬 / degassed 차단 버퍼 1 ML에 ML에 주식 비드 솔루션을 희석. 0.01-0.05 ML / 15 분 분 챔버로 흐름.
  8. 일단 구슬이 추가되며, 흐름을 끄고 챔버가 평형에 도달할 수 있습니다. 다음 아울렛 튜브를 모두 닫습니다. 챔버없이 튜브에 모든 변경 사항은 구슬과 가위 닿는 DNA 분자에 강한 힘을 발휘합니다 압력 변동을 일으킬 것입니다 마감했다.
  9. 바늘로 구슬을 로딩에 사용했던 입구 튜브를 차단하고, 작업 버퍼에 차단 버퍼의 degassed 1X 솔루션으로 두 번째 입구를 사용하여 흐름 세포를 세척 시작합니다. 0.01-0.05 ML / 분 속도로 광범위하게 씻으십시오. nonspecifically 표면 (에 붙어있는 구슬 제거 눌러서 수동으로 무대를 선동 태핑을 ).
  10. 무료로 구슬이 충분히 제거되면 흐름을 끄고 챔버가 평형에 도달할 수 있습니다. 열린 아울렛 튜브를 닫고 단백질 솔루션 입구 저수지 스위치 천천히 급격한 압력 변화를 방지하기 위해 콘센트를 여는
  11. 구슬은 흐름의 방향 (변경하여 DNA를 곁에있다면 당신은 확인할 수 DNA를 ).
  12. 자, 효소 반응을 수행할 수 있습니다. 에 대한 선도 - 스트랜드 합성 실험 gp4 helicase와 MgCl 2를 포함하지 않습니다 degassed T7 복제 버퍼 gp5 효소 (ITS processivity 팩터 thioredoxin과 복잡한로 정화)의 20nM 솔루션의 20nM 솔루션을합니다.
  13. DNA에 효율적인 바인딩을 허용하는 중간 유량의 챔버에 단백질 솔루션을 흐름. 우리는 8 분 동안 0.037 ML / 분 사용 후 0.012 ML / 7 분 분.
  14. 무료로 단백질을 제거하는 MgCl 2없이 degassed T7 복제 버퍼와 챔버를 씻으십시오. 0.037 ML / 3-10분에 대한 분 율은 잘 작동합니다.
  15. 세척 후, 흐름 T7 복제 MgCl 2 버퍼와 데이터 수집을 시작합니다. 0.012 ML /이 프로토콜에 명시된 조건에서 DNA의 tethers 3 PN의 드래그 강제로 해당 분의 유량을 사용합니다.
  16. 이미지가 구슬과 표면 사이의 특이 현상이 상호 작용을 방지하기 전에 흐름 세포 위에 희토류 영구 자석을 배치합니다.
  17. 10X 객관적이고 CCD 카메라와 함께 필드를 볼 수 있습니다. 곁에 비드를 사용하는 데 중점을 둡니다.
  18. 10도 및 현미경 근처 현미경 단계에 평행 사이의 입사 각도에서 광섬유 조명기를 놓습니다. 다크 - 필드 조명은 비드 이미지의 명암을 증가하는 데 사용됩니다.
  19. 느린 프레임 속도 (일반적으로 2-4 Hz에서) 20 30 분에 대한 데이터를 수집.

6. 대표 결과

성공적인 실험에서는 (동시에 100 개 이상의 구슬을 관찰하실 수 있습니다 리딩 스트랜드 합성 ). 실험은 최고의 스트랜드의 DNA 합성을 표시하는 수많은 흔적을 얻을 것입니다.

데이터 분석 :

요금 및 긴장을 풀기 DNA와 중합의 processivities를 측정하기 위해, 구슬의 정확한 위치가 결정되어야합니다. 당신은 2 차원 가우스 함수 이러한 위치를 피팅하여 얻을 수 있습니다. 궤도는 다음 추적 소프트웨어 (예 : DiaTrack)를 사용하여 각 프레임에 추적 구슬 위치로 추출하실 수 있습니다. 이제 정말 모든 그래픽을 사용하여 시간의 함수로 구슬 위치를 계획하여 궤도를 시각화하기 위해 준비ftware (예 : 오리진). 속도 데이터를 얻기 위해, 선형 회귀와 플롯에 맞게하고 기울기를 계산합니다. processivity 들어, 단축 이벤트 (그림 3)의 끝을 처음부터 DNA의 전체 길이를 결정합니다. 이 숫자의 두 basepairs로 변환해야합니다. basepairs에 비드 운동을 변환하려면, 먼저 반응 유량에 버리지 λ의 DNA 분자의 길이를 측정해야합니다. λ의 DNA의 길이가 (48,502 BP) 알려져 있기 때문에 당신은 실험적인 강제에 기본 쌍 / 픽셀의 수를 조정할 수있다. 증가 정확성에 대해, 관심이 효소 변경되지 않은 구슬 밧줄의 기본 추적의 흔적에서 뺍니다. 모든 단일 측정과 플롯 속도와 processivity의 배포판에 결합합니다. 가우스와 단일 지수 함수, 각각 (그림 3)를 사용하여 데이터를 맞습니다.

그림 1
그림 1. 단일 분자 실험 설정. (A) 듀플렉스 λ DNA가 (48.5 KB) 5를 통해 흐름을 세포의 표면에 연결된 '비오틴 - streptavidin 상호 작용을 사용하여 한 가닥의 끝, 그리고 3'같은 스트랜드의 끝을 사용하여 구슬에 첨부되어 있습니다 digoxigenin 안티 digoxigenin 상호 작용. 준비하는 복제 포크는 효소의 로딩 있도록 비드 반대 끝에 형성됩니다. (B) 비드 - DNA 어셈블리는 버퍼의 층류를 사용하여 늘어과 넓은 필드 광학 현미경을 사용하여 몇 군데 있습니다. 상수 스트레칭 힘을을 유지하면서, 시간이 지남에 따라 구슬의 위치를​​ 추적함으로써, DNA 구조의 길이는 모니터링할 수 있습니다. 낮은 세력 아래에 (C) 확장 ssDNA의 프로필 (채워진 동그라미)와 dsDNA (오픈 서클). 점선 완전히 DS - λ DNA의 crystallographic 길이 ​​16.3 μm의를 보여줍니다. 3 PN 주변 세력에 ssDNA와 dsDNA 사이의 길이의 큰 차이점은 DNA의 길이 모니터링 변경 SS 및 dsDNA간에 전환의 직접적인 관찰이 가능합니다. DNA - 결합 구슬 다수의 동시 시각화 한 실험에 여러 개인 replisomes의 연구 있습니다.

그림 2
그림 2 박테리오 파지 T7 복제 단백질 :.의 DNA 중합 효소 (gp5과 thioredoxin의 복잡한)와 DNA helicase (gp4)는 deoxyribonucleotides과 마그네슘의 존재에 DNA 가닥을 선도하는 종합. 이 과정은 coiling에 의한 DNA 보온 스트랜드의 단축과 함께합니다. 비드의 ssDNA 변경 위치에 dsDNA의 전환. 비드의 위치를​​ 측정하는 것은 DNA 복제의 속도와 processivity의 정확한 결정을하실 수 있습니다.

그림 3
그림 3. 단일 분자 선도 - 스트랜드 합성 실험에서 전형적인 데이터의 예. DNA 복제의 Processivity이 단축 이벤트의 끝을 처음부터 DNA의 총 길이와 동일합니다. DNA 복제의 속도는 선형 회귀와 음모를 피팅하고 경사를 계산하여 얻을 수 있습니다. 측정의 숫자에서 결합 데이터를 얻은되었습니다 삽입된 페이지 보여주는 속도와 processivity 배포판. 데이터는 각각 가우스와 단일 지수 함수를 사용하여 장착되었습니다.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

층류 흐름에 의해 구슬을 끼쳤다 드래그 팀은 복제 단백질의 효소 활동에 영향을 미치지 않도록하는 것이 중요합니다. 예를 들어, 0.012 ML / 분 유량에 해당하는 3 PN 인력은 DNA 선도 가닥의 복제에는 영향을 미치지 않습니다. 그것은 그러나 조정의 DNA 합성 동안을 효소 활동에 영향을 미치지 않으며, 그것은 따라서 1.5 PN을 줄일 수있다. 드래그 힘을 쉽게 유속 또는 유량 채널 5 너비를 변경하여 제어할 수 있습니다.

분석에 이르는 DNA 사이 이중 및 단일 좌초된 DNA의 길이 차이를 고용합니다. 실험 ssDNA 여기 dsDNA의 변환을 설명하는 것은 최고의 스트랜드 합성 (그림 2)의 결과로 발생합니다. 당신은 ssDNA 6 PN 아래 낮은 스트레칭 세력 (그림 1)에서만 dsDNA보다 짧은 것을 기억한다.

이 방법의 개선 가능성은 3' - 끝에 두 번째 구슬을 첨부하여 복제 템플릿의 보온 가닥을 수정하는 것입니다. 이러한 교대는 DNA의 두 가닥에서 우리가 자리를 잡고 효소 활동의 직접 관찰을 허용합니다.

이외 선도 가닥 합성 및 조정 복제 연구에서 분석에 이르는 DNA가 성공적으로 복제 5,6 동안 단일 분자 λ의 exonuclease의 운동 및 효소 교환의 역학을 조사하기 위해 고용되었다. 원칙적으로이 방법은 어떤 DNA 처리 효소를 연구하는 데 사용할 수 있습니다.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

분석에 이르는 DNA의 발전은 폴 Blainey, 종 봉과 사미르 Hamdan하여 주었되었습니다. 이 작품은 찰스 리차드슨 (GM54397), 그리고 안토니 반 Oijen (GM077248)로 건강을 부여의 국립 연구소에 의해 지원됩니다.

Materials

Name Company Catalog Number Comments
Bacteriophage λ DNA New England Biolabs N3011L
DNA Oligonucleotides Integrated DNA Technologies
T4 DNA Ligase New England Biolabs M0202L
T4 Polynucleotide Kinase New England Biolabs M0201L
α-digoxigenin Fab Roche Group 11214667001
Tosyl Activated Beads Invitrogen 142-03
Magnetic Separator Invitrogen Dynal MPC
3-aminopropyl-triethoxysilane Sigma-Aldrich A3648 Other aminosilanes can be used or mixed with non-amine reactive silanes for sparser surfaces
Succinimidyl propionate PEG Nektar Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.
Biotin-PEG-NHS Nektar Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.
Double-sided tape Grace Bio-Lab Inc. SA-S-1L 100 μm thickness
Quartz slide Technical Glass 20 mm (W)x 50 mm (L)x 1mm (H) Size to fit on coverslips. Drill holes with diamond-tip drill bits (DiamondBurs.net)
Polyethylene tubing BD Biosciences 427416 0.76 mm ID, 1.22 OD
Other size tubing can be substituted.
Streptavidin Sigma-Aldrich S4762 Make 1 mg/mL solution, 25 μL aliquots in PBS pH 7.3
Deoxyribonucleotide triphosphate solution mix New England Biolabs N0447
Inverted Optical Microscope with 10X Objective Olympus Corporation Olympus IX-51
Permament rare-earth magnet National Imports www.rare-earth-magnets.com
CCD Camera QImaging Rolera-XR Fast 139
Syringe Pump Harvard Apparatus 11 Plus Operate in refill mode to facilitate solution changes
Fiber Illuminator Thorlabs Inc. OSL1

DOWNLOAD MATERIALS LIST

References

  1. Lee, J. B. DNA primase acts as a molecular brake in DNA replication. Nature. 439, 621-624 (2006).
  2. Tanner, N. A., van Oijen, A. M. Single-molecule observation of prokaryotic DNA replication. Methods Mol Biol. 521, 397-410 (2009).
  3. Sofia, S. J., Premnath, V. V., Merrill, E. W. Poly(ethylene oxide) Grafted to Silicon Surfaces: Grafting Density and Protein Adsorption. Macromolecules. 31, 5059-5070 (1998).
  4. Tanner, N. A., Loparo, J. J., van Oijen, A. M. Visualizing single-molecule DNA replication with fluorescence microscopy. J Vis Exp. (2009).
  5. Hamdan, S. M., Loparo, J. J., Takahashi, M., Richardson, C. C., van Oijen, A. M. Dynamics of DNA replication loops reveal temporal control of lagging-strand synthesis. Nature. 457, 336-339 (2009).
  6. van Oijen, A. M. Single-molecule kinetics of lambda exonuclease reveal base dependence and dynamic disorder. Science. 301, 1235-1238 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics