A observação direta de Enzimas DNA Replicação Usando um DNA molécula única Alongamento Assay

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Nós descrevemos um método para observar a replicação em tempo real de moléculas de DNA individual mediada por proteínas do sistema de replicação bacteriófago.

Cite this Article

Copy Citation | Download Citations

Kulczyk, A. W., Tanner, N. A., Loparo, J. J., Richardson, C. C., van Oijen, A. M. Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay. J. Vis. Exp. (37), e1689, doi:10.3791/1689 (2010).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Nós descrevemos um método para observar a replicação em tempo real de moléculas de DNA individual mediada por proteínas do sistema de replicação bacteriófago. Linearizada λ DNA é modificada para ter um biotina na extremidade de um fio, e uma porção digoxigenina na outra extremidade do fio mesmo. O fim biotinilado é anexado a uma lamela de vidro funcionalizadas eo fim digoxigeninated para uma pequena pérola. A montagem destas amarras DNA-pérola sobre a superfície de uma célula de fluxo permite um fluxo laminar para ser aplicado a exercer uma força de arrasto na esfera. Como resultado, o DNA é esticada próximo e paralelo à superfície da lamínula, a uma força que é determinado pela taxa de fluxo (Figura 1). O comprimento do DNA é medida através do monitoramento da posição do talão. Diferenças de comprimento entre o DNA de um único e double-stranded são utilizados para obter informações em tempo real sobre a atividade das proteínas de replicação na bifurcação. Medir a posição do talão permite a determinação precisa das taxas e processivities de DNA descontrair e polimerização (Figura 2).

Protocol

1. Modelo de replicação do DNA

DNA para a reação é um DNA λ linearizada modificado por anelamento de oligonucleotídeos para formar uma forquilha de replicação. Além disso, biotina é anexado ao final de uma vertente do DNA λ, e uma porção digoxigenina está ligado à outra extremidade do fio mesmo 1.

Materiais: Bacteriófago λ DNA, Oligonucleotídeos: braço garfo biotinilado (A: 5'-biotina-AAAAAAAAAAAAAAAAGAGTACTGTACGATCTAGCATCAATCACAGGGTCAGGTTCGTTATTGTCCAACTTGCTGTCC-3 '), λ-complementares braço fork (B: 5'-GGGCGGCGACCTGGACAGCAAGTTG GACAATCTCGTTCTATCACTAATTCACTAATGCAGGGAGGATTTCAGATATGGCA-3'), primer fork (C: 5 ' -TGCCATATCTGAAATCCTCCCTGC-3 '), fim digoxigenina λ-complementares (D: 5'-AGGTCG CCGCCCAAAAAAAAAAAA-digoxigenina-3'), DNA Ligase T4, T4 polinucleotídeo quinase, bloco Heat.

  1. Fosforilar termina a 5 'de oligonucleotídeos B e D utilizando Quinase Polinucleotídeo T4.
  2. Recozer oligonucleotides A, B e C para o DNA λ em uma única etapa, adicionando um excesso de 10 vezes de oligonucleotídeos A e B, e um excesso de 100 vezes de oligonucleotídeo C em tampão T4 DNA ligase.
  3. Aquecer a mistura a 65 ° C no bloco de calor. Uma vez aquecida, por sua vez o bloco de calor e deixe resfriamento lento corretamente anneal oligonucleotides.
  4. Adicionar DNA ligase T4 à mistura e incubar à temperatura ambiente por 2 horas. Ligase T4 DNA vai catalisar a correta união de oligonucleotides A e B e DNA λ.
  5. Finalmente, recozer a D oligonucleotídeo para o modelo de replicação do DNA pela adição de 100 vezes o excesso de oligonucleotídeo D com respeito ao DNA l em tampão T4 DNA ligase.
  6. Incubar a mistura a 45 ° C por 30 min no bloco, calor e arrefecer à temperatura ambiente girando lentamente bloco calor fora.
  7. O modelo de replicação final DNA está pronto para uso. Nós armazenar o modelo em uma concentração de 1,4 nM a 4 ° C por várias semanas.

2. Contas

Contas são funcionalizados com um fragmento Fab, com especificidade para digoxigenina. Eles podem ser então anexado ao modelo de dois DNA de replicação.

Materiais: Tosil contas ativado, α-digoxigenina fragmento Fab, tampão A: 0,1 M pH 9,5 H3BO3, tampão B: 0,1 M PBS pH 7,4, 0,1% w / v BSA, Buffer C: 0,2 M Tris-HCl pH 8.5 (25 ° C), 0,1% w / v BSA, separador magnético, Rotator.

  1. Ressuspender a solução estoque de contas e transferência de uma alíquota pequena dentro do tubo eppendorf. Colocar o tubo em um slot do separador magnético e incubar até que a solução limpa, em seguida, retire o sobrenadante por pipetagem.
  2. Adicionar Um buffer, que irá ativar grupos tosila para acoplamento de anticorpos. Misture delicadamente por pipetagem e remover do buffer com o separador magnético.
  3. Adicionar fragmento Fab e contas ressuspender novamente em tampão A, misture bem e incubar 16-24 horas a 37 ° C usando rotador. Após a incubação, contas separadas usando o separador magnético e remover buffer.
  4. Lavar contas adicionando tampão B e incubar a 4 ° C por 5 min. Remover o buffer usando separador magnético. Repetir a lavagem duas vezes.
  5. Adicionar tampão C e incubar a 37 ° C por 4 horas para bloquear grupos tosila livre. Contas separadas usando separador magnético e remover buffer.
  6. Lavar duas vezes em tampão B e alíquotas para o uso. Contas podem ser armazenados a 4 ° C por 1 ano ou mais sem perda substancial de qualidade (nossa solução estoque contém 1 - 2x10 9 esferas / ml).

3. Lamelas funcionalizados

Para permitir a ligação do DNA à lamela de vidro, o vidro é o primeiro funcionalizados com um aminosilane, que é acoplado a moléculas de PEG biotinilado. Este revestimento ajuda a reduzir as interações não específicas de DNA e proteínas de replicação com a superfície 3,4.

Materiais: lamínulas de vidro, potes de coloração, 3-aminopropyltriethoxysilane, Methoxy-PEG5k NHS-éster, Biotina-PEG5k-NHSester, acetona, 1M KOH, Etanol, Forno sonicador Bath,

  1. Limpam-se as lamínulas de vidro, colocando-os na coloração frascos e encher os frascos com etanol. Sonicado por 30 minutos, enxaguar os frascos e encher com 1 M KOH. Repita os dois lavagens.
  2. Para a reação de funcionalização em primeiro lugar, todos os vestígios de água precisam ser removidos. Enchei as talhas de acetona e sonicate por 10 min. Vazio e encher novamente com acetona.
  3. Prepare uma solução 2% v / v do reagente silano em acetona. Adicionar ao tinas de coloração e agitar por 2 minutos. Esta reação casais do grupo de alcóxi de aminosilane ao vidro, deixando uma amina reativos para a etapa seguinte de acoplamento. Saciar a reação com um grande excesso de água.
  4. Seca as lamelas cozendo-los em 110 °; C no forno por 30 minutos.
  5. Prepare um metoxi 50:1: biotina mistura PEG em 100 mM NaHCO 3 pH 8.2. Apontar para cerca de 0,2% PEG w / v biotinilado.
  6. Pipetar 100 mL da mistura PEG em uma lamela seca silanizadas e colocar outra lamínula por cima. Incluindo um espaçador lamela de vidro vai permitir a separação das lamelas.
  7. Incubar as lamelas na solução de PEG por 3 horas, em seguida, separe cada par de lamelas e lavar abundantemente com água. Tenha cuidado para manter as lamelas funcionalizados lateral-se como apenas o lado uma vez serão revestidas com PEG.
  8. Seca as lamelas com o ar e armazenar sob vácuo em exsicador. As superfícies de permanecer estável por pelo menos um mês, assim que dezenas de lamelas podem ser feitas em um lote e usado quando necessário.

4. Preparação câmara de fluxo

O experimento é realizado com uma câmara de fluxo simples construída com uma lamela funcionalizados, fita dupla face, uma lâmina de quartzo e tubo. Uma câmara de fluxo está preparado para cada experimento uma única molécula de 2,4.

Materiais: fita dupla face, lâmina de barbear, lâmina de quartzo com furos para tubos de epóxi, de secagem rápida, lamela funcionalizados, estreptavidina solução (25 mL de 1 mg / mL em PBS), tubulação, tampão de bloqueio (5X: 20 mM Tris pH 7.5, 2 mM EDTA, 50 mM NaCl, 0,2 mg / mL BSA, 0,005% Tween-20), buffer de trabalho (1X: 20 mM Tris-HCl pH 7,5, 2 mM EDTA, 50 mM NaCl).

  1. Comece por misturar e colocar 5 mL de tampão de bloqueio e 20 ml de tampão trabalhando em um dessecador para remover quaisquer bolhas de ar para etapas posteriores.
  2. Dê uma lamela PEG-funcionalizados e espalhar 125 de PBS-diluída solução de estreptavidina sobre a superfície. Deixar isso para incubar por 20 minutos em temperatura ambiente enquanto prepara outras partes da câmara, permitindo estreptavidina para ligar a Biotins superfície.
  3. Corte um pedaço de fita dupla face para corresponder ao tamanho da lâmina de quartzo. Marcar a posição dos furos de tubos na fita para que um esboço da câmara de fluxo podem ser tiradas na fita.
  4. Faça um canal central de 3 mm de largura e retângulos contendo dois buracos. Nós usamos câmaras de fluxo, com dois de entrada e duas de saída em forma de Y canais.
  5. Corte ao longo do contorno desenhado, tornando reto, cortes limpos para garantir que nenhum sobressaia adesivo para o canal.
  6. Limpe o quartzo, cuidadosamente, com acetona ou etanol para remover adesivo da construção anterior de fluxo de células.
  7. Encontrar o melhor alinhamento do contorno do canal, remove um dos lados da camada adesiva e coloque cuidadosamente a fita sobre a lâmina de quartzo. Tenha o cuidado de alinhar a fita corretamente, como os buracos de entrada e saída necessidade de permanecer desbloqueados.
  8. Cortar comprimentos de tubulação para a entrada e saída da célula de fluxo. Isso ajuda a cortar a extremidade do tubo em cerca de um ângulo de 30 ° para que o tubo não vai pressionar plana contra o fundo de câmara. Colocar os tubos em algum tipo de apoio (suportes de tubos, por exemplo) para suspendê-las para fixação fácil a célula de fluxo nas próximas etapas.
  9. Lavar a lamela estreptavidina revestida abundantemente com água e seque com ar comprimido. Lembre-se que apenas um lado é funcionalizada. Remover o outro lado do suporte de fita e colocar a lâmina de quartzo para a lamela.
  10. Pressione levemente na lamela a empurrar para fora todo o ar aprisionado no adesivo. Isso ajudará a evitar as bolhas de ar entrando no canal de fluxo.
  11. Vedação dos lados da câmara com epóxi. Insira o tubo de corte nos orifícios do quartzo e foca no lugar com epóxi. Isso precisa secar por alguns minutos.
  12. Depois de seco, comece a bloquear a superfície, puxando alguns dos desgaseificados tampão de bloqueio através de um dos tubos. A agulha calibre 21 se encaixa perfeitamente dentro do tubo de 0,76 milímetros. Lavar algumas vezes para remover bolhas de ar, e permitir que a câmara para incubar por pelo menos meia hora.

5. Única molécula Experiment Replicação

Uma vez que o modelo de DNA e contas funcionalizados foram preparadas, ea câmara de fluxo está pronto, uma experiência única molécula pode ser realizada.

Materiais: câmara de fluxo preparados, tampão de bloqueio (5X: 20 mM Tris-HCl pH 7,5, 2 mM EDTA, 50 mM NaCl, 1 mg / mL BSA, 0,025% Tween-20) buffer, de trabalho (1X: 20 mM Tris-HCl pH 7,5, 2 mM EDTA, 50 mM NaCl), buffers de replicação T7 com ou sem 10 mM MgCl 2 (1X: 40 mM Tris-HCl pH 7,5, 50 mM K-glutamato, 2 mM EDTA, 100 mg / ml BSA, 10 mM TDT, 600 mM dNTPs), proteínas de replicação, microscópio óptico invertido com objetiva de 10X, câmera CCD, um ímã permanente de terras-raras, bomba de seringa, airspring, iluminador de fibra, computador com software de aquisição de imagem.

  1. Após a célula de fluxo foi bloqueado, ele está pronto para começar o experimento.
  2. Pegue a célula de fluxo e colocá-lo no palco microscópio. Segure a câmara no lugar com clipes de estágioe certifique-se que o canal de fluxo é posicionado em alinhamento com a câmara CCD.
  3. Conecte o fluxo de saída de tubos de célula para a airspring usando um tubo conector maior diâmetro ou uma agulha. O airspring é usado para estabilizar as irregularidades de fluxo. Um tubo de plástico de 50 ml é preenchida com 45ml de água. A tampa do tubo é selada com epóxi. Três buracos são perfurados na tampa, e três pedaços de tubos são inseridos no tubo. Usando epoxy, os tubos são, então, selados para a tampa, impedindo o ar de entrar ou escapar. O airspring está conectado à bomba de seringa, e os tubos de saída da célula de fluxo.
  4. Coloque os tubos de entrada da célula de fluxo em tampão de bloqueio e puxe a seringa para remover qualquer ar no tubo. Um filme suave do tubo de saída vai ajudar a limpar as bolhas de ar aprisionado na célula de fluxo.
  5. Uma vez que todas as bolhas de ar foram removidos, a um quarteirão dos tubos de entrada com uma agulha, e um dos tubos de saída, dobrando-em 1800 e proteger o tubo com fita adesiva.
  6. Diluir o modelo de DNA de ações para 22:00 em 1 ml de tampão de bloqueio desgaseificados. Fluxo para a câmara de fluxo moderado para permitir a cobertura boa superfície de DNA (0,01-0,05 ml / min por 20 minutos funciona bem). Isto pode ser variado com base em quantas moléculas de DNA estão na superfície para cada lote de lamelas ou quantos forem desejados para o experimento.
  7. Diluir a solução estoque talão a 2 4x10-6 contas / ml em 1 ml de tampão de bloqueio desgaseificados. Fluxo para a câmara de 0,01-0,05 ml / min por 15 minutos.
  8. Uma vez que contas são adicionados, por sua vez o fluxo e deixe câmara para alcançar o equilíbrio. Em seguida, fechar tubos tanto de saída. Quaisquer alterações aos tubos sem a câmara fechada vai causar flutuações de pressão que irá exercer uma força sobre as contas e corte as moléculas de DNA amarrados.
  9. Bloquear o tubo de entrada que foi usado para carregar contas com uma agulha, e começar a lavar a célula de fluxo usando a entrada em segundo lugar com solução 1X desgaseificados de tampão de bloqueio em tampão de trabalho. Lavar exaustivamente a uma taxa de 0,01-0,05 ml / min. Agitar manualmente o palco tocando para remover quaisquer contas inespecificamente preso à superfície ( Tapping ).
  10. Uma vez que contas livres são suficientemente afastados, por sua vez o fluxo e deixe câmara para alcançar o equilíbrio. Fechar o tubo de saída aberta e mudar o reservatório de entrada para solução de proteína, lentamente abertura da tomada para evitar mudanças de pressão rápida
  11. Você pode verificar se contas são amarrados ao DNA pela mudança de direção do fluxo ( DNA ).
  12. Agora, a reação enzimática pode ser realizada. Experimentos para a vertente levando-síntese de fazer a solução de 20nm de gp4 helicase e solução de 20nm GP5 polimerase (purificada como um complexo com o seu thioredoxin fator de processabilidade) em tampão desgaseificados replicação T7, que não contém MgCl 2.
  13. Fluxo da solução de proteína na câmara a taxa de fluxo moderado para permitir a ligação eficiente de DNA. Usamos 0,037 ml / min durante 8 minutos, e depois 0,012 ml / min durante 7 minutos.
  14. Lave a câmara com tampão desgaseificados replicação T7 sem MgCl 2 para remover proteínas livres. A taxa de 0,037 ml / min por 3-10 minutos funciona bem.
  15. Após a lavagem, o fluxo de buffer de replicação T7 com MgCl 2 e começar a aquisição de dados. Use um fluxo de 0,012 ml / min, correspondendo a 3 força de arrasto sobre as amarras pN DNA em condições descritos neste protocolo.
  16. Coloque um ímã permanente de terras-raras acima da célula de fluxo antes de imagem para evitar interações inespecíficas entre contas e de superfície.
  17. Ver campo com uma objetiva de 10X e câmera CCD. Foco usando um cordão amarrado.
  18. Posição de um iluminador de fibra em um ângulo de incidência entre 10 graus e paralelo ao estágio do microscópio perto do microscópio. Em campo escuro iluminação é usada para aumentar o contraste da imagem talão.
  19. Aquisição de dados de 20 30 min em um frame rate lenta (tipicamente 2-4 Hz).

6. Resultados representante

Em um experimento bem sucedido você deve ser capaz de observar mais de 100 contas simultaneamente ( síntese vertente Leading ). O experimento deve render numerosos vestígios exibindo a síntese de DNA levando vertente.

Análise de dados:

A fim de medir as taxas e processivities de DNA descontrair e polimerização, as posições precisas de contas deve ser determinado. Você pode alcançá-lo pela montagem dessas posições com funções de 2-dimensional de Gauss. Trajetórias podem ser extraídas através do rastreamento posição grânulo em cada quadro usando software de rastreamento (DiaTrack por exemplo). Agora você está pronto para visualizar trajetórias traçando posição talão como uma função do tempo usando qualquer gráfico paraftware (Origin, por exemplo). Para obter dados de taxa, o ajuste das parcelas com uma regressão linear e calcular o declive. Para processabilidade, determinar o comprimento total do DNA do início ao fim de um evento de encurtamento (Figura 3). Ambos estes números terão de ser convertido em pares de bases. Para converter o movimento de contas para pares de bases, primeiro você precisa para medir o comprimento de uma molécula de DNA λ esticada na taxa de fluxo de reação. Uma vez que o comprimento do DNA λ é conhecido (48.502 bp), você pode calibrar o número de pares de base / pixel de força experimental. Para maior precisão, subtrair a partir de vestígios de interesse um traço fundamental de um corda do grânulo que não é enzimaticamente alterada. Combine todas as medições individuais e taxa de enredo e distribuições processabilidade. Ajustar os dados utilizando as funções de Gauss e single-exponencial, respectivamente (Figura 3).

Figura 1
Figura 1. Molécula única configuração experimental. (A) Duplex λ DNA (48,5 kb) está ligado à superfície da célula de fluxo através da extremidade 5 'de uma fita usando uma interação biotina-estreptavidina, ea extremidade 3' da fita mesmo é anexado a um cordão com um digoxigenina interação anti-digoxigenina. A forquilha de replicação está ferrado, formada na extremidade oposta o talão para permitir o carregamento da polimerase. (B) Bead-DNA conjuntos são distendidos com fluxo laminar de buffer e fotografada usando de campo amplo microscopia óptica. Ao rastrear as posições das contas ao longo do tempo, mantendo uma força constante de alongamento, os comprimentos das construções de DNA pode ser monitorado. (C) perfil de Extensão da ssDNA (círculo preenchido) e dsDNA (círculo aberto) sob forças baixo. A linha tracejada mostra duração cristalográfica da plena ds-DNA λ, 16,3 mM. A grande diferença de comprimento entre ssDNA e dsDNA em forças em torno de 3 pN permite uma observação direta de conversões entre ss-dsDNA e por acompanhar as alterações no comprimento do DNA. A visualização simultânea de um grande número de DNA-coupled contas permite o estudo de muitos replisomes individuais em um experimento.

Figura 2
Figura 2 proteínas Bacteriófago T7 replicação:. DNA polimerase (complexo de GP5 e thioredoxin) e DNA helicase (gp4) sintetizar fita de DNA líder na presença de desoxirribonucleótidos e magnésio. Este processo é acompanhado pelo encurtamento da cadeia de DNA em atraso devido à enrolando. Conversão de dsDNA em ssDNA muda de posição do talão. Medir posição do talão permite a determinação precisa da velocidade e processabilidade de replicação do DNA.

Figura 3
Figura 3. Exemplo de dados típicos de uma única molécula-líder fio-experimento de síntese. Processabilidade da replicação do DNA é igual a um comprimento total do DNA do início ao fim de um evento de encurtamento. A taxa de replicação do DNA é obtido pela montagem do enredo com uma regressão linear e calcular o declive. A taxa mostra inset e distribuições processabilidade que foram obtidos pela combinação de dados de uma série de medições. Os dados foram equipados com funções de Gauss e single-exponencial, respectivamente.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

É importante assegurar que a força de arrasto exercida sobre contas pelo fluxo laminar não influencia atividades enzimáticas das proteínas de replicação. Por exemplo, uma força de 3 pN que corresponde a uma vazão de 0,012 ml / min não afetam a replicação do filamento de DNA de liderança. Isto, contudo, afetar as atividades enzimáticas que ocorrem durante a síntese de DNA coordenada, e, portanto, tem que ser reduzida para 1,5 pN. A força de arrasto pode ser facilmente controlado, alterando a taxa de fluxo ou uma largura do canal de fluxo 5.

O DNA emprega ensaio de alongamento diferenças comprimento entre duplo e single-stranded DNA. No experimento descrito aqui a conversão de dsDNA de ssDNA ocorre como resultado da síntese vertente principal (Figura 2). Você deve se lembrar que o ssDNA é menor do que dsDNA apenas com baixas forças de alongamento inferior a 6 pN (Figura 1).

A possível melhora desse método é o de modificar a vertente atraso do modelo de replicação, anexando um talão segundo a sua extremidade 3'-. Alternância tal permitir a observação direta de atividades enzimáticas que ocorrem em ambas as vertentes de DNA.

Além dos estudos da síntese vertente de liderança e coordenação de replicação, o DNA que se estende do ensaio tem sido empregada com sucesso para examinar a única molécula de cinética de exonuclease λ, ea dinâmica da troca de polimerase durante a replicação 5,6. Em princípio, este método pode ser usado para estudar qualquer enzima de processamento de DNA.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

O desenvolvimento do DNA que se estende do ensaio foi auxiliado por Paulo Blainey, Lee Jong-Bong, e Hamdan Samir. Este trabalho é apoiado pelos Institutos Nacionais de Saúde concede a Charles Richardson (GM54397), e Antoine van Oijen (GM077248).

Materials

Name Company Catalog Number Comments
Bacteriophage λ DNA New England Biolabs N3011L
DNA Oligonucleotides Integrated DNA Technologies
T4 DNA Ligase New England Biolabs M0202L
T4 Polynucleotide Kinase New England Biolabs M0201L
α-digoxigenin Fab Roche Group 11214667001
Tosyl Activated Beads Invitrogen 142-03
Magnetic Separator Invitrogen Dynal MPC
3-aminopropyl-triethoxysilane Sigma-Aldrich A3648 Other aminosilanes can be used or mixed with non-amine reactive silanes for sparser surfaces
Succinimidyl propionate PEG Nektar Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.
Biotin-PEG-NHS Nektar Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.
Double-sided tape Grace Bio-Lab Inc. SA-S-1L 100 μm thickness
Quartz slide Technical Glass 20 mm (W)x 50 mm (L)x 1mm (H) Size to fit on coverslips. Drill holes with diamond-tip drill bits (DiamondBurs.net)
Polyethylene tubing BD Biosciences 427416 0.76 mm ID, 1.22 OD
Other size tubing can be substituted.
Streptavidin Sigma-Aldrich S4762 Make 1 mg/mL solution, 25 μL aliquots in PBS pH 7.3
Deoxyribonucleotide triphosphate solution mix New England Biolabs N0447
Inverted Optical Microscope with 10X Objective Olympus Corporation Olympus IX-51
Permament rare-earth magnet National Imports www.rare-earth-magnets.com
CCD Camera QImaging Rolera-XR Fast 139
Syringe Pump Harvard Apparatus 11 Plus Operate in refill mode to facilitate solution changes
Fiber Illuminator Thorlabs Inc. OSL1

DOWNLOAD MATERIALS LIST

References

  1. Lee, J. B. DNA primase acts as a molecular brake in DNA replication. Nature. 439, 621-624 (2006).
  2. Tanner, N. A., van Oijen, A. M. Single-molecule observation of prokaryotic DNA replication. Methods Mol Biol. 521, 397-410 (2009).
  3. Sofia, S. J., Premnath, V. V., Merrill, E. W. Poly(ethylene oxide) Grafted to Silicon Surfaces: Grafting Density and Protein Adsorption. Macromolecules. 31, 5059-5070 (1998).
  4. Tanner, N. A., Loparo, J. J., van Oijen, A. M. Visualizing single-molecule DNA replication with fluorescence microscopy. J Vis Exp. (2009).
  5. Hamdan, S. M., Loparo, J. J., Takahashi, M., Richardson, C. C., van Oijen, A. M. Dynamics of DNA replication loops reveal temporal control of lagging-strand synthesis. Nature. 457, 336-339 (2009).
  6. van Oijen, A. M. Single-molecule kinetics of lambda exonuclease reveal base dependence and dynamic disorder. Science. 301, 1235-1238 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics