Observation directe d'ADN Enzymes réplication via un ADN simple molécule Stretching Assay

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Nous décrivons une méthode pour l'observation de la réplication en temps réel des molécules individuelles d'ADN médiée par les protéines du système de réplication des bactériophages.

Cite this Article

Copy Citation | Download Citations

Kulczyk, A. W., Tanner, N. A., Loparo, J. J., Richardson, C. C., van Oijen, A. M. Direct Observation of Enzymes Replicating DNA Using a Single-molecule DNA Stretching Assay. J. Vis. Exp. (37), e1689, doi:10.3791/1689 (2010).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Nous décrivons une méthode pour l'observation de la réplication en temps réel des molécules individuelles d'ADN médiée par les protéines du système de réplication des bactériophages. Linéarisé λ ADN est modifiée pour avoir une biotine à l'extrémité d'un brin, et un fragment de la digoxigénine sur l'autre extrémité du même brin. La fin biotinylé est attaché à une lamelle de verre fonctionnalisée et la fin digoxigeninated à une petite perle. L'assemblage de ces attaches ADN perlent à la surface d'une cellule de flux permet un flux laminaire à être appliqués à exercer une force de traînée sur le talon. En conséquence, l'ADN est étiré proche et parallèle à la surface de la lamelle à une force qui est déterminé par le débit (Figure 1). La longueur de l'ADN est mesurée par le suivi de la position de la bille. Différences de longueur entre l'ADN simple et double brin sont utilisées pour obtenir des informations en temps réel sur l'activité des protéines de réplication sur la fourche. Mesure de la position de la bille permet une détermination précise des tarifs et processivities de l'ADN de déroulage et de polymérisation (figure 2).

Protocol

1. Modèle de réplication d'ADN

D'ADN pour la réaction est un ADN linéarisé λ modifié par recuit d'oligonucléotides pour former une fourche de réplication. De plus, la biotine est fixé à l'extrémité d'un brin de l'ADN λ, et un groupement digoxigénine est attaché à l'autre extrémité du même brin 1.

Matériaux: bactériophage λ l'ADN, les oligonucléotides: bras de fourche biotinylé (A: 5'-biotine-AAAAAAAAAAAAAAAAGAGTACTGTACGATCTAGCATCAATCACAGGGTCAGGTTCGTTATTGTCCAACTTGCTGTCC-3 '), bras de fourche λ-complémentaire (B: 5'-GGGCGGCGACCTGGACAGCAAGTTG GACAATCTCGTTCTATCACTAATTCACTAATGCAGGGAGGATTTCAGATATGGCA-3'), l'amorce de fourche (C: 5 ' -TGCCATATCTGAAATCCTCCCTGC-3 '), fin digoxigénine λ-complémentaire (D: 5'-AGGTCG CCGCCCAAAAAAAAAAAA-digoxigénine-3'), l'ADN ligase T4, T4 polynucléotide kinase, bloc thermique.

  1. Phosphoryler les extrémités 5 'des oligonucléotides B et D en utilisant la T4 polynucléotide kinase.
  2. Recuit oligonucléotides A, B et C de l'ADN λ en une seule étape en ajoutant un excès de 10 fois d'oligonucléotides A et B, et un excès de 100 fois de C oligonucléotide dans tampon ADN ligase T4.
  3. Chauffer le mélange à 65 ° C dans le bloc thermique. Une fois chauffée, tournez le bloc de chauffage hors tension et permettre un refroidissement lent à bien recuit oligonucléotides.
  4. Ajouter T4 ADN ligase au mélange et laisser incuber à température ambiante pendant 2 heures. ADN ligase T4 catalyser la bonne jonction des oligonucléotides A et B, et l'ADN λ.
  5. Enfin, recuire les oligonucléotides D dans le modèle de réplication de l'ADN en ajoutant 100 fois plus de D oligonucléotides à l'égard de l'ADN dans un tampon de l 'ADN ligase T4.
  6. Incuber le mélange à 45 ° C pendant 30 min dans le bloc feu et laisser refroidir lentement à température ambiante en tournant bloquer le feu.
  7. Le modèle de réplication d'ADN finale est désormais prêt à l'emploi. Nous conservons le modèle à une concentration de 1,4 nM à 4 ° C pendant plusieurs semaines.

2. Perles

Les perles sont fonctionnalisés avec un fragment Fab ayant une spécificité pour la digoxigénine. Ils peuvent être ensuite fixé à la matrice d'ADN 2 de réplication.

Matériaux: tosyle billes activées, α-digoxigénine fragment Fab, Tampon A: 0,1 M H3BO3 pH 9,5, tampon B: 0,1 M PBS, pH 7,4, 0,1% w / v de BSA, Tampon C: 0,2 M Tris-HCl pH 8,5 (25 ° C), 0,1% p / v de BSA, séparateur magnétique, Rotator.

  1. Resuspendre la solution stock de perles et de transférer une petite aliquote dans le tube eppendorf. Placer le tube dans une fente du séparateur magnétique et incuber jusqu'à ce qu'une solution efface, puis retirer le surnageant par pipetage.
  2. Ajouter du tampon A, qui va activer des groupes tosyle pour le couplage d'anticorps. Mélanger doucement par pipetage et éliminer le tampon avec le séparateur magnétique.
  3. Ajouter fragment Fab et perles resuspendre nouveau dans le tampon A, mélanger soigneusement et incuber 16-24 heures à 37 ° C en utilisant des rotateurs. Après incubation, les billes séparées utilisant le séparateur magnétique et éliminer le tampon.
  4. Lavez perles en ajoutant tampon B et incuber à 4 ° C pendant 5 min. Retirez le tampon en utilisant séparateur magnétique. Répéter deux lavages.
  5. Ajouter le tampon C et incuber à 37 ° C pendant 4 heures pour bloquer gratuitement les groupes tosyle. Perles séparées utilisant séparateur magnétique et éliminer le tampon.
  6. Laver deux fois en tampon B et partie aliquote d'utilisation. Perles peuvent être conservés à 4 ° C pendant 1 an ou plus sans perte substantielle de la qualité (notre solution mère contient 1 - 2x10 9 billes / ml).

3. Lamelles fonctionnalisés

Pour permettre la fixation de l'ADN à la lamelle de verre, le verre est d'abord fonctionnalisés avec un aminosilane, qui est ensuite couplé à des molécules de PEG biotinylé. Ce revêtement contribue à réduire les interactions non spécifiques de l'ADN et les protéines de réplication avec la surface 3,4.

Matériaux: lamelles de verre, des pots de coloration, 3-aminopropyltriéthoxysilane, méthoxy-PEG5k-NHS ester biotine-PEG5k-NHSester, l'acétone, 1M KOH, l'éthanol, Four Bain sonicateur,

  1. Nettoyez soigneusement les lamelles de verre en les plaçant dans des bocaux coloration et le remplissage des bocaux avec de l'éthanol. Soniquer pendant 30 minutes, rincer les bocaux et les remplir de 1 M KOH. Répéter deux lavages.
  2. Pour la réaction de fonctionnalisation d'abord, toute trace d'eau doivent être enlevés. Remplissez les bocaux avec de l'acétone et soniquer pendant 10 min. Vider et remplir à nouveau avec de l'acétone.
  3. Préparer un 2% v / v solution du réactif de silane dans l'acétone. Ajouter à la coloration des bocaux et agiter pendant 2 minutes. Cette réaction des couples du groupe alcoxy de l'aminosilane à la vitre, laissant une amine réactive pour la prochaine étape de couplage. Arrêter la réaction avec un large excès d'eau.
  4. Sécher les lamelles en les cuisant à 110 °; C dans le four pendant 30 minutes.
  5. Préparer un méthoxy 50:1: biotine PEG mélange dans 100 mM NaHCO 3 à pH 8,2. But pour environ 0,2% p / v PEG biotinylé.
  6. Pipeter 100 uL du mélange PEG sur une lamelle sèche silanisé et placer une autre lamelle sur le dessus. Y compris une entretoise lamelle de verre permettra la séparation des lamelles.
  7. Incuber les lamelles dans la solution de PEG pendant 3 heures, puis de séparer chaque paire de lamelles et laver abondamment avec de l'eau. Veillez à garder les lamelles latérales fonctionnalisées en tant que côté une fois sera recouvert avec du PEG.
  8. Sécher les lamelles avec de l'air et de stocker sous vide dans un dessiccateur. Les surfaces restent stables pendant au moins un mois, donc des dizaines de lamelles peuvent être faites dans un lot et utilisés au besoin.

4. Préparation Chambre de circulation

L'expérience est réalisée en utilisant une chambre de flux simple, construit avec une lamelle fonctionnalisée, scotch double-face, une lame de quartz et les tubes. Une chambre d'écoulement est préparé pour chaque expérience unique molécule 2,4.

Matériaux: ruban adhésif double face, une lame de rasoir, toboggan de quartz avec des trous pour les tuyaux, à séchage rapide époxy, lamelle fonctionnalisée, solution de streptavidine (25 uL de 1 mg / ml dans le PBS), des tubes, un tampon de blocage (5X: Tris 20 mM pH 7,5, EDTA 2 mM, NaCl 50 mM, 0,2 mg / ml BSA, 0,005% de Tween-20), tampon de travail (1X: 20 mM Tris-HCl pH 7,5, EDTA 2 mM, NaCl 50 mM).

  1. Commencez par mélanger et placer 5 ml de tampon de blocage et 20 ml de tampon de travailler dans un dessiccateur pour éliminer les bulles d'air pour les étapes ultérieures.
  2. Prenez une lamelle de PEG-fonctionnalisés et la propagation de la solution de streptavidine 125 PBS-dilué sur la surface. Laissez ce à incuber pendant 20 minutes à température ambiante pendant la préparation d'autres parties de la chambre, ce qui permet de lier streptavidine biotines surface.
  3. Coupez un morceau de scotch double-face pour correspondre à la taille de la diapositive à quartz. Marquer la position des trous de tuyau sur la bande de telle sorte que les grandes lignes de la chambre d'écoulement peuvent être tirées sur la bande.
  4. Faire un canal central 3 mm de large et de rectangles contenant les deux trous. Nous utilisons des chambres d'écoulement avec deux entrée et deux de sortie en forme de Y canaux.
  5. Coupez le long du contour dessiné, rendant coupes droites et propres pour s'assurer que personne ne dépasse colle dans le canal.
  6. Nettoyez soigneusement l'acétone de quartz à l'aide ou l'éthanol pour enlever l'adhésif de la construction de cellules d'écoulement précédentes.
  7. Trouver le meilleur alignement du contour de canal, retirer un côté de l'adhésif et placer soigneusement le ruban sur la lame de quartz. Soyez prudent afin d'aligner la bande correctement, comme les trous d'entrée et de sortie doivent rester débloqué.
  8. Couper des longueurs de tuyaux pour l'entrée et la sortie de la cellule d'écoulement. Il aide à couper l'extrémité du tube à environ un angle de 30 ° pour que le tube ne sera pas de presse à plat contre le fond de chambre. Placer les tubes sur une sorte de soutien (support de tubes, par exemple) de les suspendre pour une fixation facile à la cellule de flux dans les prochaines étapes.
  9. Rincer la lamelle recouvertes de streptavidine abondamment à l'eau et sécher à l'air comprimé. Rappelez-vous que seul un côté est fonctionnalisé. Retirer de l'autre côté du support cassette et placer la lame de quartz sur la lamelle.
  10. Appuyez légèrement sur la lamelle pour faire sortir tout l'air emprisonné dans la colle. Cela permettra d'éviter les bulles d'air d'entrer dans le canal d'écoulement.
  11. Scellez les côtés de la chambre à l'époxy. Insérer le tuyau coupé dans les trous du quartz et sceller en place à l'époxy. Cela doit sécher pendant quelques minutes.
  12. Une fois sèche, commencer à bloquer la surface en tirant partie de la mémoire tampon dégazée par un blocage de tubes. Une aiguille de calibre 21 correspond parfaitement à l'intérieur du tube de 0,76 mm. Rincez plusieurs fois pour enlever les bulles d'air, et permettre à la chambre à incuber pendant au moins une demi-heure.

5. Expérience de la réplication à molécule unique

Une fois la matrice d'ADN et de billes fonctionnalisées ont été préparées, et la chambre d'écoulement est prêt, une expérience unique molécule peut être effectuée.

Matériaux: chambre de flux Préparé, tampon de blocage (5X: 20 mM Tris-HCl pH 7,5, EDTA 2 mM, NaCl 50 mM, 1 mg / ml BSA, 0,025% de Tween-20), tampon de travail (1X: 20 mM Tris-HCl pH 7,5, EDTA 2 mM, NaCl 50 mM), des tampons réplication T7 avec ou sans 10mM MgCl 2 (1X: 40 mM Tris-HCl pH 7,5, 50 mM de K-glutamate, EDTA 2 mM, 100 ug / ml de BSA, 10 mM TNT, 600 uM dNTP), les protéines de réplication, inversé microscope optique avec objectif 10X, caméra CCD, permanent aimants de terres rares, une pompe seringue, ressort pneumatique, illuminateur de fibre, un ordinateur avec logiciel d'acquisition de l'image.

  1. Après la cellule de débit a été bloqué, il est prêt à commencer l'expérience.
  2. Prenez la cellule d'écoulement et le placer sur la platine du microscope. Tenir la chambre en place avec des clips étapeet être sûr que le canal d'écoulement est positionné dans l'alignement avec caméra CCD.
  3. Raccorder les tubes de flux de cellules de sortie au ressort pneumatique en utilisant un tuyau de plus grand diamètre de connecteur ou une aiguille. Le ressort pneumatique est utilisé pour stabiliser les irrégularités de débit. Un tube en plastique de 50 ml est rempli avec 45ml d'eau. Le couvercle du tube est scellé à l'époxy. Trois trous sont percés dans le couvercle, et trois morceaux de tubes sont insérés dans le tube. L'utilisation d'époxy, les tubes sont ensuite scellés pour le couvercle, empêchant tout l'air d'entrer ou de sortir. Le ressort pneumatique est relié à la pompe seringue, et pour les tubes de sortie de la cellule d'écoulement.
  4. Placer les tubes d'entrée de la cellule de flux dans un tampon bloquant et tirez sur la seringue pour enlever tout l'air dans le tube. Un film de douceur du tube de sortie aidera à éclaircir les bulles d'air piégées dans la cellule d'écoulement.
  5. Une fois que toutes les bulles d'air ont été enlevés, bloquer l'un des tubes d'entrée avec une aiguille, et l'un des tubes de sortie en la pliant en 1800 et la sécurisation du tube avec du ruban adhésif.
  6. Diluer la matrice d'ADN d'actions à 22 heures dans 1 ml de tampon de blocage dégazée. Débit dans la chambre à débit modéré pour permettre une couverture de surface de bons d'ADN (0,01 à 0,05 ml / min pendant 20 minutes fonctionne bien). Cela peut être varié en fonction du nombre de molécules d'ADN sont sur la surface de chaque lot de lamelles ou combien sont souhaitées pour l'expérience.
  7. Diluer la solution mère talon à 2-4x10 6 billes / ml dans 1 ml de tampon de blocage dégazée. Débit dans la chambre à 0.01 à 0,05 ml / min pendant 15 minutes.
  8. Une fois que les perles sont ajoutés, tournez la circulation hors et permettre la chambre pour atteindre l'équilibre. Ensuite, fermez les deux tubes de sortie. Tout changement aux tubes sans la chambre fermée sera causer des fluctuations de pression qui va exercer une force sur les billes et le cisaillement des molécules d'ADN attachés.
  9. Bloquer le tube d'entrée qui a été utilisé pour le chargement des perles avec une aiguille, et de commencer à laver la cellule de flux en utilisant la deuxième entrée avec une solution dégazée 1X de tampon de blocage dans un tampon de travail. Laver abondamment à raison de de 0,01 à 0,05 ml / min. Agiter manuellement le stade en appuyant à éliminer toutes les billes non spécifique collé à la surface ( Tapping ).
  10. Une fois perles libres sont suffisamment éloignés, tournez la circulation hors et permettre la chambre pour atteindre l'équilibre. Fermer le tube de sortie ouverte et basculer le réservoir d'entrée à la solution de protéines, ouvrant lentement la prise pour éviter les changements rapides de pression
  11. Vous pouvez vérifier si les perles sont attachés à l'ADN en changeant la direction de l'écoulement ( l'ADN ).
  12. Maintenant, la réaction enzymatique peut être effectuée. Expériences de synthèse pour mener brin font solution de 20nm de GP4 hélicase et une solution de 20nm d'gp5 polymérase (purifié comme un complexe avec son facteur de processivité thiorédoxine) dans un tampon de réplication dégazé T7 qui ne contient pas de MgCl 2.
  13. Débit de la solution de protéines dans la chambre à débit modéré pour permettre une liaison efficace avec l'ADN. Nous utilisons 0,037 ml / min pendant 8 minutes, puis 0,012 ml / min pendant 7 minutes.
  14. Laver la chambre avec un tampon de réplication dégazé T7 sans MgCl 2 pour éliminer les protéines libres. Le taux de 0,037 ml / min pendant 3-10 minutes fonctionne très bien.
  15. Après le lavage, le tampon de flux de réplication T7 avec MgCl 2 et de commencer l'acquisition des données. Utiliser un débit de 0,012 ml / min correspondant à 3 force de traînée sur le pN longes l'ADN dans les conditions décrites dans le présent protocole.
  16. Placez un aimant permanent de terres rares-dessus de la cellule de débit avant d'imagerie pour éviter les interactions non spécifiques entre les perles et de surface.
  17. Voir le terrain avec un objectif 10x et d'une caméra CCD. Concentrer l'aide d'un captif perle.
  18. Placez un illuminateur de fibre à un angle d'incidence entre 10 degrés et parallèle à la platine du microscope à proximité du microscope. Éclairage sur fond noir est utilisé pour augmenter le contraste dans l'imagerie de perles.
  19. Acquérir des données pour 20 30 min à une cadence lente (généralement 2-4 Hz).

6. Les résultats représentatifs

Dans une expérience réussie, vous devriez être en mesure d'observer plus de 100 billes simultanément ( synthèse du brin leader ). L'expérience devrait donner de nombreuses traces affichant leader de synthèse d'ADN brin.

Analyse des données:

Afin de mesurer les taux et processivities de l'ADN de déroulage et de polymérisation, la position précise des perles doit être déterminée. Vous pouvez y parvenir en ajustant ces postes avec des fonctions de Gauss à 2 dimensions. Trajectoires peuvent alors être extraites par la position de billes de suivi à chaque image en utilisant un logiciel de suivi (DiaTrack par exemple). Maintenant vous êtes prêt à visualiser les trajectoires en traçant la position billes en fonction du temps en utilisant n'importe quel graphique afinftware (par exemple l'origine). Pour obtenir des données de taux, l'ajustement des parcelles avec une régression linéaire et de calculer la pente. Pour processivité, déterminer la longueur totale de l'ADN du début à la fin d'un événement raccourcissement (figure 3). Ces deux numéros devront être convertis en paires de bases. Pour convertir le mouvement du talon paires de bases, vous devez d'abord mesurer la longueur d'une molécule d'ADN λ étiré au débit de réaction. Puisque la longueur de l'ADN λ est connue (48 502 pb), vous pouvez calibrer le nombre de paires de base / pixel à la force expérimentale. Pour une précision accrue, de soustraire les traces d'intérêt de base de traces d'une attache perle qui n'est pas enzymatiquement modifiés. Combiner tous les mesures individuelles et le taux de l'intrigue et distributions processivité. Ajuster les données en utilisant des fonctions de Gauss et simple exponentielle, respectivement (figure 3).

Figure 1
Figure 1. Molécule unique dispositif expérimental. (A) Duplex λ ADN (48.5 ko) est attaché à la surface de la cellule d'écoulement par l'extrémité 5 'd'un brin à l'aide d'une interaction biotine-streptavidine, et l'extrémité 3' du même brin est attachée à un cordon en utilisant une digoxigénine anti-digoxigénine interaction. Une fourche de réplication apprêté est formé à l'extrémité opposée au bourrelet de permettre le chargement de la polymérase. (B) de billes d'ADN assemblées sont tendus à l'aide d'écoulement laminaire de tampon et imagée en utilisant gamme microscopie optique en champ. En suivant les positions des perles au fil du temps, tout en maintenant une force constante étirements, les longueurs des constructions d'ADN peuvent être surveillés. Profil d'extension (c) de ADNss (cercle plein) et ADNdb (cercle ouvert) sous de faibles forces. La ligne pointillée indique la longueur cristallographique totalement ds-λ ADN, 16,3 um. La grande différence de longueur entre ADNsb et ADNdb sur les forces de l'ordre de 3 pN permet une observation directe des conversions entre l'art et ADNdb en observant les changements dans la longueur de l'ADN. La visualisation simultanée d'un grand nombre d'ADN couplé perles permet l'étude de nombreux replisomes individuels dans une expérience.

Figure 2
Figure 2 protéines bactériophage T7 réplication:. ADN-polymérase (complexe de GP5 et la thiorédoxine) et l'ADN hélicase (gp4) synthétiser des brins d'ADN leader dans la présence de désoxyribonucléotides et de magnésium. Ce processus est accompagné par un raccourcissement du brin d'ADN à la traîne à cause de l'enroulement. Conversion d'ADN double brin dans ADNss changements de position de la bille. Mesure de position de la bille permet une détermination précise de la vitesse et la processivité de la réplication de l'ADN.

Figure 3
Figure 3. Exemple de données typiques d'une molécule unique expérience de synthèse d'avant-brin. Processivité de réplication de l'ADN est égale à une longueur totale de l'ADN du début à la fin d'un événement raccourcissement. Le taux de réplication de l'ADN est obtenue en ajustant la parcelle avec une régression linéaire et le calcul de la pente. Le taux encart montre et les distributions processivité qui ont été obtenus en combinant les données à partir d'un certain nombre de mesures. Les données ont été ajustés à l'aide des fonctions de Gauss et simple exponentielle, respectivement.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Il est important de s'assurer que la force de traînée exercée sur les billes par flux laminaire ne pas influencer les activités enzymatiques des protéines de réplication. Par exemple, une force de 3 PN qui correspond à un débit de 0,012 ml / min n'affecte pas la réplication du brin d'ADN de premier plan. Cela ne va cependant affecter les activités enzymatiques qui ont lieu pendant la synthèse d'ADN coordonnés, et il doit donc être réduite à 1,5 pN. La force de traînée peut être facilement contrôlé en changeant le débit ou une largeur du canal 5 de flux.

L'ADN d'étirement test emploie des différences de longueur entre le double et simple brin d'ADN. Dans l'expérience décrite ici la conversion de l'ADN double brin d'ADN simple brin se produit en tant que résultat de la synthèse du brin leader (figure 2). Vous devriez vous rappeler que l'ADN simple brin est plus courte que ADNdb seulement à de faibles forces d'étirement en dessous de 6 pN (figure 1).

Une amélioration possible de cette méthode est de modifier le brin retardé du modèle de réplication en attachant un deuxième talon à son extrémité 3 '. Ces alternance permettrait l'observation directe des activités enzymatiques qui ont lieu à deux brins de l'ADN.

Outre les études de la synthèse et la réplication brin précoce coordonné, l'ADN d'étirement de dosage a été employée avec succès pour examiner la molécule unique cinétique de l'exonucléase λ, et la dynamique des échanges polymérase lors de la réplication 5,6. En principe, cette méthode peut être utilisée pour étudier toute enzyme traitement de l'ADN.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgments

Le développement de l'ADN qui s'étend de dosage a été aidé par Paul Blainey, Bong Jong-Lee, et Samir Hamdan. Ce travail est soutenu par le National Institutes of Health accorde à Charles Richardson (GM54397), et Antoine van Oijen (GM077248).

Materials

Name Company Catalog Number Comments
Bacteriophage λ DNA New England Biolabs N3011L
DNA Oligonucleotides Integrated DNA Technologies
T4 DNA Ligase New England Biolabs M0202L
T4 Polynucleotide Kinase New England Biolabs M0201L
α-digoxigenin Fab Roche Group 11214667001
Tosyl Activated Beads Invitrogen 142-03
Magnetic Separator Invitrogen Dynal MPC
3-aminopropyl-triethoxysilane Sigma-Aldrich A3648 Other aminosilanes can be used or mixed with non-amine reactive silanes for sparser surfaces
Succinimidyl propionate PEG Nektar Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.
Biotin-PEG-NHS Nektar Similar PEGs can be purchased from Nanocs, CreativePEGWorks, etc.
Double-sided tape Grace Bio-Lab Inc. SA-S-1L 100 μm thickness
Quartz slide Technical Glass 20 mm (W)x 50 mm (L)x 1mm (H) Size to fit on coverslips. Drill holes with diamond-tip drill bits (DiamondBurs.net)
Polyethylene tubing BD Biosciences 427416 0.76 mm ID, 1.22 OD
Other size tubing can be substituted.
Streptavidin Sigma-Aldrich S4762 Make 1 mg/mL solution, 25 μL aliquots in PBS pH 7.3
Deoxyribonucleotide triphosphate solution mix New England Biolabs N0447
Inverted Optical Microscope with 10X Objective Olympus Corporation Olympus IX-51
Permament rare-earth magnet National Imports www.rare-earth-magnets.com
CCD Camera QImaging Rolera-XR Fast 139
Syringe Pump Harvard Apparatus 11 Plus Operate in refill mode to facilitate solution changes
Fiber Illuminator Thorlabs Inc. OSL1

DOWNLOAD MATERIALS LIST

References

  1. Lee, J. B. DNA primase acts as a molecular brake in DNA replication. Nature. 439, 621-624 (2006).
  2. Tanner, N. A., van Oijen, A. M. Single-molecule observation of prokaryotic DNA replication. Methods Mol Biol. 521, 397-410 (2009).
  3. Sofia, S. J., Premnath, V. V., Merrill, E. W. Poly(ethylene oxide) Grafted to Silicon Surfaces: Grafting Density and Protein Adsorption. Macromolecules. 31, 5059-5070 (1998).
  4. Tanner, N. A., Loparo, J. J., van Oijen, A. M. Visualizing single-molecule DNA replication with fluorescence microscopy. J Vis Exp. (2009).
  5. Hamdan, S. M., Loparo, J. J., Takahashi, M., Richardson, C. C., van Oijen, A. M. Dynamics of DNA replication loops reveal temporal control of lagging-strand synthesis. Nature. 457, 336-339 (2009).
  6. van Oijen, A. M. Single-molecule kinetics of lambda exonuclease reveal base dependence and dynamic disorder. Science. 301, 1235-1238 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics