البطانية نضوج خلية يتوسط المشارك ثقافة الإنسان الخلايا الجذعية الجنينية إلى خلايا البنكرياس المنتجة للأنسولين في نهج التفاضل إخراج

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

الدراسة الحالية يصف نهجا موجها التمايز في حفز البنكرياس من تمايز الخلايا الجذعية الجنينية البشرية. أهمية كبيرة هو أن العثور على نضوج الخلايا البطانية يتوسط شارك في ثقافة الخلايا الجذعية الجنينية البشرية المستمدة الأسلاف البنكرياس الى خلايا الانسولين تعبير.

Cite this Article

Copy Citation | Download Citations

Jaramillo, M., Banerjee, I. Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach. J. Vis. Exp. (61), e3759, doi:10.3791/3759 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

الخلايا الجذعية الجنينية (ESC) واثنين من الخصائص الرئيسية: أنها يمكن أن تكون لأجل غير مسمى نشر في المختبر في حالة غير متمايزة، وأنها ذات قوة تناسلية متعددة، ومن ثم تكون له القدرة على التمايز إلى أنساب متعددة. هذه الخصائص تجعل المجالس الاقتصادية والاجتماعية جذابة للغاية لعلاج الخلايا والتطبيقات القائمة على العلاج التجديدي 1. ولكن لكامل إمكاناتها لتتحقق هذه الخلايا لا بد من التفريق في الظواهر ناضجة وظيفية، والتي هي مهمة شاقة. وثمة نهج واعدة في إحداث تمايز الخلايا هو محاولة لتقليد وعن كثب مسار توالد الأعضاء في إعداد المختبر في. ومن المعروف تنمية البنكرياس تحدث في مراحل معينة بدءا من الأديم الباطن، والتي يمكن أن تتطور إلى أجهزة عدة، بما في ذلك الكبد والبنكرياس. لا يمكن أن يتحقق عن طريق الاستقراء الأديم الباطن من تعديل المسار العقدي من خلال إضافة Activin A 3 بالاقتران مع عوامل نمو عدة 4-7 في المختبر عن طريق إضافة سايكلوبامين 8. وتوسطت نضوج البنكرياس بنسبة الأحداث الموازية عدة بما في ذلك تثبيط الإشارات الشق؛ تجميع أسلاف البنكرياس إلى 3-dimentional مجموعات؛ تحريض الأوعية الدموية، على سبيل المثال لا الحصر. حتى الآن الأكثر نجاحا في المختبر من نضوج الخلايا المشتقة ESC سلف البنكرياس قد تحققت من خلال تثبيط الشق يشير بواسطة مكملات DAPT 9. على الرغم من نجاح، وهذا يؤدي إلى انخفاض العائد من النمط الظاهري ناضجة مع انخفاض وظيفة. وهناك مجال أقل درس هو تأثير الخلية البطانية يشير في نضوج البنكرياس، والذي يتزايد تقدير باعتباره عاملا مهما في المساهمة في الجسم الحي، البنكرياس نضوج جزيرة 10،11.

الدراسة الحالية يستكشف تأثير مثل هذه endothelخلية يشير الاتحاد العالمي للتعليم في نضوج ESC المستمدة من خلايا البنكرياس السلف في انتاج الانسولين جزيرة تشبه الخلايا. نحن الإبلاغ عن متعدد المراحل بروتوكول التمايز الموجهة حيث يتم لأول مرة المجالس الاقتصادية والاجتماعية التي يسببها الإنسان نحو الأديم الباطن بواسطة Activin وجنبا إلى جنب مع تثبيط مسار PI3K. ويتم تحقيق مواصفات البنكرياس من خلايا الأديم الباطن عن طريق تثبيط الإشارات من قبل القنفذ الصوتي سايكلوبامين جنبا إلى جنب مع الحث ريتينويد من قبل إضافة حمض الريتينويك. هو فعل المرحلة النهائية من النضج بواسطة إشارات الخلية البطانية التي حققتها تكوين ثقافة مشتركة. في حين تم اختبار العديد من الخلايا البطانية في الثقافة المشتركة، هنا نقدم البيانات المتوفرة لدينا مع خلايا الفئران الاوعية الدموية الدقيقة في القلب البطانية (RHMVEC)، في المقام الأول لسهولة تحليلها.

Protocol

1. خلية الصيانة

  1. واستمرت hESC H1 (معهد ويسيل) على الآبار hESC المؤهلين المغلفة matrigel mTeSR1 مع وسائل الاعلام، مع وسائل الاعلام تتغير كل يوم. وقد تم طلاء الآبار بواسطة حل matrigel المخففة، التي أعدت عن طريق إضافة 300 ميكرولتر من matrigel hESC في 25 مل من DMEM: F12. تم إضافة 1 مل من هذا الحل matrigel إلى كل بئر من لوحة بئر الست، أو 400 ميكروليتر وأضاف أن كل بئر من لوحة 12 جيدا ويسمح للمعطف لمدة 1 ساعة في درجة حرارة الغرفة. وpassaged ميكانيكيا الخلايا في نسبة انقسام 01:04 عن طريق كشط المستعمرات بمجرد أن تم التوصل إليها بين 1 و 1.5mm في القطر.
  2. RHMVEC (مركزنا التكنولوجيات) واستمر في وسائل الاعلام-131 MCDB مع وسائل الإعلام تغيير كل يوم. وانقسمت الخلايا trypsinization مرة واحدة وقد تم التوصل التقاء 80٪ في نسبة انقسام 01:03. واستخدمت الخلايا البطانية بين المقاطع 3 و 7 لهذه الدراسة.

2. إعداد حلول للسهم

  1. Activin أعيد A في 50 ميكروغرام / مل في P عقيمBS تحتوي على 0.1٪ مصل بقري الزلال. وكان aliquoted الحل وتخزينها عند درجة حرارة -20 درجة مئوية.
  2. وأعيد تشكيل EGF في 500 ميكروغرام / مل في حمض الخليك 10 ملي العقيمة. وكان aliquoted الحل وتخزينها عند درجة حرارة -20 درجة مئوية.
  3. وأعيد تشكيل الانسولين بنسبة 10 ملغم / لتر وذلك بإضافة حمض H 2 O (الرقم الهيدروجيني ≤ 2)، الذي أعدته بالإضافة إلى 0.1 مل حامض الخليك الجليدي إلى 10 مل من الماء.
  4. وأعيد تشكيل DAPT في DMSO في 18 ملغ / مل. وقد تضعف كذلك إلى تركيز ميكرومتر 300 في DMEM: F12، aliquoted وتخزينها في -20 درجة مئوية.
  5. وأعيد تشكيل KAAD-سايكلوبامين في DMSO في 5mg/ml. وقد تضعف كذلك إلى تركيز ميكرومتر 2 في DMEM: F12، aliquoted وتخزينها في -20 درجة مئوية.
  6. وأعيد تشكيل جميع العابر حمض الريتينويك بنسبة 2.7 ملغ / مل في الإيثانول بنسبة 95٪. وقد تضعف كذلك إلى تركيز 2MM في DMEM: F12، aliquoted وتخزينها في -80 درجة مئوية.

3. نهائي الأديم الباطن (DE) والبنكرياس السلف التعريفي (بي بي)

  1. مرة واحدة حوكان المستعمرات ESC تم التوصل اليه بين 1 و 1.5mm في القطر، ويقوم DE الاستقراء بإضافة DMEM: F12 تستكمل مع جيش صرب البوسنة، B27 0.2٪، و 100 نانوغرام / مل Activin ألف و1 ميكرومتر Wortmannin لمدة 4 أيام (يوم 0-يوم 4) مع وسائل الاعلام تتغير كل يوم.
  2. بعد DE الاستقراء كان كاملا، وكان المستحث البنكرياس تحريض السلف عن طريق تغيير وسائل الإعلام لDMEM: F12 تستكمل مع جيش صرب البوسنة، B27 0.2٪ وKAAD سايكلوبامين، في تركيز 0.2 ميكرومتر لمدة 24 ساعة (يوم 4 يوم 5).
  3. بعد 24 ساعة تم تغيير وسائل الإعلام إلى DMEM: F12 تستكمل مع B27، 0.2٪ BSA، KAAD-سايكلوبامين في تركيز ميكرومتر 0.2 و جميع العابر حمض الريتينويك في تركيز 2 ميكرومتر لمدة 3 أيام مع وسائل الاعلام تتغير كل يوم (يوم لمدة 5 أيام 8) .

4. البنكرياس نضوج

  1. بعد الاستقراء PP، تم تغيير جميع الفئات إلى وسائل الإعلام نضوج تتألف من DMEM: F12 تستكمل مع B27، ميكروغرام نا 0.2٪ BSA، 10 نيكوتيناميد مم، 25 ميكروغرام / مل الأنسولين، 30 نانومتر سيو (3) و50 2 / ترانسفيرين مل لمدة 2 دAYS مع وسائل الاعلام تتغير كل يوم (يوم 8 يوم 10).
  2. بعد 2 أيام في وسائل الإعلام النضج، يتم تنفيذ الخطوة نضوج النهائي في استخدام مواز ظروف عديدة ومختلفة للمقارنة. وكان المستحث التفاضل وفقا للشروط التالية: (ط) باستخدام الشق المانع DAPT (II) باستخدام شارك في ثقافة وسائل الاعلام فقط دون الخلايا البطانية، والتحكم و(III) باستخدام اتصال يشترك في الثقافة مع خلايا RHMVEC. واستمرت الخلايا في وسائل الاعلام DAPT أو زملاء الثقافة لمدة اسبوع (يوم 10 يوم 17) مع وسائل الاعلام تتغير كل يوم.
    1. وقد أعدت وسائل الاعلام DAPT من خلال استكمال وسائل الإعلام مع نضوج DAPT ميكرومتر 30. واول من كشف عن خلايا في هذه المجموعات لاستكمال MCDB131 لمدة 24 ساعة ويتعرض بعد ذلك إلى وسائل الإعلام DAPT لمدة 6 أيام (يوم 11 يوم 17).
    2. وقد أعد شارك في ثقافة وسائل الاعلام من خلال استكمال MCDB-131 وسائل الاعلام مع B27، 0.2٪ BSA، 10 نيكوتيناميد مم، 10 نانوغرام / مل EGF، 1 ميكروغرام / مل الهيدروكورتيزون، 10 ملغ EndoGro، 90 ميكروغرام / مل الهيبارين. لحالة مراقبة وسائل الاعلام تعرضوا للتمييز الخلاياوالمتوسطة-131 MCDB كاملة لمدة 24 ساعة (يوم 10 يوم 11) وبعد ذلك تم تغيير وسائل الاعلام الى المشاركة في ثقافة وسائل الاعلام لمدة 6 أيام (يوم 11 يوم 17) (أي الخلايا البطانية).
    3. عن حالة التعاون ثقافة الاتصال، وأضيف 1000000 RHMVEC إلى الخلايا التفريق في كامل وسائل الاعلام-131 MCDB (مركزنا التكنولوجيات) لمدة 24 ساعة (يوم 10 يوم 11) للسماح للمرفق. بعد 24 ساعة تم تغيير وسائل الإعلام إلى المشاركة في ثقافة وسائل الاعلام لمدة 6 أيام (يوم 11 يوم 17) مع وسائل الاعلام تتغير كل يوم.

5. qRT-PCR تحليل

  1. في نهاية كل مرحلة من التمايز (الأديم الباطن؛ السلف البنكرياس؛ جزيرة ناضجة) هي lysed وتم استخراج الحمض النووي الريبي باستخدام الحمض النووي الريبي الثاني NucleoSpin استخلاص عدة وفقا لتعليمات الشركة الصانعة.
  2. وقد تم تحليل الحمض النووي الريبي عن طريق فحص الحمض النووي الريبي جودة الامتصاصية في 260 نانومتر و 280، تليها الكمي باستخدام الحمض النووي الريبي SmartSpec زائد طيفي.
  3. تم إجراء النسخ العكسي باستخدام ImProm الثاني ك النسخ العكسيوفقا لتعليمات الشركة الصانعة. وأجريت جميع التفاعلات مع 100 نانوغرام من الحمض النووي الريبي.
  4. تم تنفيذ qRT-PCR باستخدام QPCR Mx3005P نظام (اجيلنت) وبريليانت الثاني SYBR الأخضر مزيج سيد QPCR وفقا لتعليمات الشركة الصانعة. يتم سرد الاشعال المستخدمة في الجدول 1. تم تنفيذ الخطوة التهيئة عند 50 درجة مئوية لمدة 2 دقيقة تليها 95 درجة مئوية لمدة 10 دقائق. وأجريت دورات التضخيم 50 على النحو التالي: 95 درجة مئوية لمدة 30 ثانية و 54 درجة مئوية لمدة 30 ثانية و 72 درجة مئوية لمدة 1 دقيقة.
  5. تم احتساب التغير أضعاف التعبير مرنا الهدف أكثر من خلايا غير متمايزة من القيم المقطعية باستخدام الصيغ التالية:
    ΔCT (ماركر ط) = CT (ماركر ط) - CT (GAPDH)
    Δ ΔCT (ماركر ط) = ΔCT (ماركر ط) (نموذج) - ΔCT (ماركر ط) (خلايا غير متمايزة)
    التعبير النسبية (ماركر ط) = 2-ΔΔCT(علامة ط)

6. كيمياء سيتولوجية مناعية

  1. في نهاية كل مرحلة من التمايز (الأديم الباطن؛ السلف البنكرياس؛ جزيرة ناضجة) كانت ثابتة في الخلايا الفورمالديهايد 4٪ لمدة 15 دقيقة في درجة حرارة الغرفة.
  2. وpermeabilized الخلايا الثابتة باستخدام 0.25٪ تريتون X-100 (تكساس) لمدة 15 دقيقة.
  3. تم حجب غير محددة من قبل تلطيخ حضانة في مصل الدم حمار 10٪ في تكساس 0.05٪ لمدة 30 دقيقة.
  4. تم تنفيذ الابتدائية حضانة الجسم المضاد بين عشية وضحاها في 4 درجات مئوية في منع عازلة في تخفيف الجسم المضاد الموصى بها (انظر الجدول 1).
  5. تم غسلها الخلايا مع 0.05٪ ثلاث مرات تكساس لمدة 5 دقائق.
  6. تم إجراء الثانوية حضانة الجسم المضاد لمدة ساعة في درجة حرارة الغرفة في الظلام مع الأجسام المضادة المناسبة المخفف في عرقلة العازلة.
  7. تم غسلها الخلايا مع 0.05٪ ثلاث مرات تكساس لمدة 5 دقائق.
  8. تم تنفيذ تلطيخ النووية حضانة مع Hoescht صمة عار في تخفيف 1:1000 في برنامج تلفزيونيلمدة 5 دقائق ثم يغسل بنسبة 3 مع برنامج تلفزيوني.
  9. تم تصوير الخلايا الثابتة والملون باستخدام أوليمبوس IX81 مجهر مقلوب وMetamorph برامج التصوير.

7. ممثل النتائج

بالإضافة إلى ذلك من Activin ألف وWortmannin إلى hESC غير متمايزة لمدة 4 أيام يدفع الأديم الباطن نهائي كما أكده qRT-PCR تحليل لعلامات DE Sox17، Cxcr4، وFoxa2 والمناعية لSox17 كما هو موضح في الشكل رقم 2. وتم تأكيد التمايز إلى خلايا البنكرياس السلف بعد إضافة حمض الريتينويك وسايكلوبامين بواسطة qRT-PCR من علامات سلف البنكرياس والمناعية لPdx1 كما هو موضح في الشكل (3).

في المرحلة النهائية من التمايز، اتصال يشترك في الثقافة مع الخلايا التي يسببها RHMVEC بقوة upregulation من التعبير الانسولين في hESC المستمدة الخلايا الاولية البنكرياس. وقد تم تحليل كفاءة التمايز بوساطة شارك في الثقافة عن طريق التعاونmparing مع شرط للسيطرة على استخدام DAPT. وقد استخدم DAPT كعنصر تحكم إيجابية لأنها تعد حاليا واحدة من أكثر الوسائل المستخدمة على نطاق واسع لتحقيق النضج البنكرياس. منذ تم تنفيذ التعاون ثقافة في وسائل الاعلام تعديل تكملها عوامل داعمة من الخلايا البطانية، تم إجراء مراقبة إضافية مع وسائل الإعلام في غياب الخلايا البطانية للتحقق من تأثير وسائل الإعلام على التفرقة. وترد تفاصيل هذا التحليل في الشكل 4.

الشكل 1.
الشكل 1. متعددة المراحل بروتوكول للتمايز hESC إلى خلايا الانسولين التعبير.

الشكل 2.
الشكل 2. النهائي الاستقراء الأديم الباطن من الخلايا الجذعية الجنينية البشرية. A) qRT-PCR تحليل علامات DE ممثل في الخلايا hESC تتعرض لActivin ألف وWortmannin لمدة 4 أيام. نتائج ع ه تطبيع فيما يتعلق hESC غير متمايزة. B) Sox17 تلطيخ (الأخضر) ودابي (الأزرق) إظهار التعبير النووية من Sox17. مقياس شريط: 50 ميكرون.

الشكل 3.
الرقم سلف البنكرياس 3. الحث على الخلايا الجذعية الجنينية الخلايا المشتقة الأديم الباطن. A) qRT-PCR تحليل علامات مبكرة في خلايا البنكرياس hESC الأديم الباطن المشتقة عرضة للحمض الريتينويك سايكلوبامين و لمدة 4 أيام بعد الاستقراء DE. النتائج طبيعية فيما يتعلق hESC غير متمايزة. B) Pdx1 تلطيخ (البنفسجي) ودابي (الأزرق) إظهار التعبير النووية من Pdx1. مقياس شريط: 50 ميكرون.

">

الشكل 4.
الشكل 4. البنكرياس مرحلة نضوج A) qRT-PCR تحليل هرمونات البنكرياس في hESC بعد نضوج البنكرياس باستخدام DAPT، اتصل وسائل الإعلام المشاركة في ثقافة أو زملاء الثقافة (السيطرة). النتائج طبيعية فيما يتعلق hESC غير متمايزة. ف القيم المتحصل عليها من قبل الطالب اختبار t. ب) المشاركة في الثقافة مع ديل-AC-LDL RHMVEC المسمى (الأحمر) تبين المناطق التي ECS نعلق على لوحة إذا كان هناك مساحات فارغة (أعلى)، يمكن العثور على RHMVEC الأخرى في اتصال مباشر مع ESC التفريق (القاع). C) C-الببتيد (الأخضر) تلطيخ للخلايا متباينة باستخدام أسلوب المشاركة في ثقافة. شريط الحجم: 12.5 ميكرون (الأعلى) و 50 ميكرون (القاع) D) المناعية من RHMVEC لا يدل على التعبير الانسولين في RHMVEC.

علامة Primer1 (5 'إلى 3') </ TD> Primer2 (5 'إلى 3') المرجع
SOX17 CTCTGCCTCCTCCACGAA CAGAATCCAGACCTGCACAA 12
CXCR4 CACCGCATCTGGAGAACCA GCCCATTTCCTCGGTGTAGTT 4
FOXA2 GGAGCGGTGAAGATGGAA TACGTGTTCATGCCGTTCAT 12
PDX1 AAGTCTACCAAAGCTCACGCG GTAGGCGCCGCCTGC 4
PTF1 CATAGAGAACGAAACCACCCTTTGAG GCACGGAGTTTCCTGGACAGAGTTC 12
HLXB9 CACCGCGGGCATGATC ACTTCCCCAGGAGGTTCGA 4
HNF6 TGTGGAAGTGGCTGCAGGA TGTGAAGACCAACCTGGGCT 5
PAX6 CGAATTCTGCAGGTGTCCAA ACAGACCCCCTCGGACAGTAAT 5
NKX6.1 AGACCCACTTTTTCCGGACA CCAACGAATAGGCCAAACGA 5
ISL1 GATCTATGTCACCTCGCAAGG TACAACCACCATTTCACTG 12
الجلوكاجون AGGCAGACCCACTCAGTGA AACAATGGCGACCTCTTCTG 4
الأنسولين AAGAGGCCATCAAGCAGATCA CAGGAGGCGCATCCACA 12

الجدول رقم 1. مبادىء القراءة المستخدمة في تفاعلات qPCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

خلال تطوير البنكرياس، وخلايا البنكرياس التفريق على مقربة مع الخلايا البطانية من الشريان الأورطي، وعلاوة على ذلك، البنكرياس الجزر هي أوعية دموية كثيفة لتعزيز التبادل السريع للالسكر في الدم والهرمونات جزيرة. نظرا لهذه الحقائق، فإنه ليس من المستغرب أن الخلايا البطانية تلعب دورا هاما في عملية توالد الأعضاء البنكرياس. في حين يتزايد أهمية الخلايا البطانية خلال تطوير البنكرياس يجري تقديره، وأقل التحقيق في دوره في تمايز في المختبر من خلايا جنينية. في تقريرنا السابق أنشأنا الدور الإيجابي للنضوج الخلايا البطانية في البنكرياس من الخلايا الجذعية الجنينية 13. في الدراسة الحالية نحن دراسة تأثير إشارات الخلية البطانية على تمييز الخلايا الجذعية الجنينية البشرية.

أدى كل من التي كانت تستخدم الخلايا البطانية متعددة في هذا البروتوكول، في مماثلة althou التأثير الكليغ مع وجود اختلافات في الكفاءة من التمايز. في هذا التقرير نقدم تأثير شارك في زراعة الخلايا المشتقة hESC سلف البنكرياس مع خلايا الفئران الاوعية الدموية الدقيقة في القلب البطانية (RHMVEC). يمكن أن الخلايا البطانية تصور ملائم بواسطة AC-LDL تلطيخ، والتي تقتصر على الخلايا البطانية فقط. وأظهرت المشاركة في ثقافة التفريق المجالس الاقتصادية والاجتماعية مع ما قبل الخلايا البطانية التي الملون في حين أن معظم الخلايا البطانية وكانت قابلة للحياة في ثقافة لفترة ممتدة من الزمن، وRHMEV تختفي تدريجيا بعد 4 أيام و لم يعد من الممكن الكشف عنها بعد 6 أيام من النضج. غياب RHMVEC يبسط تحليل من خلال القضاء على الحاجة إلى الفرز، وبالتالي تم اختياره لتعظيم الاستفادة من بروتوكول التعاون ثقافة.

في حين أن هذه الدراسة تشير بوضوح إلى الأثر الإيجابي من الخلايا البطانية في البنكرياس الذي يحفز نضوج، والآلية الدقيقة لهذا الاستقراء لا يزال مجهولا ويجري التحقيق حاليا في مختبر لدينا. لا الحصريمكن أن يكون مقبولا آليات ث (ط) من تأثير جزيئات الخلية يفرز (II) بوساطة الخلايا البطانية تثبيط إشارات من الدرجة (ج) دور المصفوفة خارج الخلية التي يفرزها الخلايا البطانية. في حين أن الفئة الأولى لا يحتاج إلى خلية خلية الاتصال، ومثل هذا الاتصال هو إلزامي بالنسبة للفئة الثانية والثالثة. يقوم بالتالي لدينا بعض التحليلات الأولية باستخدام مختلف شارك في ثقافة تكوينات: (ط) اتصال يشترك في ثقافة (II) transwell شارك في الثقافة و(الثالث) ثقافة الإعلام مكيفة. لوحظ أن اتصال يشترك في ثقافة نتج عنها التمايز أقصى، كما ترى التعبير الانسولين، تليها transwell شارك في الثقافة، في حين أن وسائل الإعلام مكيفة ثقافة أسفر عن تأثير ضئيل على التعبير الانسولين (لا تظهر البيانات). هذه التحليلات تشير إلى أنه في حين أن الخلية خلية الاتصال هو المهم، قد يكون هناك بعض فترة قصيرة جزيئات يفرزها والتي تعتبر مهمة كذلك.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

ليس لدينا ما يكشف.

Acknowledgements

نحن نعترف بدعم من المعاهد الوطنية للصحة جائزة مبتكر جديد DP2 116520 وORAU رالف كلية جديد بوي جائزة تحسين.

Materials

Name Company Catalog Number Comments
mTeSR1 (with supplement) Stem Cell Technologies 5850
hESC qualified matrigel BD Biosciences 354277
DMEM:F12 Invitrogen 11330-032
MCDB-131 Invitrogen 10372019
MCDB-131 (Complete) VEC Technologies MCDB-131
B27 Supplement Invitrogen 17504044
Activin A R&D Systems 338-AC 100ng/ml
Wortmannin Invitrogen W3144 1μM
KAAD-Cyclopamie Sigma-Aldrich C4116 0.2μM
All-Trans Retinoic Acid Sigma-Aldrich R2625 2μM
DAPT Sigma-Aldrich D5942 30μM
Nicotinamide Sigma-Aldrich N0636 10 mM
Sodium Selenite Sigma-Aldrich S5261 30 nM
Insulin Sigma-Aldrich I1882 25 μg/ml
Transferrin Sigma-Aldrich T8158 50 μg/ml
EGF R&D Systems 236-EG 10ng/ml
EndoGro VEC Technologies ENDOGRO 10mg
Heparin Sigma-Aldrich H3149 90μg/ml
Hydrocortisone Sigma-Aldrich H0888 1μg/ml
NucleoSpin RNA II Macherey-Nagel 740955
ImProm II reverse transcription System Promega Corp. A3800
Brilliant II SYBR Green QPCR master mix Stratagene, Agilent Technologies 600548
Sox17 goat polyclonal IgG Santa Cruz Biotechnology, Inc. sc-17355 1/500
PDX1 goat polyclonal IgG Santa Cruz Biotechnology, Inc. sc-14662 1/500
C-Peptide Rabbit polyclonal Cell Signaling Technology 4593 1/500
Alexa Fluor 488 donkey anti-rabbit IgG Invitrogen A-21206 1/1000
Alexa Fluor 647 donkey anti-goat IgG Invitrogen A-21447 1/1000
Table 2. Reagents and Kits

DOWNLOAD MATERIALS LIST

References

  1. De Vos, J., Assou, S., Tondeur, S., Dijon, M., Hamamah, S. Les cellules souches embryonnaires humaines : de la transgression de l'embryon humain á la médecine régénératrice de demain. Gynécologie Obstétrique & Fertilité. 37, 620-626 (2009).
  2. Murtaugh, L. C., Melton, D. A. Genes, Signals, and Lineages in Pancreas Development. Annual Review of Cell and Developmental Biology. 19, 71-89 (2003).
  3. Kubo, A., Shinozaki, K., Shannon, J. M., Kouskoff, V., Kennedy, M., Woo, S., Fehling, H. J., Keller, G. Development of definitive endoderm from embryonic stem cells in culture. Development. 131, 1651-1662 (2004).
  4. D'Amour, K. A., Bang, A. G., Eliazer, S., Kelly, O. G., Agulnick, A. D., Smart, N. G., Moorman, M. A., Kroon, E., Carpenter, M. K., Baetge, E. E. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat. Biotech. 24, 1392-1401 (2006).
  5. Zhang, D., Jiang, W., Liu, M., Sui, X., Yin, X., Chen, S., Shi, Y., Deng, H. Highly efficient differentiation of human ES cells and iPS cells into mature pancreatic insulin-producing cells. Cell Res. 19, 429-438 (2009).
  6. Basma, H., Soto-Gutiérrez, A., Yannam, G. R., Liu, L., Ito, R., Yamamoto, T., Ellis, E., Carson, S. D., Sato, S., Chen, Y., Muirhead, D. Differentiation and Transplantation of Human Embryonic Stem Cell-Derived Hepatocytes. Gastroenterology. 136, 990-999 (2009).
  7. Phillips, B. W., Hentze, H., Rust, W. L., Chen, Q. -P., Chipperfield, H., Tan, E. -K., Abraham, S., Sadasivam, A., Soong, P. L., Wang, S. T., Lim, R., Sun, W., Colman, A., Dunn, N. R. Directed Differentiation of Human Embryonic Stem Cells into the Pancreatic Endocrine Lineage. Stem Cells and Development. 16, 561-578 (2007).
  8. Kim, S. K., Melton, D. A. Pancreas development is promoted by cyclopamine, a Hedgehog signaling inhibitor. Proceedings of the National Academy of Sciences. 95, 13036-13041 (1998).
  9. Docherty, K. Growth and development of the islets of Langerhans: implications for the treatment of diabetes mellitus. Current Opinion in Pharmacology. 1, 641-649 (2001).
  10. Nikolova, G., Jabs, N., Konstantinova, I., Domogatskaya, A., Tryggvason, K., Sorokin, L., Fässler, R., Gu, G., Gerber, H. -P., Ferrara, N., Melton, D. A. The Vascular Basement Membrane: A Niche for Insulin Gene Expression and [beta]> Cell Proliferation. Developmental Cell. 10, 397-405 (2006).
  11. Yoshitomi, H., Zaret, K. S. Endothelial cell interactions initiate dorsal pancreas development by selectively inducing the transcription factor Ptf1a. Development. 131, 807-817 (2004).
  12. Osafune, K., Caron, L., Borowiak, M., Martinez, R. J., Fitz-Gerald, C. S., Sato, Y., Cowan, C. A., Chien, K. R., Melton, D. A. Marked differences in differentiation propensity among human embryonic stem cell lines. Nat. Biotech. 26, 313-315 (2008).
  13. Banerjee, I., Sharma, N., Yarmush, M. Impact of co-culture on pancreatic differentiation of embryonic stem cells. J. Tissue Eng. Regen. Med. 5, 313-323 (2010).

Comments

2 Comments

  1. good

    Reply
    Posted by: Zhongchun S.
    July 20, 2012 - 2:15 AM
  2. Dear Maria Jaramillo

    I am a student of the licencientura in biotechnology in the Universidad Argentina de la Empresa.
    I am currently studying the cell cultures, researching on the internet I find interesting the abstract, I would like to know if it is possible for me to send the paper by email please.
    thanks and greetings


    Ana Clara López Novo
    Matter cell cultures
    Department of biotechnology and food technology
    Faculty of engineering and Sciences
    Universidad Argentina de la Empresa
    Lima 717 (C1073AAO)
    Ciudad Autónoma de Buenos Aires
    Email: anaclaralopeznovo@gmail.com

    Reply
    Posted by: Ana L.
    May 6, 2013 - 10:24 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics