Эндотелиальных клеток со-культуры посредником Созревание эмбриональных стволовых клеток человека в поджелудочной железы инсулин продуцирующих клеток в направленной дифференцировки подход

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Данное исследование описывает направленной дифференцировки подход в стимулировании панкреатической дифференциации эмбриональных стволовых клеток человека. Большое значение имеет вывод, что эндотелиальных клеток со-культуры посредником созревания человеческих эмбриональных стволовых клеток, полученных в поджелудочной предшественников инсулина экспрессирующие клетки.

Cite this Article

Copy Citation | Download Citations

Jaramillo, M., Banerjee, I. Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach. J. Vis. Exp. (61), e3759, doi:10.3791/3759 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Protocol

1. Сотовые обслуживание

  1. H1 чЭСК (WiCell) поддерживали на чЭСК квалифицированных матригелем лунок с mTeSR1 СМИ, со средствами массовой информации меняются каждый день. Лунки покрыты разбавленного раствора матригелем, получают путем добавления 300 мкл чЭСК матригелем в 25 мл DMEM: F12. 1 мл этого раствора матригелем был добавлен в каждую лунку с шестью лунками, или 400 мкл в каждую лунку добавляют по 12-луночного планшета и позволили, чтобы покрыть в течение 1 часа при комнатной температуре. Клетки механически пассировать на раскол соотношении 1:4, очищая колонии, как только они достигнут между 1 и 1,5 мм в диаметре.
  2. RHMVEC (VEC технологий) была сохранена в MCDB-131 средства массовой информации со средствами массовой информации меняются каждый день. Клетки были разделены на трипсинизации раз 80% слиянии было достигнуто на раскол соотношении 1:3. Эндотелиальных клеток между проходы 3 и 7 были использованы для настоящего исследования.

2. Подготовка растворы

  1. Активин была преобразована в 50 мкг / мл в стерильные PBS, содержащего 0,1% бычьего сывороточного альбумина. Решение было аликвоты и хранили при -20 ° C.
  2. ЭФР был преобразован в 500 мкг / мл в стерильные 10 мМ уксусной кислоты. Решение было аликвоты и хранили при -20 ° C.
  3. Инсулин был преобразован в 10 мг / мл, добавив подкисляют H 2 O (рН ≤ 2), подготовленный при добавлении 0,1 мл ледяной уксусной кислоты в 10 мл воды.
  4. DAPT был преобразован в ДМСО при 18 мг / мл. Кроме того, было разбавляют до концентрации 300 мкМ в DMEM: F12, аликвоты и хранили при -20 ° C.
  5. KAAD-Cyclopamine был преобразован в ДМСО при 5mg/ml. Кроме того, было разбавляют до концентрации 2 мкМ в DMEM: F12, аликвоты и хранили при -20 ° C.
  6. All-транс-ретиноевой кислоты была воссоздана на 2,7 мг / мл 95% этанола. Кроме того, было разбавляют до 2 мМ концентрации в DMEM: F12, аликвоты и хранили при -80 ° C.

3. Окончательное энтодермы (DE) и поджелудочной железы предшественников (ПП) Индукционные

  1. После чESC колонии достигнута между 1 и 1,5 мм в диаметре, DE индукция проводилась путем добавления DMEM: F12 дополнены B27, 0,2% BSA, 100 нг / мл Активин и 1 мкМ вортманнин в течение 4 дней (день 0-4-й день), со средствами массовой информации меняются каждый день.
  2. После DE индукции была завершена, индукция поджелудочной предшественников было вызвано изменением СМИ DMEM: F12 дополнены B27, 0,2% BSA и KAAD-Cyclopamine в концентрации 0,2 мкМ в течение 24 часов (день 4-5-й день).
  3. Через 24 часа СМИ было изменено на DMEM: F12 дополнены B27, 0,2% BSA, KAAD-Cyclopamine 0,2 мкм концентрация и полностью транс-ретиноевой кислоты при концентрации 2 мкМ в течение 3 дней со средствами массовой информации меняются каждый день (День 5-8-й день) .

4. Созревание поджелудочной железы

  1. После индукции PP, все группы было изменено на созревание средства массовой информации состоит из DMEM: F12 дополнены B27, 0,2% BSA, 10 мМ никотинамид, 25 мкг / мл инсулина, 30 нМ Na 2 SeO 3 и 50 мкг / мл трансферрина на 2 гн я со средствами массовой информации меняются каждый день (День 8-10 день).
  2. Через 2 дня в созревании СМИ, заключительный этап созревания осуществляется параллельно, используя несколько различных условиях для сравнения. Дифференциация вызывали на следующих условиях: (i) с помощью надреза ингибитор DAPT (II) с использованием со-культуру средств массовой информации только без эндотелиальных клеток, как контроль и (III) с помощью контакта со-культуры RHMVEC клеток. Клетки были сохранены в DAPT или со-культуральной среды в течение недели (10 день-17 день) в средствах массовой информации меняются каждый день.
    1. DAPT средств массовой информации была подготовлена ​​дополняющий созревания СМИ с 30 DAPT мкМ. Клетки этой группы были впервые подвергается завершить MCDB131 в течение 24 часов, а затем подвергается DAPT средств массовой информации в течение 6 дней (день 11 день 17).
    2. Со-культуры средств массовой информации была подготовлена ​​путем дополнения MCDB-131 средств массовой информации с B27, 0,2% BSA, 10 мМ никотинамид, 10 нг / мл ЭФР, 1 мкг / мл гидрокортизона, 10 мг EndoGro, 90 мкг / мл гепарина. Для контроля состояния среды дифференциации клетки подвергались воздействиюв MCDB-131 полной среде в течение 24 часов (день 10-11-й день), после чего средства массовой информации было изменено на совместное питательных сред в течение 6 дней (день 11-День 17) (без эндотелиальных клеток).
    3. Для контакта со-культура состояние, один миллион RHMVEC был добавлен в дифференциации клеток в полной MCDB-131 средства массовой информации (VEC технологий) в течение 24 часов (10 день-11 день), чтобы можно было смонтировать. Через 24 часа СМИ было изменено на совместное питательных сред в течение 6 дней (день 11-День 17) со средствами массовой информации меняются каждый день.

5. QRT-PCR анализа

  1. В конце каждого этапа дифференциации (энтодермы, поджелудочной железы предшественников, зрелый островок) лизировали и РНК извлекали с помощью NucleoSpin РНК II добычи комплект в соответствии с инструкциями производителя.
  2. РНК анализом качества, проверяя РНК поглощению при 260 нм и 280 нм, а затем РНК количественного использования SmartSpec Plus спектрофотометр.
  3. Обратной транскрипции проводили с использованием ImProm II обратной транскрипции кего в соответствии с инструкциями производителя. Все реакции проводились с 100 нг РНК.
  4. QRT-PCR проводили с использованием Mx3005P КПЦР системы (Agilent) и Блестящие II SYBR Green КПЦР мастер смеси в соответствии с инструкциями производителя. Праймеров приведены в таблице 1. Инициализации шаг был выполнен на 50 ° С в течение 2 минут, затем 95 ° С в течение 10 минут. 50 циклов амплификации осуществляется следующим образом: 95 ° C в течение 30 секунд, 54 ° C в течение 30 секунд и 72 ° С в течение 1 минуты.
  5. Повязку меняют целевой экспрессию мРНК на недифференцированные клетки была рассчитана из значений КТ, используя следующие формулы:
    ΔCT (Маркер я) = CT (Маркер я) - КТ (GAPDH)
    Δ ΔCT (Маркер я) = ΔCT (Маркер я) (образец) - ΔCT (Маркер я) (Недифференцированная клетки)
    Относительное выражение (маркер я) = 2-ΔΔCT(Маркер я)

6. Иммуноцитохимическая

  1. В конце каждого этапа дифференциации (энтодермы, поджелудочной железы предшественников, зрелый островок) клетки фиксировали в 4% формальдегида в течение 15 минут при комнатной температуре.
  2. Фиксированные клетки проницаемыми использованием 0,25% Тритон Х-100 (TX) в течение 15 минут.
  3. Неспецифические окрашивания был заблокирован инкубации в 10% осел в сыворотке 0,05% ТХ на 30 минут.
  4. Первичная инкубации антител проводили ночи при 4 ° C в блокирующем буфере в рекомендованных разведение антител (см. таблицу 1).
  5. Клетки промывали 0,05% TX три раза в течение 5 минут.
  6. Вторичный инкубации антител проводили в течение одного часа при комнатной температуре в темноте с соответствующими антителами разводят в блокирующем буфере.
  7. Клетки промывали 0,05% TX три раза в течение 5 минут.
  8. Ядерная окрашивание проводили путем инкубации с Hoescht пятно на разведении 1:1000 в PBSв течение 5 минут, затем 3 промывок PBS.
  9. Фиксированные и окрашенные клетки были обследованы использовании Olympus IX81 инвертированного микроскопа и Метаморф обработки изображений.

7. Представитель Результаты

Добавление Активин и вортманнин в недифференцированное чЭСК в течение 4 дней вызывает окончательное энтодермы, что подтверждается QRT-PCR анализ на маркеры DE Sox17, CXCR4 и Foxa2 и иммунной для Sox17, как показано на рисунке 2. Дифференциация клеток поджелудочной железы к предшественников после добавления cyclopamine и ретиноевая кислота была подтверждена QRT-PCR поджелудочной железы прародитель маркеров и иммуногистохимическое Pdx1, как показано на рисунке 3.

На заключительной стадии дифференциации, свяжитесь со-культуры RHMVEC клетки сильно индуцированного регуляция инсулина выражение в чЭСК полученных клеток поджелудочной железы предшественников. Эффективность совместной культуре опосредованной дифференциации был проанализирован сотрудничестваmparing с контролем состояния с помощью DAPT. DAPT был использован в качестве положительного контроля, поскольку он является одним из наиболее широко используемых методов для достижения поджелудочной созревания. Поскольку со-культуры была проведена в модифицированной среде с добавлением факторов, поддерживающих эндотелиальных клеток, дополнительный контроль осуществляется со средствами массовой информации в отсутствии эндотелиальных клеток проверить влияние средств массовой информации на дифференциацию. Подробности этого анализа представлены на рисунке 4.

Рисунок 1.
Рисунок 1. Многоступенчатая протокол для дифференциации чЭСК в инсулин клеток, экспрессирующих.

Рисунок 2.
Рисунок 2. Окончательное индукции энтодермы из человеческих эмбриональных стволовых клеток. А) QRT-PCR анализ представитель маркеров ДЭ чЭСК клетки подвергаются активин и вортманнин в течение 4 дней. Результаты ар электронной нормированы по отношению к недифференцированной чЭСК. B) Sox17 окрашивания (зеленый) и DAPI (синий), показывают, ядерная выражение Sox17. Шкала бар: 50 мкм.

Рисунок 3.
Рисунок 3. Поджелудочной предшественников индукции эмбриональных стволовых клеток, полученных энтодермы клетками. А) QRT-PCR анализ ранних маркеров поджелудочной железы в чЭСК полученных энтодермы клетки подвергаются cyclopamine и ретиноевой кислоты в течение 4 дней после индукции DE. Результаты нормированный по отношению к недифференцированной чЭСК. B) Pdx1 окрашивания (фиолетовый) и DAPI (синий), показывают, ядерная выражение Pdx1. Шкала бар: 50 мкм.

">

Рисунок 4.
Рисунок 4. Стадия созревания поджелудочной железы) QRT-PCR анализ гормонов поджелудочной железы чЭСК после созревания поджелудочной использованием DAPT, свяжитесь со-культуры или совместное культуры средств массовой информации (контроль). Результаты нормированный по отношению к недифференцированной чЭСК. р значений, полученных студентом т-тест. В) Со-культуры Дил-Ac-ЛПНП помечены RHMVEC (красный), показывают, регионы, где КЭ приложить к пластинке, если есть пустые пространства (сверху), других RHMVEC можно найти в непосредственном контакте с дифференциации ESC (внизу). C) С-пептид (зеленый) для окрашивания клеток дифференцирована использованием со-культуры методом. Шкала бар: 12,5 мкм (вверху) и 50 мкм (нижний) D) окрашивания в RHMVEC демонстрирует не инсулин выражение в RHMVEC.

Маркер Primer1 (5 'к 3') </ TD> Primer2 (5 'к 3') Ссылка
SOX17 CTCTGCCTCCTCCACGAA CAGAATCCAGACCTGCACAA 12
CXCR4 CACCGCATCTGGAGAACCA GCCCATTTCCTCGGTGTAGTT 4
FOXA2 GGAGCGGTGAAGATGGAA TACGTGTTCATGCCGTTCAT 12
PDX1 AAGTCTACCAAAGCTCACGCG GTAGGCGCCGCCTGC 4
PTF1 CATAGAGAACGAAACCACCCTTTGAG GCACGGAGTTTCCTGGACAGAGTTC 12
HLXB9 CACCGCGGGCATGATC ACTTCCCCAGGAGGTTCGA 4
HNF6 TGTGGAAGTGGCTGCAGGA TGTGAAGACCAACCTGGGCT 5
PAX6 CGAATTCTGCAGGTGTCCAA ACAGACCCCCTCGGACAGTAAT 5
NKX6.1 AGACCCACTTTTTCCGGACA CCAACGAATAGGCCAAACGA 5
ISL1 GATCTATGTCACCTCGCAAGG TACAACCACCATTTCACTG 12
Глюкагон AGGCAGACCCACTCAGTGA AACAATGGCGACCTCTTCTG 4
Инсулина AAGAGGCCATCAAGCAGATCA CAGGAGGCGCATCCACA 12

Таблица 1. Грунтовки для КПЦР реакций.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

В поджелудочной развития, дифференциации клеток поджелудочной железы находятся в непосредственной близости с эндотелиальных клеток от аорты, кроме того, панкреатических островков густо васкуляризированной для содействия быстрому обмену глюкозы в крови и островок гормонов. Учитывая эти факты, это не удивительно, что эндотелиальные клетки играют важную роль в процессе органогенеза поджелудочной железы. В то время как значение эндотелиальных клеток поджелудочной железы при развитии все более и более высокую оценку, ее роль в в пробирке дифференциацию эмбриональных клеток в меньшей степени исследован. В нашем предыдущем докладе мы установили положительную роль эндотелиальных клеток в поджелудочной созревания мышиных эмбриональных стволовых клеток 13. В настоящем исследовании мы исследуем влияние эндотелиальной сигнальной ячейки дифференциации эмбриональных стволовых клеток человека.

Несколько эндотелиальные клетки, используемые в настоящем протоколе, которые привели к аналогичным общий эффект althouGH с изменением эффективности дифференциации. В настоящем докладе мы представляем влияние совместного культивирования чЭСК производных панкреатических клеток-предшественников в сердце крысы микрососудистых эндотелиальных клеток (RHMVEC). Эндотелиальных клеток может быть удобно визуализировать AC-ЛПНП окрашивание, которое является специфическим только эндотелиальных клеток. Со-культуры дифференциации стволовых клеток с предварительно окрашенных эндотелиальных клеток показал, что в то время как большинство из эндотелиальных клеток были жизнеспособны в культуре в течение длительного периода времени, RHMEV постепенно исчезают через 4 дня и больше не могли быть обнаружены через 6 дней созревания. Отсутствие RHMVEC упрощает анализ за счет устранения необходимости для сортировки, поэтому была выбрана для оптимизации совместной культуре протокола.

Хотя настоящее исследование ясно показывает, положительный эффект от эндотелиальных клеток вызывающих созревание поджелудочной железы, точный механизм такого индукции до сих пор неизвестно и время в настоящее время исследованы в нашей лаборатории. Feш вероятных механизмах может быть (я) эффект клеточной выделяются молекулы (II), эндотелиальные клетки опосредованное торможение в выемка сигнализации (III), роль внеклеточного матрикса выделяемый клетками эндотелия. В то время как первая категория не требует межклеточных контактов, такой контакт является обязательным для второй и третьей категории. Поэтому мы провели некоторый предварительный анализ с использованием различных со-культуры конфигурациях: (I), контакт со-культуры (II) Transwell совместной культурой и (III) условно культуру средств массовой информации. Было отмечено, что контакт со-культуры привели к максимальной дифференциации, судя по выражению инсулина, следует Transwell совместно культуры, в то время как условная культуральной среде в результате минимальное влияние на инсулин выражении (данные не представлены). Эти исследования показывают, что в то время как межклеточных контактов важно, там могут быть некоторые короткоживущие выделяются молекулы, которые также важны.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Нам нечего раскрывать.

Acknowledgements

Мы признаем, поддержка NIH Новый Новатор премии DP2 116520 и ORAU Ральф Поу младший факультета повышения Award.

Materials

Name Company Catalog Number Comments
mTeSR1 (with supplement) Stem Cell Technologies 5850
hESC qualified matrigel BD Biosciences 354277
DMEM:F12 Invitrogen 11330-032
MCDB-131 Invitrogen 10372019
MCDB-131 (Complete) VEC Technologies MCDB-131
B27 Supplement Invitrogen 17504044
Activin A R&D Systems 338-AC 100ng/ml
Wortmannin Invitrogen W3144 1μM
KAAD-Cyclopamie Sigma-Aldrich C4116 0.2μM
All-Trans Retinoic Acid Sigma-Aldrich R2625 2μM
DAPT Sigma-Aldrich D5942 30μM
Nicotinamide Sigma-Aldrich N0636 10 mM
Sodium Selenite Sigma-Aldrich S5261 30 nM
Insulin Sigma-Aldrich I1882 25 μg/ml
Transferrin Sigma-Aldrich T8158 50 μg/ml
EGF R&D Systems 236-EG 10ng/ml
EndoGro VEC Technologies ENDOGRO 10mg
Heparin Sigma-Aldrich H3149 90μg/ml
Hydrocortisone Sigma-Aldrich H0888 1μg/ml
NucleoSpin RNA II Macherey-Nagel 740955
ImProm II reverse transcription System Promega Corp. A3800
Brilliant II SYBR Green QPCR master mix Stratagene, Agilent Technologies 600548
Sox17 goat polyclonal IgG Santa Cruz Biotechnology, Inc. sc-17355 1/500
PDX1 goat polyclonal IgG Santa Cruz Biotechnology, Inc. sc-14662 1/500
C-Peptide Rabbit polyclonal Cell Signaling Technology 4593 1/500
Alexa Fluor 488 donkey anti-rabbit IgG Invitrogen A-21206 1/1000
Alexa Fluor 647 donkey anti-goat IgG Invitrogen A-21447 1/1000
Table 2. Reagents and Kits

DOWNLOAD MATERIALS LIST

References

  1. De Vos, J., Assou, S., Tondeur, S., Dijon, M., Hamamah, S. Les cellules souches embryonnaires humaines : de la transgression de l'embryon humain á la médecine régénératrice de demain. Gynécologie Obstétrique & Fertilité. 37, 620-626 (2009).
  2. Murtaugh, L. C., Melton, D. A. Genes, Signals, and Lineages in Pancreas Development. Annual Review of Cell and Developmental Biology. 19, 71-89 (2003).
  3. Kubo, A., Shinozaki, K., Shannon, J. M., Kouskoff, V., Kennedy, M., Woo, S., Fehling, H. J., Keller, G. Development of definitive endoderm from embryonic stem cells in culture. Development. 131, 1651-1662 (2004).
  4. D'Amour, K. A., Bang, A. G., Eliazer, S., Kelly, O. G., Agulnick, A. D., Smart, N. G., Moorman, M. A., Kroon, E., Carpenter, M. K., Baetge, E. E. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat. Biotech. 24, 1392-1401 (2006).
  5. Zhang, D., Jiang, W., Liu, M., Sui, X., Yin, X., Chen, S., Shi, Y., Deng, H. Highly efficient differentiation of human ES cells and iPS cells into mature pancreatic insulin-producing cells. Cell Res. 19, 429-438 (2009).
  6. Basma, H., Soto-Gutiérrez, A., Yannam, G. R., Liu, L., Ito, R., Yamamoto, T., Ellis, E., Carson, S. D., Sato, S., Chen, Y., Muirhead, D. Differentiation and Transplantation of Human Embryonic Stem Cell-Derived Hepatocytes. Gastroenterology. 136, 990-999 (2009).
  7. Phillips, B. W., Hentze, H., Rust, W. L., Chen, Q. -P., Chipperfield, H., Tan, E. -K., Abraham, S., Sadasivam, A., Soong, P. L., Wang, S. T., Lim, R., Sun, W., Colman, A., Dunn, N. R. Directed Differentiation of Human Embryonic Stem Cells into the Pancreatic Endocrine Lineage. Stem Cells and Development. 16, 561-578 (2007).
  8. Kim, S. K., Melton, D. A. Pancreas development is promoted by cyclopamine, a Hedgehog signaling inhibitor. Proceedings of the National Academy of Sciences. 95, 13036-13041 (1998).
  9. Docherty, K. Growth and development of the islets of Langerhans: implications for the treatment of diabetes mellitus. Current Opinion in Pharmacology. 1, 641-649 (2001).
  10. Nikolova, G., Jabs, N., Konstantinova, I., Domogatskaya, A., Tryggvason, K., Sorokin, L., Fässler, R., Gu, G., Gerber, H. -P., Ferrara, N., Melton, D. A. The Vascular Basement Membrane: A Niche for Insulin Gene Expression and [beta]> Cell Proliferation. Developmental Cell. 10, 397-405 (2006).
  11. Yoshitomi, H., Zaret, K. S. Endothelial cell interactions initiate dorsal pancreas development by selectively inducing the transcription factor Ptf1a. Development. 131, 807-817 (2004).
  12. Osafune, K., Caron, L., Borowiak, M., Martinez, R. J., Fitz-Gerald, C. S., Sato, Y., Cowan, C. A., Chien, K. R., Melton, D. A. Marked differences in differentiation propensity among human embryonic stem cell lines. Nat. Biotech. 26, 313-315 (2008).
  13. Banerjee, I., Sharma, N., Yarmush, M. Impact of co-culture on pancreatic differentiation of embryonic stem cells. J. Tissue Eng. Regen. Med. 5, 313-323 (2010).

Comments

2 Comments

  1. good

    Reply
    Posted by: Zhongchun S.
    July 20, 2012 - 2:15 AM
  2. Dear Maria Jaramillo

    I am a student of the licencientura in biotechnology in the Universidad Argentina de la Empresa.
    I am currently studying the cell cultures, researching on the internet I find interesting the abstract, I would like to know if it is possible for me to send the paper by email please.
    thanks and greetings


    Ana Clara López Novo
    Matter cell cultures
    Department of biotechnology and food technology
    Faculty of engineering and Sciences
    Universidad Argentina de la Empresa
    Lima 717 (C1073AAO)
    Ciudad Autónoma de Buenos Aires
    Email: anaclaralopeznovo@gmail.com

    Reply
    Posted by: Ana L.
    May 6, 2013 - 10:24 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics