Células endoteliais em co-cultura Maturação media de células estaminais humanas embrionárias a células pancreáticas produtoras de insulina em uma abordagem diferenciada Direção

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

O presente estudo descreve uma abordagem diferenciada dirigida em induzir a diferenciação de pâncreas de células estaminais embrionárias humanas. De grande importância é a constatação de que células endoteliais co-cultura maturação media de células-tronco embrionárias humanas derivadas progenitores pâncreas em células que expressam insulina.

Cite this Article

Copy Citation | Download Citations

Jaramillo, M., Banerjee, I. Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach. J. Vis. Exp. (61), e3759, doi:10.3791/3759 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Células-tronco embrionárias (ESC) tem duas características principais: eles podem ser propagadas in vitro indefinidamente em um estado indiferenciado e são pluripotentes, tendo assim o potencial de se diferenciar em várias linhagens. Essas propriedades fazem CES extremamente atraente para a terapia baseada em células e aplicações de tratamento regenerativo 1. No entanto, para o seu pleno potencial a ser realizado as células têm de ser diferenciada em fenótipos maduros e funcionais, o que é uma tarefa assustadora. Uma abordagem promissora na indução da diferenciação celular é a de perto imitar o caminho de organogénese na configuração in vitro. Desenvolvimento pancreática é conhecido para ocorrer em fases específicas 2, começando com endoderme, que pode desenvolver em vários órgãos, incluindo fígado e pâncreas. Indução endoderme pode ser conseguido por modulação da via nodal através da adição de Activina A 3 em combinação com vários factores de crescimento de 4-7 in vitro por adição de ciclopamina 8. Maturação pancreática é mediada por vários eventos paralelos, incluindo inibição da sinalização do entalhe; agregação de células progenitoras pancreáticas em 3-dimensionais aglomerados; indução da vascularização; para nomear alguns. De longe o mais bem sucedido na maturação in vitro de células progenitoras derivadas do CES pancreáticas foram alcançados através da inibição da sinalização Notch por DAPT suplementação 9. Embora bem sucedido, isto resulta em baixo rendimento do fenótipo maduro com funcionalidade reduzida. A área menos estudada é o efeito de células endoteliais de sinalização na maturação do pâncreas, que é cada vez mais apreciada como um fator importante que contribui para in-vivo ilhota pancreática maturação 10,11.

O presente estudo explora o efeito de endothelial célula de sinalização na maturação de células progenitoras humanas CES derivados pancreáticas produtoras de insulina em ilhota células semelhantes. Relatamos um multi-estágio protocolo diferenciação dirigida para onde os CES humanos são primeiro induzida no sentido endoderme por Activina A, juntamente com a inibição da via PI3K. Especificação do pâncreas de células endoderme é conseguido através da inibição da sinalização por Sonic hedgehog ciclopamina juntamente com a indução de retinóide por adição de ácido retinóico. A fase final de maturação é induzida pela sinalização celular endotelial conseguido através de uma configuração de co-cultura. Embora várias células endoteliais foram testados na co-cultura, aqui apresentamos os nossos dados com células de rato do coração microvasculares endoteliais (RHMVEC), principalmente para a facilidade de análise.

Protocol

1. Manutenção de células

  1. HESC H1 (WiCell) foram mantidos em células estaminais embrionárias humanas qualificados Matrigel poços revestidos com mTeSR1 mídia, com os meios de mudar a cada dia. Os poços foram revestidos por solução diluída de matrigel, preparado por adição de 300 ul de matrigel hESC em 25 ml de DMEM: F12. 1 ml desta solução matrigel foi adicionado a cada poço de uma placa de seis bem, ou 400 ul adicionados a cada poço de uma placa de 12 poços e deixou-se revestimento durante 1 hora à temperatura ambiente. As células foram passadas mecanicamente a uma razão de divisão de 1:4 por raspagem colónias uma vez que eles atingiram entre 1 e 1,5 milímetros de diâmetro.
  2. RHMVEC (VEC tecnologias) foi mantida em MCDB-131 meios de comunicação com a mídia mudar a cada dois dias. As células foram divididos por tripsinização uma vez confluência de 80% foi atingido a uma razão de divisão de 1:3. As células endoteliais entre as passagens 3 e 7 foram utilizados para este estudo.

2. Preparação das soluções de reserva

  1. Activina A foi reconstituído em 50 ug / mL em P estérilBS contendo 0,1% de albumina de soro bovino. A solução foi distribuído por alíquotas e armazenado a -20 ° C.
  2. EGF foi reconstituído em 500 ug / mL em estéril ácido acético 10 mM. A solução foi distribuído por alíquotas e armazenado a -20 ° C.
  3. A insulina foi reconstituído a 10 mg / ml pela adição de H2O acidificada (pH ≤ 2), preparado por adição de 0,1 ml de ácido acético glacial a 10 ml de água.
  4. DAPT foi reconstituído em DMSO a 18 mg / ml. Foi ainda diluída até 300 uM de concentração em DMEM: F12, aliquotas a -20 ° C.
  5. KAAD ciclopamina-foi reconstituído em DMSO a 5mg/ml. Foi ainda diluído para 2 mM de concentração em DMEM: F12, aliquotas a -20 ° C.
  6. Ácido trans-retinóico foi reconstituído em 2,7 mg / ml em etanol a 95%. Foi ainda diluído para 2 mM de concentração em DMEM: F12, aliquotas a -80 ° C.

3. Endoderma definitivo (DE) e pâncreas Progenitor de indução (PP)

  1. Uma vez que hCES colónias atingiu entre 1 e 1,5 milímetros de diâmetro, a indução DE foi realizada adicionando DMEM: F12 suplementado com B27, BSA 0,2%, 100 ng / ml Activina A e 1 wortmannin iM durante 4 dias (Dia 0 Dia-4) com meios mudam todos os dias.
  2. Após a indução DE estava completa, a indução de células progenitoras de pâncreas foi induzida pela alteração dos meios de comunicação para DMEM: F12 suplementado com B27, BSA 0,2% e KAAD-ciclopamina a 0,2 uM durante 24 horas (Dia 4 Dia-5).
  3. Após 24 horas meio foi mudado para DMEM: F12 suplementado com B27, 0,2% de BSA, KAAD-ciclopamina a 0,2 uM e ácido all-trans retinóico em 2 concentração iM durante 3 dias com os meios de mudar a cada dia (dia 5-Dia 8) .

4. Maturação de pâncreas

  1. Após a indução de PP, todos os grupos foram mudadas para meio de maturação compostos de DMEM: F12 suplementado com B27 0,2% de BSA, 10 mM de nicotinamida, 25 insulina ug / ml, 30 nM Na, 2 ug SeO 3 e 50 / transferrina ml para 2 days com a mídia mudam todos os dias (Dia 8 Dia-10).
  2. Após 2 dias em meio de maturação, o passo de maturação final é realizada em paralelo utilizando várias condições diferentes para comparação. Diferenciação foi induzida sob as seguintes condições: (i) utilizando entalhe inibidor DAPT (ii) co-cultura utilizando meios apenas, sem células endoteliais como controlo e (iii) usando contacto co-cultura com células RHMVEC. As células foram mantidas em meios DAPT ou co-cultura durante uma semana (Dia 10 Dia-17) com os meios de mudar a cada dia.
    1. Mídia DAPT foi preparado, completando os meios de maturação com 30 DAPT mM. Células nesta grupos foram primeiro expostas para completar MCDB131 durante 24 horas e em seguida exposto a meios DAPT durante 6 dias (Dia 11 Dia-17).
    2. Co-cultura meio foi preparado, completando MCDB-131 meios de comunicação com B27, 0,2% de BSA, 10 mM de nicotinamida, 10 ng / ml de EGF, 1 ug / ml de hidrocortisona, 10 mg EndoGro, 90 ug / ml de heparina. Para a mídia condição de controle de diferenciação das células foram expostaspara MCDB-131 meio completo, durante 24 horas (Dia 10 Dia-11), após o que o meio foi alterado para co-cultura media durante 6 dias (Dia 11 Dia-17) (sem células endoteliais).
    3. Para a condição de contacto co-cultura, um milhão RHMVEC foi adicionado às células de diferenciação em completos MCDB-131 meios (VEC tecnologias) durante 24 horas (Dia 10 Dia-11) para permitir a ligação. Depois de mídia 24 horas foi alterado para co-cultura de mídia para 6 dias (dia 11 Dia-17) com meios de comunicação mudam todos os dias.

5. qRT-PCR

  1. No final de cada fase de diferenciação (endoderme; progenitor pancreática; ilhota maduro) foram lisadas e RNA foi extraído usando NucleoSpin RNA extraction kit II de acordo com as instruções do fabricante.
  2. RNA foi analisada a qualidade, verificando absorvância RNA em 260 nm e 280 nm, seguido por quantificação de RNA usando uma SmartSpec Além disso espectrofotómetro.
  3. A transcrição reversa foi realizada utilizando ImProm II k transcrição reversalo de acordo com as instruções do fabricante. Todas as reacções foram realizadas com 100 ng de RNA.
  4. qRT-PCR foi realizada utilizando o sistema de Mx3005P QPCR (Agilent) e Brilliant II SYBR Green QPCR mistura principal de acordo com as instruções do fabricante. Os iniciadores utilizados estão listados na tabela 1. A etapa de inicialização foi realizada a 50 ° C durante 2 minutos, seguido por 95 ° C durante 10 minutos. 50 ciclos de amplificação foram realizadas como se segue: 95 ° C durante 30 segundos, 54 ° C durante 30 segundos e 72 ° C durante 1 minuto.
  5. Mudança de dobragem de expressão de mRNA-alvo ao longo células indiferenciadas foi calculada a partir dos valores de TC usando as seguintes fórmulas:
    ΔCT (marcador i) = CT (marcador i) - CT (GAPDH)
    Δ ΔCT (marcador i) = ΔCT (marcador i) (Amostra) - ΔCT (marcador i) (células indiferenciadas)
    A expressão relativa (Marker i) = 2-ΔΔCT(Marcador i)

6. Imunocitoquímica

  1. No final de cada fase de diferenciação (endoderme; progenitor pancreática; ilhota madura), as células foram fixadas em formaldeído a 4% durante 15 minutos à temperatura ambiente.
  2. As células fixas foram permeabilizadas usando 0,25% de Triton X-100 (TX) durante 15 minutos.
  3. Coloração não específica foi bloqueada por incubação em soro burro 10% em 0,05% TX durante 30 minutos.
  4. Incubação do anticorpo primário foi realizada durante a noite a 4 ° C em tampão de bloqueio na diluição de anticorpo recomendada (ver tabela 1).
  5. As células foram lavadas com 0,05% de TX três vezes durante 5 minutos.
  6. Incubação do anticorpo secundário foi realizada durante uma hora à temperatura ambiente no escuro com anticorpos adequados diluídas em tampão de bloqueio.
  7. As células foram lavadas com 0,05% de TX três vezes durante 5 minutos.
  8. A coloração nuclear foi realizada por incubação com Hoescht mancha na diluição 1:1000 em PBSdurante 5 minutos, seguido por 3 lavagens com PBS.
  9. Células fixadas e coradas foram fotografadas usando microscópio Olympus IX81 invertido e Metamorph software de imagem.

7. Os resultados representativos

A adição de Activina A e wortmannin para hESC indiferenciada durante 4 dias induz endoderme definitivo como confirmado por qRT-PCR para marcadores DE Sox17 e CXCR4, e Foxa2 e imunocoloração para Sox17 como ilustrado na Figura 2. Diferenciação para células progenitoras pancreáticas após a adição de ácido retinóico e ciclopamina foi confirmada por qRT-PCR de marcadores pancreáticas progenitoras e imunocoloração para Pdx1 como ilustrado na Figura 3.

Na fase final da diferenciação, contacto co-cultura com células RHMVEC fortemente induzidas upregulation de expressão de insulina nas células estaminais embrionárias humanas derivadas de células progenitoras pancreáticas. A eficiência de co-cultura diferenciação mediada foi analisado por comparing com a condição de controle usando DAPT. DAPT foi utilizado como um controlo positivo, uma vez que é actualmente um dos métodos mais amplamente utilizados para atingir a maturação pancreático. Uma vez que a co-cultura foi realizada em meio modificado, suplementado por factores de suporte de células endoteliais, controle adicional foi realizada com os meios de comunicação, na ausência de células endoteliais para verificar o efeito dos meios de comunicação em diferenciação. Detalhes desta análise são apresentados na Figura 4.

Figura 1.
Figura 1. Multi-estágio protocolo para a diferenciação de hESC em células que expressam de insulina.

Figura 2.
Figura 2. Indução endoderma definitivo de células estaminais embrionárias humanas. A) análise de qRT-PCR de marcadores representativos DE em células expostas a células estaminais embrionárias humanas Activina A e wortmannin durante 4 dias. Resultados ar e normalizada em relação ao hESC indiferenciada. B) Sox17 coloração (verde) e DAPI (azul) mostraram expressão nuclear de Sox17. Barra de escala: de 50 um.

Figura 3.
Figura 3. Indução de células progenitoras do pâncreas do de células estaminais embrionárias derivadas de células endoderme. A) análise de qRT-PCR de marcadores pancreáticas iniciais em células derivadas hESC endoderme expostos ao ácido retinóico ciclopamina e durante 4 dias após a indução DE. Resultados normalizados com respeito a hESC indiferenciada. B) Pdx1 coloração (violeta) e DAPI (azul) mostraram expressão nuclear de Pdx1. Barra de escala: de 50 um.

">

Figura 4.
Figura 4. Fase de maturação do pâncreas A) análise de qRT-PCR de hormonas pancreáticas na hESC após a maturação pancreática utilizando DAPT, contacto meios co-cultura ou de co-cultura (controlo). Resultados normalizados com respeito a hESC indiferenciada. valores p obtidos pelo teste t de Student. B) co-cultura com Dil-Ac-LDL RHMVEC rotulada (vermelho) mostram regiões onde ECs ligam à placa se existem espaços vazios (topo), RHMVEC outro pode ser encontrada em contacto directo com o CES diferenciador (parte inferior). C) C-péptido de coloração (verde) para as células diferenciadas com co-cultura método. Barra de escala: 12,5 mM (superior) e 50 mM (Inferior) D) A imunomarcação de RHMVEC demonstra nenhuma expressão de insulina no RHMVEC.

Marcador Primer1 (5 'para 3') </ Td> Primer2 (5 'para 3') Ref
SOX17 CTCTGCCTCCTCCACGAA CAGAATCCAGACCTGCACAA 12
CXCR4 CACCGCATCTGGAGAACCA GCCCATTTCCTCGGTGTAGTT 4
FOXA2 GGAGCGGTGAAGATGGAA TACGTGTTCATGCCGTTCAT 12
PDX1 AAGTCTACCAAAGCTCACGCG GTAGGCGCCGCCTGC 4
PTF1 CATAGAGAACGAAACCACCCTTTGAG GCACGGAGTTTCCTGGACAGAGTTC 12
HLXB9 CACCGCGGGCATGATC ACTTCCCCAGGAGGTTCGA 4
HNF6 TGTGGAAGTGGCTGCAGGA TGTGAAGACCAACCTGGGCT 5
PAX6 CGAATTCTGCAGGTGTCCAA ACAGACCCCCTCGGACAGTAAT 5
NKX6.1 AGACCCACTTTTTCCGGACA CCAACGAATAGGCCAAACGA 5
ISL1 GATCTATGTCACCTCGCAAGG TACAACCACCATTTCACTG 12
GLUCAGON AGGCAGACCCACTCAGTGA AACAATGGCGACCTCTTCTG 4
INSULINA AAGAGGCCATCAAGCAGATCA CAGGAGGCGCATCCACA 12

Primers Tabela 1. Usado para reações qPCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Durante o desenvolvimento de pâncreas, células pancreáticas de diferenciação estão em estreita proximidade com as células endoteliais da aorta, além disso, ilhéus pancreáticos são densamente vascularizado para promover a troca rápida de glicose no sangue e hormonas de ilhéus. Tendo em conta estes factos, não é surpreendente que as células endoteliais desempenham um papel importante no processo de organogénese pancreático. Embora a importância das células endoteliais durante o desenvolvimento pancreática é cada vez mais a ser apreciado, o seu papel na diferenciação in vitro de células embrionárias é menos investigada. No nosso relatório anterior que estabeleceu o papel positivo de células endoteliais sobre a maturação de células de pâncreas de rato-tronco embrionárias 13. No presente estudo investigamos o efeito da sinalização da célula endotelial na diferenciação de células-tronco embrionárias.

Várias células endoteliais foram utilizados neste protocolo, todos os quais resultou em althou efeito global semelhanteGH com variações em termos de eficiência de diferenciação. No relatório atual apresenta-se o efeito da co-cultura de células estaminais embrionárias humanas derivadas de células pancreáticas de ratos com células progenitoras cardíacas microvasculares endoteliais (RHMVEC). As células endoteliais pode ser convenientemente visualizadas por AC-LDL de coloração, que é específico para apenas células endoteliais. Co-cultura dos CES de diferenciação com pré-corados mostrou que as células endoteliais, enquanto a maioria das células endoteliais foram viáveis ​​em cultura durante período de tempo prolongado, o RHMEV desaparecer gradualmente após 4 dias e já não podia ser detectado após 6 dias de maturação. Ausência do RHMVEC simplifica a análise, eliminando a necessidade de classificação, portanto, foi escolhido para a optimização do protocolo de co-cultura.

Embora o presente estudo indica claramente o efeito positivo de células endoteliais em maturação pancreática indutor, o mecanismo exacto de indução tais é ainda desconhecido e sendo actualmente investigada no nosso laboratório. A few mecanismos plausíveis poderia ser (i) o efeito da pilha-secretadas moléculas (ii) inibição mediada célula endotelial de entalhe de sinalização (iii) o papel da matriz extracelular secretado pelas células endoteliais. Enquanto a primeira categoria não exige contato célula-célula, esse contato é obrigatória para a segunda e terceira categoria. Assim foi realizada uma análise preliminar utilizando diferentes co-cultura configurações: (i) contactar o co-cultura (ii) transwell de co-cultura e (iii) meios de cultura condicionado. Observou-se que o contacto co-cultura resultou em diferenciação máxima, tal como julgado pela expressão de insulina; seguido por transwell de co-cultura, enquanto que meios de cultura condicionado resultou em efeito mínimo sobre a expressão de insulina (dados não mostrados). Estas análises indicam que, enquanto contato célula-célula é importante, pode haver alguns de curta duração moléculas secretadas que são importantes também.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Não temos nada a divulgar.

Acknowledgements

Reconhecemos o apoio do NIH Innovator Award Nova DP2 116520 e ORAU Ralph Powe Júnior Prêmio Valorização da Faculdade.

Materials

Name Company Catalog Number Comments
mTeSR1 (with supplement) Stem Cell Technologies 5850
hESC qualified matrigel BD Biosciences 354277
DMEM:F12 Invitrogen 11330-032
MCDB-131 Invitrogen 10372019
MCDB-131 (Complete) VEC Technologies MCDB-131
B27 Supplement Invitrogen 17504044
Activin A R&D Systems 338-AC 100ng/ml
Wortmannin Invitrogen W3144 1μM
KAAD-Cyclopamie Sigma-Aldrich C4116 0.2μM
All-Trans Retinoic Acid Sigma-Aldrich R2625 2μM
DAPT Sigma-Aldrich D5942 30μM
Nicotinamide Sigma-Aldrich N0636 10 mM
Sodium Selenite Sigma-Aldrich S5261 30 nM
Insulin Sigma-Aldrich I1882 25 μg/ml
Transferrin Sigma-Aldrich T8158 50 μg/ml
EGF R&D Systems 236-EG 10ng/ml
EndoGro VEC Technologies ENDOGRO 10mg
Heparin Sigma-Aldrich H3149 90μg/ml
Hydrocortisone Sigma-Aldrich H0888 1μg/ml
NucleoSpin RNA II Macherey-Nagel 740955
ImProm II reverse transcription System Promega Corp. A3800
Brilliant II SYBR Green QPCR master mix Stratagene, Agilent Technologies 600548
Sox17 goat polyclonal IgG Santa Cruz Biotechnology, Inc. sc-17355 1/500
PDX1 goat polyclonal IgG Santa Cruz Biotechnology, Inc. sc-14662 1/500
C-Peptide Rabbit polyclonal Cell Signaling Technology 4593 1/500
Alexa Fluor 488 donkey anti-rabbit IgG Invitrogen A-21206 1/1000
Alexa Fluor 647 donkey anti-goat IgG Invitrogen A-21447 1/1000
Table 2. Reagents and Kits

DOWNLOAD MATERIALS LIST

References

  1. De Vos, J., Assou, S., Tondeur, S., Dijon, M., Hamamah, S. Les cellules souches embryonnaires humaines : de la transgression de l'embryon humain á la médecine régénératrice de demain. Gynécologie Obstétrique & Fertilité. 37, 620-626 (2009).
  2. Murtaugh, L. C., Melton, D. A. Genes, Signals, and Lineages in Pancreas Development. Annual Review of Cell and Developmental Biology. 19, 71-89 (2003).
  3. Kubo, A., Shinozaki, K., Shannon, J. M., Kouskoff, V., Kennedy, M., Woo, S., Fehling, H. J., Keller, G. Development of definitive endoderm from embryonic stem cells in culture. Development. 131, 1651-1662 (2004).
  4. D'Amour, K. A., Bang, A. G., Eliazer, S., Kelly, O. G., Agulnick, A. D., Smart, N. G., Moorman, M. A., Kroon, E., Carpenter, M. K., Baetge, E. E. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat. Biotech. 24, 1392-1401 (2006).
  5. Zhang, D., Jiang, W., Liu, M., Sui, X., Yin, X., Chen, S., Shi, Y., Deng, H. Highly efficient differentiation of human ES cells and iPS cells into mature pancreatic insulin-producing cells. Cell Res. 19, 429-438 (2009).
  6. Basma, H., Soto-Gutiérrez, A., Yannam, G. R., Liu, L., Ito, R., Yamamoto, T., Ellis, E., Carson, S. D., Sato, S., Chen, Y., Muirhead, D. Differentiation and Transplantation of Human Embryonic Stem Cell-Derived Hepatocytes. Gastroenterology. 136, 990-999 (2009).
  7. Phillips, B. W., Hentze, H., Rust, W. L., Chen, Q. -P., Chipperfield, H., Tan, E. -K., Abraham, S., Sadasivam, A., Soong, P. L., Wang, S. T., Lim, R., Sun, W., Colman, A., Dunn, N. R. Directed Differentiation of Human Embryonic Stem Cells into the Pancreatic Endocrine Lineage. Stem Cells and Development. 16, 561-578 (2007).
  8. Kim, S. K., Melton, D. A. Pancreas development is promoted by cyclopamine, a Hedgehog signaling inhibitor. Proceedings of the National Academy of Sciences. 95, 13036-13041 (1998).
  9. Docherty, K. Growth and development of the islets of Langerhans: implications for the treatment of diabetes mellitus. Current Opinion in Pharmacology. 1, 641-649 (2001).
  10. Nikolova, G., Jabs, N., Konstantinova, I., Domogatskaya, A., Tryggvason, K., Sorokin, L., Fässler, R., Gu, G., Gerber, H. -P., Ferrara, N., Melton, D. A. The Vascular Basement Membrane: A Niche for Insulin Gene Expression and [beta]> Cell Proliferation. Developmental Cell. 10, 397-405 (2006).
  11. Yoshitomi, H., Zaret, K. S. Endothelial cell interactions initiate dorsal pancreas development by selectively inducing the transcription factor Ptf1a. Development. 131, 807-817 (2004).
  12. Osafune, K., Caron, L., Borowiak, M., Martinez, R. J., Fitz-Gerald, C. S., Sato, Y., Cowan, C. A., Chien, K. R., Melton, D. A. Marked differences in differentiation propensity among human embryonic stem cell lines. Nat. Biotech. 26, 313-315 (2008).
  13. Banerjee, I., Sharma, N., Yarmush, M. Impact of co-culture on pancreatic differentiation of embryonic stem cells. J. Tissue Eng. Regen. Med. 5, 313-323 (2010).

Comments

2 Comments

  1. good

    Reply
    Posted by: Zhongchun S.
    July 20, 2012 - 2:15 AM
  2. Dear Maria Jaramillo

    I am a student of the licencientura in biotechnology in the Universidad Argentina de la Empresa.
    I am currently studying the cell cultures, researching on the internet I find interesting the abstract, I would like to know if it is possible for me to send the paper by email please.
    thanks and greetings


    Ana Clara López Novo
    Matter cell cultures
    Department of biotechnology and food technology
    Faculty of engineering and Sciences
    Universidad Argentina de la Empresa
    Lima 717 (C1073AAO)
    Ciudad Autónoma de Buenos Aires
    Email: anaclaralopeznovo@gmail.com

    Reply
    Posted by: Ana L.
    May 6, 2013 - 10:24 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics