पोलीमरेज़ चेन रिएक्शन: बेसिक प्रोटोकॉल प्लस समस्या निवारण और अनुकूलन रणनीतियाँ

Biology
 

Cite this Article

Copy Citation | Download Citations

Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J. Vis. Exp. (63), e3998, doi:10.3791/3998 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Materials

Name Company Catalog Number Comments
Taq Polymeras Sigma-Aldrich D4545-25UN
dNTPs Qiagen 201225
0.2 ml Thin Wall Tubes PCR tubes Bio-Rad 223-9469
0.2 ml Thin Wall Tube caps Bio-Rad 223-9472
EDTA disodium salt dihydrate Sigma-Aldrich E5134
Trizma-HCl Sigma-Aldrich T-3253
Custom Phage Primer Invitrogen 25441F_RL6_Contig2_68k TACTGCAACGCGATGTTGCG
Custom Phage Primer Invitrogen 26007R_RL6_ Contig2_68k TCACCATCAATCGTGGCGGT
Custom Yeast Primer Integrated DNA Technologies SacI-Gal3(-256) ACCTGGAGCTCCTATTT TAACATGTGGATTTCTTGAAAGAATGAAATCG
Custom Yeast Primer Integrated DNA Technologies Gal3(1848)-SacI CGGATGGAGCTCGCGT GAAGGTAATTTTTTTTTATGTCTCCG
Thermal Cycler Bio-Rad 170-9703 My Cycler
Agarose ISC BioExpress E-3120-500
Gel electrophoresis Hoeffer Scientific Instruments Model HE33
1 kb DNA Ladder New England Biolabs N3232S
Bio Rad Power Pack Bio-Rad 164-5050 PowerPac Basic
Gel Doc system Fotodyne Incorporated FOTO/Analyst Investigator FX Workstation

DOWNLOAD MATERIALS LIST

References

  1. Albert, J., Fenyo, E. M. Simple sensitive, and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers. J. Clin. Microbiol. 28, 1560-1564 (1990).
  2. Baskaran, N., et al. Uniform amplification of a mixture of deoxyribonucleic acids with varying GC content. Genome Res. 6, 633-638 (1996).
  3. Blanchard, M. M., Taillon-Miller, P., Nowotny, P., Nowotny, V. PCR buffer optimization with uniform temperature regimen to facilitate automation. PCR Methods Appl. 2, 234-240 (1993).
  4. Borer, P. N., Dengler, B., Tinoco, I. Jr, Uhlenbeck, O. C. Stability of ribonucleic acid double-stranded helices. J. Mol. Biol. 86, 843-853 (1974).
  5. Breslauer, K. J., Frank, R., Blocker, H., Marky, L. A. Predicting DNA duplex stability from the base sequence. Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750 (1986).
  6. Chou, Q., Russell, M., Birch, D. E., Raymond, J., Bloch, W. Prevention of pre-PCR mis-priming and primer dimerization improves low-copy-number amplifications. Nucleic Acids Res. 20, 1717-1723 (1992).
  7. Coleman, W. B., Tsongalis, G. J. Diagnostics for the clinical laboration. Humana Press. (2005).
  8. D'Aquila, R. T., et al. Maximizing sensitivity and specificity of PCR by pre-amplification heating. Nucleic Acids Res. 19, 3749 (1991).
  9. Dieffenbach, C. W., Lowe, T. M., Dveksler, G. S. General concepts for PCR primer design. PCR Methods Appl. 3, S30-S37 (1993).
  10. Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K., Mattick, J. S. 'Touchdown' PCR to circumvent spurious priming during gene amplification. Nucleic Acids Res. 19, 4008 (1991).
  11. Erlich, H. A., Gelfand, D., Sninsky, J. J. Recent advances in the polymerase chain reaction. Science. 252, 1643-1651 (1991).
  12. Frey, U. H., Bachmann, H. S., Peters, J., Siffert, W. PCR-amplification of GC-rich regions: 'slowdown PCR. Nat. Protoc. 3, 1312-1317 (2008).
  13. Haqqi, T. M., Sarkar, G., David, C. S., Sommer, S. S. Specific amplification with PCR of a refractory segment of genomic DNA. Nucleic Acids Res. 16, 11844 (1988).
  14. Henke, W., Herdel, K., Jung, K., Schnorr, D., Loening, S. A. Betaine improves the PCR amplification of GC-rich DNA sequences. Nucleic Acids Res. 25, 3957-3958 (1997).
  15. Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T. J. PCR Protocols: A guide to methods and applications. Academic Press, Inc. San Diego. (1990).
  16. King, N. Methods in Molecular Biology. 630, Humana Press. (2010).
  17. Kleppe, K., Ohtsuka, E., Kleppe, R., Molineux, I., Khorana, H. G. Studies on polynucleotides. XCVI. Repair replications of short synthetic DNA's as catalyzed by DNA polymerases. J. Mol. Biol. 56, 341-361 (1971).
  18. Korbie, D. J., Mattick, J. S. Touchdown PCR for increased specificity and sensitivity in PCR amplification. Nat. Protoc. 3, 1452-1456 (2008).
  19. Kramer, M. F., Coen, D. M. Enzymatic amplification of DNA by PCR: standard procedures and optimization. Curr. Protoc. Toxicol. Appendix 3, 1-14 (2001).
  20. Kramer, M. F., Coen, D. M. The polymerase chain reaction. Curr. Protoc. Protein Sci. Appendix 4, Appendix 4J (2002).
  21. Kreader, C. A. Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein. Appl. Environ. Microbiol. 62, 1102-1106 (1996).
  22. Kwok, S., et al. Identification of human immunodeficiency virus sequences by using in vitro enzymatic amplification and oligomer cleavage detection. J. Virol. 61, 1690-1694 (1987).
  23. McConlogue, L., Brow, M. A., Innis, M. A. Structure-independent DNA amplification by PCR using 7-deaza-2'-deoxyguanosine. Nucleic Acids Res. 16, 9869 (1988).
  24. Mullis, K. B. The unusual origin of the polymerase chain reaction. Sci. Am. 262, 56-65 (1990).
  25. Mullis, K. B. Target amplification for DNA analysis by the polymerase chain reaction. Ann. Biol. Clin. (Paris). 48, 579-582 (1990).
  26. Mullis, K. B. The polymerase chain reaction in an anemic mode: how to avoid cold oligodeoxyribonuclear fusion). PCR Methods Appl. 1, 1-4 (1991).
  27. Mullis, K. B., Faloona, F. A. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol. 155, 335-350 (1987).
  28. Paabo, S., Gifford, J. A., Wilson, A. C. Mitochondrial DNA sequences from a 7000-year old brain. Nucleic Acids Res. 16, 9775-9787 (1988).
  29. Rees, W. A., Yager, T. D., Korte, J., von Hippel, P. H. Betaine can eliminate the base pair composition dependence of DNA melting. Biochemistry. 32, 137-144 (1993).
  30. Roux, K. H., Hecker, K. H. One-step optimization using touchdown and stepdown PCR. Methods Mol. Biol. 67, 39-45 (1997).
  31. Rychlik, W., Spencer, W. J., Rhoads, R. E. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res. 18, 6409-6412 (1990).
  32. Saiki, R. K., et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 239, 487-491 (1988).
  33. Saiki, R. K., et al. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science. 230, 1350-1354 (1985).
  34. Sambrook, J. A. R., David, W. Molecular Cloning A Laboratory Manual. 2, 3, Cold Spring Harbor Laboratory Press. (2001).
  35. Sarkar, G., Kapelner, S., Sommer, S. S. Formamide can dramatically improve the specificity of PCR. Nucleic Acids Res. 18, 7465 (1990).
  36. Smit, V. T., et al. KRAS codon 12 mutations occur very frequently in pancreatic adenocarcinomas. Nucleic Acids Res. 16, 7773-7782 (1988).
  37. Wilson, I. G. Inhibition and facilitation of nucleic acid amplification. Appl. Environ. Microbiol. 63, 3741-3751 (1997).
  38. Wu, R. Methods in Enzymology. 218, Academic Press, Inc. San Diego. (1993).

Comments

1 Comment

  1. Thanks for the great overview of the all-important PCR procedure. I will no doubt reference it often in the future.

    I have a PCR troubleshooting question...what do to about streaking on the gel after a successful amplification? My bands are nice and bright and where they are supposed to be, but there is a heavily-streaked "path" starting at the wells and following until the end where my bands are. Is there something I can do about my PCR conditions, or the thermocycler settings? Any comments would be appreciated.

    Reply
    Posted by: Doug E.
    September 8, 2013 - 1:23 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics