중합 효소 사슬 반응 : 기본 프로토콜 플러스 문제 해결 및 최적화 전략

Biology
 

Summary

PCR은 많은 분자 생물학 연구소의 일반적인 기법으로 부상하고있다. 여러 기존의 PCR 프로토콜에 대한 안내서가 여기에 제공됩니다. 각 반응은 독특한 실험, 제품이 다양 생성하는 데 필요한 최적의 조건이기 때문에. 반응의 변수를 이해하는 것은 크게함으로써 원하는 결과를 얻을 수있는 기회를 증가 문제 해결 효율성을 향상시킬 것입니다.

Cite this Article

Copy Citation | Download Citations

Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J. Vis. Exp. (63), e3998, doi:10.3791/3998 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

생명 공학 발견의 황금 시대로 징계를 쇠뇌 기술 진보가 있었다. 예를 들어, 미생물학 분야는 과학자들이 처음으로 prokaryotes을 시각화 수 안톤 반 리웬허크와의 현미경의 출현으로 변모되었다. 중합 효소 사슬 반응 (PCR)의 개발 미치는 영향은 생물학에서 수많은 subdisciplines를 스팬과 분자 과학의 진로를 변경 이들 혁신 중 하나입니다. 이론 과정은 1971 년에 Keppe와 동료에 의해 제시된되었다; 전체 PCR 절차 주면 주식 회사에서 1985 년 동안 Kary Mullis에 의해 설명하고 실험적으로 적용되기 전까지는하지만, 그건 다른 14년했습니다. 이 기법의 자동화 및 개선은 세균의 Thermus aquaticus의, 따라서 이름이 DNA 형성 촉매 장치의 DNA 중합 효소의 열 안정성의 DNA 중합 효소의 도입과 함께 진행.

PCR은 포웨입니다시작하는 재료만을 소량 (즉, DNA를 템플릿이나 대상 시퀀스)의 DNA (즉, amplicon)의 특정 세그먼트의 충분한 공급을 생성할 수 rful 증폭 기술. 간단하고 일반적으로 문제가없는 반면, 가짜 결과를 생산하는 반응을 복잡하게 함정이 있습니다. PCR이 실패했을 때 그것은 아가로 오스의 젤에 대한 밴드의 사다리 또는 얼룩으로 나타 다양한 규모의 다수가 아닌 특정 DNA의 제품으로 이어질 수 있습니다. 가끔 제품이 전혀 나오지. 변이가 실수로 PCR 제품의 이질적인 인구 결과, amplicons에 소개되면 또 다른 잠재적인 문제가 발생합니다. 인내와 신중 문제 해결이 정리 및 문제 (들)을 해결하기 위해 고용하지 않는 경우 PCR 실패는 절망적이 될 수 있습니다. 이 프로토콜은 PCR의 기본 원리를 설명 대부분의 대상 시퀀스의 증폭집니다 방법론을 제공하고 반응을 최적화하기위한 전략을 제시합니다. 이 PCR 가이드, 일에 따라udents는 할 수 있어야합니다 :

  • 종래의 PCR 실험에 대한 반응 및 열 사이클링 조건을 설정
  • 다양한 반응 구성 요소의 기능과 PCR 실험에 미치는 전반적인 영향을 이해
  • 어떤 DNA를 템플릿에 대한 PCR 실험을 설계하고 최적화
  • 실패 PCR 실험 문제 해결

Protocol

1. 디자인 Primers

적절한 primers를 설계하는 것은 PCR 실험의 성공적인 결과에 필수적이다. 증폭을 위해 원하는 DNA의 특정 지역에 primers 세트를 설계할 때, 하나의 뇌관이 플러스 대회에서 5 '→ 3'방향으로 (또한 감각 또는 nontemplate 스트랜드라고도 함)에 중심입니다 가닥과로 어닐링한다 다른 프라이머는 3 '→ 5'방향 (안티 센스 또는 템플릿 스트랜드)에 중심입니다 마이너스 가닥을 보완한다. 오히려 다음, 2) 프라이머 서로 소둔 DNA를 템플릿 입문서를 만드는; 1) 자동 풀림 같은 머리 핀의 자형 고리 (그림 1A)와 같은 이차 구조의 형성으로 인한 primers의 : primers를 설계할 때 발생하는 몇 가지 일반적인 문제가 있습니다 dimers (그림 1B), 각 프라이머 3) 크게 다른 용융 온도 (T m), 어렵게 어닐링 온도를 선택하여 입을 위해 만드는아우 두 primers 효율적으로 themal 사이클링 (그림 1C) (T m의에 대한 자세한 내용은 사이클링 조건 용융 온도 (T m) 및 수정 계산 섹션 참조) 동안 자신의 목표 시퀀스에 바인딩합니다.

  1. 아래 primers를 디자인할 때 고려해야하는 특성의 목록입니다.
    1. 프라이머의 길이는 15-30 염기 잔류물 (기지)이어야합니다.
    2. 최적의 GC 함량은 40-60% 사이에 이르기까지 다양합니다.
    3. primers의 3 '끝이 마중물 효율성을 증가, 프라이머 클램프 및 엔드'호흡 '을 방지하기 위해서는 G 또는 C를 포함해야합니다. 끝을하지만 프레이 annealed 머물거나 따로 분리하지 않는 경우 DNA는 "호흡"는 발생합니다. GC 쌍에있는 세 개의 수소 채권은 호흡을 방지뿐만 아니라 primers의 녹는 온도를 높일 수 있습니다.
    4. 플러스 스트랜드의 프라이머와 마이너스 스트랜드 프라이머를 포함하는 프라이머 세트의 3 '끝을은 C 오지 말았 어야지 서로 omplementary 없으며, 하나의 프라이머의 3 '끝은 프라이머의 다른 시퀀스에 보완이 될 수 있습니다. 이 두 시나리오는 각각, 뇌관의 dimers 및 머리핀 루프 구조를 형성하는 결과를 가져올 수도 있습니다.
    5. 범위는 45-65로 확장시킬 수 있지만 52-58 ° C 사이의 primers 범위에 대한 최적의 용융 온도 (T m), ° C. 두 primers에 대한 최종 T의 상부 더이상 5 달러로 차이가해야 ° C.
    6. 그들이 형성하는 DNA와이나 머리핀 루프 구조의 준비가 끝났다 구간을 따라 미끄러지고 일으킬 수 있으므로 디 - 염기 반복 (예 : GCGCGCGCGC 또는 ATATATATAT) 또는 단일 기본 실행은 (예 : AAAAA 또는 CCCCC) 피해야한다. DNA를 템플릿의 성격으로 인해 부득 이한 경우에만 반복을 포함하거나 단일 기본 4 기지의 최대과 함께 실행됩니다.

참고 사항 :

  1. 프라이머 쌍을 디자인에 투입하기위한 많은 컴퓨터 프로그램들이 있습니다. NCBI의 뇌관 설계 도구w.ncbi.nlm.nih.gov / 공구 / 프라이머 - 폭발 / "대상 ="_blank "> http://www.ncbi.nlm.nih.gov/tools/primer-blast/ 및 Primer3 http://frodo .wi.mit.edu/primer3 /는 이러한 목적으로 권장되는 웹사이트입니다.
  2. 관련 pseudogenes 또는 homologs의 증폭을 방지하기 위해서는 primers의 대상 특이성을 확인하기 위해 NCBI에서 폭발을 실행하는 데 유용할 수 있습니다.

2. 재료 및 시약

  1. PCR 실험을 설정할 때 준비된 것이 중요합니다. 반응 혼합물 또는 시약 오염을 막기 위해 장갑을 착용한다. 부정적인 컨트롤을 포함하고, 긍정적인 컨트롤을 가능하면.
  2. 신선하게 채워진 아이스 버킷의 PCR 실험에 필요한 모든 시약을 마련하고, 그들 반응 (그림 2)를 설정하기 전에 완전히 녹여 보자. 실험 내내 얼음 시약 보관하십시오.
    • 표준 PCR의 시약이 포함원하는 목표 유전자 또는 증폭되는 DNA의 세그먼트의 DNA 중합 효소, 특정의 DNA 중합 효소를위한 버퍼, deoxynucleotides (dNTPs), DNA 템플릿 및 멸균 물에 적합한 primers로 설정합니다.
    • 추가적인 시약은 마그네슘 염 MG 2 + (0.5-5.0 mm의 최종 농도에서), 칼륨 소금 K + (35-100 mm의 최종 농도에서), dimethylsulfoxide을 (DMSO 포함할 수있다; 1-10%의 최종 농도에서 ), 포름 아미드 (1.25-10 %의 최종 농도에서), 소 (10-100 μg / ML의 최종 농도에서) 알부민 혈청, 그리고 베타인 (2.5 M로 0.5 m의 최종 농도에서). 첨가제는 문제 해결 섹션에 추가로 설명합니다.
  3. 작업대에서 실험 장비를 구성합니다.
    • 10 μl (P10), 2 - - 20 μl (P20), 20-200 μl (P200) 자료는 PCR 튜브와 뚜껑, PCR 튜브 랙, 에탄올 내성 마커, 1 사이의 분배 micropipettors 집합을 포함과 200-1000 μl (P1000)뿐만 아니라 열 자전거 타는 사람.
    • 것이 모두 같은 시약을 사용하여 여러 가지 PCR 실험을 설정할 때, 그들은 적절히 크기 조정 및 마스터 혼합 (마스터 믹스)에서 함께 조합하여 사용할 수 있습니다. 이 단계는 (주 참조) 멸균 1.8 ML의 microcentrifuge 튜브로 이루어 질 수 있습니다.
    • 아가로 오스 겔 전기 영동을위한 PCR 실험, 시약 및 장비에서 발생하는 amplicons를 분석하는 것이 필요합니다. PCR 제품의 대략적인 크기로, 적절한, 상용 분자량 크기가 표준이 필요합니다.

3. 반응 혼합물 설정하기

  1. (표 1 참조) 반응 혼합물에 추가됩니다 시약의 테이블을 만들어 시작합니다.
  2. 다음, 에탄올 내성 마커와 라벨 PCR 튜브 (들).
  3. 반응 볼륨 주식 시약의 농도에 따라 달라집니다. 최종 농도(CF) 전형적인 50 μl 반응을 다음과 같다.
    • X 버퍼 (보통의 DNA 중합 효소의 제조 업체에서 공급가, MgCl 2 15 밀리미터를 포함할 수 있습니다.) 반응 당 10X 버퍼의 5 μl를 추가합니다.
    • 200 μm의 dNTPs (네 개의 세포핵의 각각 50 μm의). 반응 지당 10 밀리미터 dNTPs (dATP, dCTP, dTTP와 dGTP 2.5 밀리미터 각각에 있습니다) 1 μl를 추가합니다.
    • 1.5 MM MG 2 +. 그것 10X 버퍼에 존재하지 않는 또는 PCR 최적화를 위해 필요한 경우에만 추가합니다. 예를 들어, 4.0 MM MG 2 + uncharacterized Mycobacteriophage 반응 (그림 3) 25 밀리미터 MgCl 2의 8 μl를 추가로 발견 보존되어 566 BP의 DNA 세그먼트의 최적의 amplicon 제작에 필요한 프로그램을 구하십시오.
    • 각 프라이머의 20-50 pmol. 각각 20 μm의 프라이머 1 μl를 추가합니다.
    • 4월 10일부터 7월 10일까지 분자 (또는 1000-1 약 NG)의 DNA 템플릿을 추가합니다. 2ng / & 무 0.5 μl 추가, 내 게놈의 Mycobacteriophage의 DNA.
    • 예를 들어 50 μl 반응마다의 DNA 중합 효소의 0.5-2.5 단위 (제조 업체의 권장 사항을 참조) 추가, 0.5 시그마 0.5 단위의 μl / μl DNA 형성 촉매의 DNA 중합 효소를 추가합니다.
    • (QS가 필요한 금액을 의미하는 양자 satis위한 라틴어 약어이다) 시약의 테이블에 미리 결정된 반응 당 50 μl 최종 볼륨을 얻기 위해 QS 멸균 증류수를 추가합니다. 따라서, 반응 당 33 μl가 최대 50 μl로 볼륨을 가지고 있어야합니다. 그러나, 그것은 물을 처음에 추가됩니다하지만 처음 시약의 테이블을 만들고 반응에 추가된 다른 모든 시약의 볼륨을 결정하는 데 필요하다는 지적한다.

4. 기본적인 PCR 프로토콜

  1. 0.2 ML 얇은 벽으로 둘러싸인 PCR 튜브를위한 홀더와 같은 아이스 버킷에 96 잘 접시를 놓습니다. PCR의 시약이 추운 0.2 ML 얇은 벽으로 둘러싸인 PCR 튜브에 추가할 수 있도록하는 것은 nucleas을 방지하는 데 도움이됩니다온라인 활동 및 특이 현상 프라이밍.
  2. 무균 물, 10X PCR 버퍼, dNTPs, MgCl 2, primers, 그리고 템플릿 DNA (표 1 참조) : 다음과 같은 순서 0.2 ML 얇은 벽으로 둘러싸인 PCR 튜브 (그림 4)에 다음 PCR의 시약을 피펫. 실험은 적어도 부정적인 통제, 그리고 아마도 긍정적인 컨트롤이 있어야하므로, 1.8 ML의 microcentrifuge 튜브의 마스터 믹스를 설정하는 (주에 대한 설명을 참조) 유용합니다.
  3. 별도의 0.2 ML 얇은 벽으로 둘러싸인 PCR 튜브에 (그림 4) 부정적인 컨트롤을위한 템플릿 DNA의 예외 (누락된 볼륨을 보상하기 위해 물을 증가)으로 모든 시약을 추가합니다. 또한, 다른 반응 (시약을 사용할 경우) 템플릿 DNA와 또는 이전에 실험 PCR 튜브와 같은 조건에서 증폭하는 것으로 알려진 primers를 사용하여 긍정적인 컨트롤을 포함해야합니다.
  4. DNA 형성 촉매의 DNA 중합 효소는 일반적으로 50 % 글리세롤에 저장됩니다반응 혼합물의 솔루션과 완벽한 분산을위한이 필요 최소한 20 번 아래로 pipetting 및하여 PCR 시약의 혼합 온화한. 믹싱 때 micropipettor는 마스터 믹스의 절반에 대한 반응 볼륨으로 설정해야하며주의가 거품을 도입 피하기 위해 이동해야합니다.
  5. 0.2 ML 얇은 벽으로 둘러싸인 PCR 튜브에 뚜껑을 넣고 열 자전거 타는 사람 (그림 5)으로 끌어 놓습니다. 열 자전거 타는 사람에 뚜껑이 단단히 닫혀되면 (표 2 참조) 프로그램을 시작합니다.
  6. 프로그램이 완료되면 0.2 ML 얇은 벽으로 둘러싸인 PCR 튜브는 4 ° C.에 제거하고 저장될 수 있습니다 PCR 제품은 다음 ethidium의 브로마이드와 겔 다음 전기 영동으로 마이 그 레이션했습니다 DNA를 더럽히는 것 아가로 오스 겔의 우물에 각각 반응 aliquots를로드까지 감지가 가능하다. PCR 제품이 있으면 ethidium의 브로마이드는 밴드가 자외선 조명기과 시각이 될 수 있도록 DNA의 가닥 기지 사이 사이에 끼어 넣다 것입니다. </ 리>

참고 사항 :

  1. 다중 PCR 실험을 설정하면 모든 반응 (즉, 마스터 믹스)에 공통 시약의 혼합 조립에 유리합니다. 보통 칵테일은 1.8 ML의 microcentrifuge 튜브로 조립된의 DNA 중합 효소, dNTPs, 반응 버퍼, 그리고 물을 솔루션을 포함하고 있습니다. 각 시약의 양은 마스터 믹스에 추가하는 것은 가장 가까운 전체 반응로 반올림 총 반응의 수를 더한 10 % 동일합니다. 예를 들어,있다면 10 × 0.1 = 1 반응 후 (10 + 1) × 5 μl 10X 버퍼 마스터 믹스를위한 10X 버퍼의 55 μl 같습니다. 마스터 믹스의 시약은 위에서 설명한대로 부드럽게 20 번 다운 micropipettor의 플런저를 펌핑하고에 의해 철저하게 혼합한다. 각 PCR 튜브는 DNA를 템플릿, 모든 필요한 primers 및 실험 관련 시약은 다음 (표 1 및 7 참조)에 추가되었습니다 위해 마스터 믹스 나누어지는를받습니다.
  2. followiNG 웹사이트 템플릿 DNA (사본의 수를 결정하기위한 계산기를 제공합니다 http://www.uri.edu/research/gsc/resources/cndna.html을 ). 이중 좌초된 DNA의 사본의 총수는 다음 방정식을 사용하여 계산할 수 있습니다 :
    / DNA =의 매수 (DNA의 금액 (NG) × 6.022x10 23) (유전자 X 1x10 9 NG / ML X 650 Daltons의 길이)
    DNA의 매수를 계산하는 것은 템플릿 반응에 따라 필요한 양을 결정하는 데 사용됩니다.
  3. 잘못된 반응은 전기 영동 후 아가로 오스 겔에 여러 바람직하지 않은 제품으로 시각 될 다른 PCR 반응에서 기내 이상의 결과로 발생할 수 있습니다. 따라서 그것이 적절한 기술을 사용하는 신중한이며, (그리고 긍정적인 제어 가능한 경우) 부정적인 컨트롤을 포함합니다.
  4. ethidium 브로마이드는 가장 일반적인 얼룩 F이지만아니면 핵산은 몇 가지 더 안전하고 덜 독성이 대안입니다. 다음의 웹사이트를 사용하고 (최종 제품을 검색하는 방법에 대한 설명과 함께 레드 메틸렌 블루, 크리스탈 바이올렛, SYBR 안전, 그리고 젤 포함한 대안 몇 가지를 설명 http://bitesizebio.com/articles/ethidium-bromide-the- 대안 / ).
  5. 가장 현대적인 PCR 기계 0.2 ML 튜브를 사용하는 반면, 일부 모델 0.5 ML 튜브의 반응을 요구할 수 있습니다. 적절한 크기의 튜브를 결정하기 위해 열 cyclers 설명서를 참조하십시오.

5. 계산 녹는 온도 (T m)

  1. primers의 녹는 온도 (T m)를 아는 것은 성공적인 PCR 실험을위한 필수적입니다. 여러 T 미터 계산기를 사용할 수있다지만, 이러한 계산으로 인해 실제 T m의 추정치임을 유의하는 것이 중요하다 T 미터 계산기 자체의 알고리즘에 의한 특정 반응과 가정에 대한 구체적인 정보가 부족합니다. T m ≈ 4 (GC) + 2 (AT) : 그러나 가까운 - 이웃의 열역학적 모델은보다 전통적인 계산을 통해 선호하고 있습니다. 그것이 계정에 인접한 기본 쌍의 스태킹 에너지를 소요하기 때문에 과거보다 정확한 T 미터 추정을 제공합니다. 계산은 간단하며 손으로 빠르게 할 수 있기 때문에 후자가 더 자주 사용됩니다. PCR 조건과 첨가제가 녹는 온도 영향을 미치는지 다양한에 대한 자세한 내용은 문제 해결 섹션을 참조하십시오.
    가까운 - 이웃의 열역학적 모델에 따라 계산기 중 하나에 의해 T m 값을 계산하기위한 권장합니다 :
    http://www6.appliedbiosystems.com/support/techtools/calc/
    에듀 / ~ 짐머 / oligoTMcalc.html "대상 ="_blank "> http://www.cnr.berkeley.edu/ ~ 짐머 / oligoTMcalc.html
    http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/
    http://www.finnzymes.com/tm_determination.html~~V
    http://mobyle.pasteur.fr/cgi-bin/portal.py? # 양식 :: 녹는

6. 열 사이클링 조건 설정

  1. PCR 열 cyclers 급속 가열 및 이중 DNA (스트랜드 분리)의 열을 유발 변성있게 반응 혼합물은, DNA의 템플릿의 플러스와 마이너스 가닥으로 primers의 어닐링 시원한, 그리고 PCR 제품의 이격. 사이클 시간은 템플릿과 DNA의 GC 콘텐츠의 크기에 따라 계산됩니다. 일반 formul는 94에서 초기 변성 단계로 시작 ° C ~ 98 ° C의 DNA 중합 효소 활동 및 템플릿 DNA의 GC 컨텐츠에 대한 최적의 온도에 따라. 전형적인 반응은 94시 1 분 변성과 함께 시작됩니다 ° C. 더 이상보다 3 분의 효소 활동을 파괴의 DNA 중합 효소를 inactivate 수 있습니다. 핫 스타트 PCR로 알려진 한 가지 방법은, 크게 최대 구분 3 분 거리에 초기 변성 시간을 확장합니다. 초기 과장된 변성 단계를 마친 후 핫 스타트 PCR을 통해 DNA의 중합 효소가 추가됩니다. 이 프로토콜 수정의 DNA 중합 효소 효소의 불활 성화 가능성을 방지합니다. 핫 시작 PCR 및 다른 대체 방법에 대한 자세한 내용은이 프로토콜의 문제 해결 섹션을 참조하십시오.
  2. 다음 단계는 3 단계 온도주기의 25-35 회진 (표 2)의 처음을 시작하는 열 자전거 타는 사람을 설정하는 것입니다. 35 위 사이클의 수를 늘리면 얻을 수 있지만PCR 제품의 더 큰 수량, 너무 많은 회진은 종종 바람직하지 보조 제품의 농축에 대한 결과입니다. 단일주기에있는 세 개의 온도 단계가 세 가지 작업을 수행 : 첫 번째 단계는 템플릿 (그리고 나중에주기, amplicons뿐만 아니라 관련) denatures, 두 번째 단계는 최적의 primers의 어닐링 수 있으며 세 번째 단계에 바인딩의 DNA 중합 효소를 허용 DNA의 템플릿 및 PCR 제품을 합성. 사이클 내에서 각 단계의 기간 및 온도 원하는 amplicon의 생산을 최적화하기 위해 변경할 수 있습니다.
    변성 단계를위한 시간은 가능 한한 짧은대로 유지됩니다. 보통 10~60초은 대부분의 DNA를 템플릿에 대한 충분합니다. 변성 시간과 온도 템플릿 DNA의 GC 내용에 따라 달라질뿐만 아니라 수 그 한 온도에서 다음으로 변경하려면 열 자전거 타는 사람 소요 시간 램프 레이트. 이 단계의 온도는 그 초기 변성 단계에 사용로서 일반적으로 동일(단계 # 1 위, 예 : 94 ° C).
    삼십초 어닐링 단계는 약 5 설정한 온도 사이클 내에서 다음 ° primers의 겉보기 T의 m 아래에 C (이상 52 사이 ° C ~ 58 ° C까지).
    사이클은 연신율 단계로 마칩니다. 온도가 실험을 위해 선택한 DNA의 중합 효소에 따라 달라집니다. 예를 들어, DNA 형성 촉매 장치의 DNA 중합 효소는 70 최적의 신장 온도를 가지고 ° C ~ 80 ° C와 다음 증폭된 각 추가 1킬로바이트위한 여분 분이 필요합니다, 첫 번째 2킬로바이트을 길어지다 위해 1 분 필요합니다. Pfu DNA를 중합 효소는 75 최적의 신장 온도를 가지고 다른 내열성 효소 °​​ C.이다 Pfu DNA를 중합 효소는 PCR과 높은 정절을 요구하고 증폭되는 모든 1킬로바이트위한 2 분 필요 프라이머 연장 반응에 사용을 권장합니다. 각각 특정의 DNA 중합 효소에 대한 지적 정확한 연신율 온도와 연신율 시간 동안 제조 업체 권장 사항을 참조하십시오.
  3. DNA 형성 촉매 장치의 DNA 중합 효소의 경우, 모든 PCR 제품의 3 '엔드에 아데닌 잔기를 추가할 수 있습니다. 이 수정은 DNA 형성 촉매 장치의 DNA 중합 효소의 터미널 transferase 활동에 의해 중재와 3'-오버행을 필요로 후속 분자 클로닝 절차에 유용합니다.
  4. 반응의 종료는 4로 혼합 냉각에 의해 이루어집니다 ° C 및 / 또는 10 mm의 최종 농도로 EDTA (에틸렌 다이아 민 테트라 초산) 또한 의한.

7. PCR 문제 해결 중요 고려 사항

표준 PCR 조건이 원하는 amplicon을 양보하지 않으면 PCR 최적화는 더 나은 결과를 달성하는 데 필요합니다. 반응의 엄중 (예, 특이성이 변경 변수에 의해 조정되는 등 변조된 수 있습니다 시약amplicon 프로파일의 결과에 영향을 미치는 농도, 사이클링 조건). 반응이 충분히 엄격한 아닌 경우 예를 들어, 많은 가짜 amplicons는 변수 길이로 생성됩니다. 반응이 너무 엄격한 경우에는 제품이 생산되지 않습니다. 문제 해결 PCR 반응은 때때로 좌절 노력 수도 있습니다. 그러나, 조심 분석 및 PCR 실험에 사용된 시약의 좋은 이해 시간과 원하는 결과를 얻기 위해 필요한 재판의 양을 줄일 수 있습니다. 모든 고려 사항의 영향 PCR의 엄중, MG 2 + 및 / 또는 가능성이 대부분의 문제를 해결합니다 어닐링 온도를 조작 적정. 그러나 아무것도를 변경하기 전에, 잘못된 결과가 인간의 오류로 인해 않았음을 확인하십시오. 모든 시약은 주어진 반응에 추가 시약이 오염되지 않았음을되었습니다 확인하여 시작합니다. electropho 후 겔에 보이는 뇌관의 dimers는 다음과 같습니다 또한 잘못된 결과를주의 깊게 살펴보고, 다음과 같은 질문을resis (작은 밴드와 같은 이들이 운영하는 B 차선 하단 <100)? 가 아닌 특정 제품 (원하는 제품이 아닌 다른 크기로 마이 그 레이션 밴드)입니까? 모든 제품의 부족은 없었나요? 플라스미드 또는 게놈의 DNA 추출물의 표적 DNA가 있나요? 또한 원하는 amplicon의 GC 내용을 분석하는 것이 현명하다.

  1. PCR의 시약 중 하나는 당신의 반응에 치명적인 경우 먼저 결정합니다. 이것은 (예, 신선한 작업 주식, 새로운 dilutions) 새로운 시약을 준비하고 체계적으로 반응 혼합물에 한 번에 하나의 새로운 시약을 추가하여 얻을 수 있습니다. 이 프로세스는 실패한 PCR 실험을위한 범죄자였던 시약 결정할 것입니다. 자주 에페 누적 아주 오래된 유전자의 경우, 그것은 소 혈청 알부민의 또한 문제를 완화하는 데 도움이 수 증명되었습니다.
  2. primers는 우선적으로 자기 어닐링이나 반응의 다른 프라이머로 어닐링하면 프라이머의 dimers가 형성될 수 있기 때문이다. 이런 경우 작은미만 100 BP의 제품은 아가로 오스 겔에 나타납니다. 프라이머에 대한 템플릿의 비율을 변경하여 시작, 프라이머 농도는 템플릿 농도 이상의 극단적인 과잉에 있으면 다음 primers는 DNA를 템플릿을 통해 스스로 혹은 서로 어닐링 가능성이 더 높습 될 것입니다. DMSO를 추가 및하거나 뜨거운 시작 열 사이클링 방법을 사용하면 문제를 해결할 수 있습니다. 결국 그것은 새로운 primers를 디자인해야 할 수도 있습니다.
  3. PCR의 엄중 변수 길이와 비 특정 PCR 밴드의 결과로 지나치게 낮은 경우가 아닌 특정 제품이 생산됩니다. 이것은 아가로 오스 겔에 사다리 효과를 생산하고 있습니다. 그런 다음 엄중을 증가하는 PCR 조건을 선택하시는 것이 좋습니다. 게놈 DNA를 증폭하면 다양한 크기의 얼룩은 또한 고도로 반복적인 시퀀스로 설계된 primers에서 비롯될 수도 있습니다. 그러나, 동일한 primers 같은 문제가 발생한없이 플라스미드의 대상 순서를 증폭 있습니다.
  4. PCR 제품의 부족은있을 수있는 반응 조건에 의한 것입니다그것은 너무 엄격한 있습니다. primers 또는 변성 템플릿 DNA의 형성과 프라이머의 dimers 및 머리핀 루프 구조는 또한 PCR 제품의 증폭을 방지할 수 있기 때문에 이러한 분자 원하는 DNA의 대응과베이스 쌍을 더 이상 수도 있습니다.
  5. GC 함량이 분석되지 않은한다면, 그렇게 할 시간입니다. GC 풍부한 영역의 PCR (GC 함량> 60 %) PCR에 가장 큰 도전 중 일부를 이거지. 그러나 어려움을 완화하기 위해 사용되었습니다 많은 첨가제가 없습니다.

8. PCR 시약을 조종

종래의 PCR에 사용되는 시약의 기능을 이해하는 것은 첫째 제일 원하는 제품을 얻는 반응 조건을 변경하는 방법을 결정할 때 중요합니다. 성공은 단순히 MgCl 2, KCl, dNTPs, primers, 템플릿의 DNA, 또는 DNA의 중합 효소의 농도 변화에 의존하고 있습니다. 그러나 이러한 시약의 잘못된 집중 stringenc을 줄이는 가짜 결과를 얻으실 수 있습니다반응 Y. PCR 문제를 해결하면 하나의 시약은 동시에 조작해야합니다. 그러나 조작 시약을 적정하다하는 신중한 수도 있습니다.

  1. 마그네슘 염 MG 2 + (0.5-5.0 mm의 최종 반응 농도)
    내열성의 DNA polymerases는 반응 과정에서 cofactor 역할을하는 마그네슘의 존재를 필요로합니다. 마그네슘 농도를 변경하면 PCR의 엄중에 가장 큰 영향 아마로 조작할 수있는 가장 쉬운 시약 중 하나입니다. 일반적으로 PCR 제품 수율은 MG 2의 큰 농도의 추가로 증가합니다 +. 그러나 MG 2의 농도를 증가 + 또한 DNA의 중합 효소의 특이성과 충실도가 줄어 듭니다. 대부분의 제조 업체의 DNA 중합 효소와 10X PCR 버퍼 용액과 함께 마그네슘 염화 (MgCl 2) 솔루션을 포함합니다. 10 × PCR 버퍼 솔루션은 일반적인 PCR을 위해 충분하다 15 밀리미터 MgCl 2가 포함될 수 있습니다반응, 또는 그것은 특정 반응에 최적화된 농도에서 별도로 추가될 수 있습니다. MG는 2 +는 실제로 반응에 소비되지 않지만 반응은 현 않고 진행할 수 없습니다. 너무 많은 MG 2 +가있을 때, 이중 가닥을 안정화하여 DNA를 템플릿의 완전한 변성을 방지 수 있습니다. 너무 많은 MG 2 + 또한 잘못된 템플릿 사이트 및 바람직하지 않은 PCR 제품의 결과로 감소 특이성에 primers의 어닐링 가짜 안정 수 있습니다. 충분이 없다면 MG 2 + 반응없이 PCR 제품의 결과, 진행되지 않습니다.
  2. 칼륨 염 K + (35-100 mm의 최종 반응 농도)
    종종 DMSO 및 / 또는 글리세롤의 추가와 함께, 정상 50 MM 반응 농도의 칼륨 염 (KCl)을 감소에서 긴 PCR 제품 (10-40킬로바이트) 혜택. 원하는 amplicon 아래 1000 BP 및 긴​​ 아닌 특정 제품이면 specifici가 형성되고타이는 100 밀리미터까지 10 밀리미터 단위로 농도를 증가 KCl을 titrating 향상됩니다. 소금 농도를 높이면 짧은 DNA 분자는 더 이상의 DNA 분자에 우선적으로 변성 것을 허용합니다.
  3. Deoxynucleotide 5'-triphosphates (20와 200 μm의 각각의 최종 반응 농도)
    그들이 적절한 상응하는 농도 (즉, [A] = [T] = [C] = [G]) 및 / 또는 인해 불안정으로 반복에서에 있지 않으면 Deoxynucleotide 5'-triphosphates은 (dNTPs) PCR에 문제를 일으킬 수 동결 융해. 일반적인 dNTP 농도는 네 가지 dNTPs의 각 50 μm의입니다. 그러나 PCR은 20와 200 μm의 각 사이의 농도를 용납하실 수 있습니다. 과도한 dNTP의 농도가 실제로 PCR을 억제시킬 수 있지만 dNTPs의 낮은 농도는 반응 특이성과 충실도를 모두 증가할 수 있습니다. 그러나, 긴 PCR-조각을 위해, 높은 dNTP 농도가 필요할 수 있습니다. dNTP 농도의 큰 변화는 corres 할거 수MG 2의 농도 변화를 ponding +.
  4. 열 안정의 DNA polymerases
    초기 DNA 형성 촉매 장치의 DNA 중합 효소가 처음 사용된 이후 그 효소와 연관된 PCR 효소와 버퍼는 먼 길을 왔습니다. 따라서 적절한 효소를 선택하면 원하는 amplicon 제품을 얻기위한 도움이 될 수 있습니다. processivity 및 / 또는 PCR 제품의 3 '엔드에 아데닌 잔기의 추가가 필요한 경우에는 예를 들어 DNA 형성 촉매 장치의 DNA 중합 효소의 사용은 Pfu DNA의 중합 효소보다 우선적 수 있습니다. 3 또한 thymine의 overhangs '아데닌 3 성령 강림 대축일 TA 벡터에 클로닝 PCR 제품에 대한 유용한 전략이되었다'를 선택하십시오. 정절이 더 중요한 경우 단, Pfu와 같은 효소가 더 나은 선택이 될 수 있습니다. 몇몇은 특별한 요구용으로 설계된 특정의 DNA polymerases의 배열을 가지고 생산하고 있습니다. 반응 조건과 원하는 amplicon의 특성을 한 번 봐, 다음 적절한 DNA를 P와 PCR 실험을 일치olymerase. 대부분의 제조 테이블을 가지고 그러한 충성심, 이윤율, 속도, 최적의 대상 길이, 그리고 GC 풍부한 증폭 또는 핫 시작 PCR에 유용 여부와 같은리스트 특성에 의한 원조의 DNA 중합 효소의 선택.
  5. 템플릿의 DNA
    DNA의 품질과 순도는 성공적인 PCR 실험의 가능성에 상당한 영향을 미칠 것입니다. DNA와 RNA의 농도는 260 nm의 (OD 260)에서 자신의 광학 밀도 측정을 사용하여 결정하실 수 있습니다. 솔루션에서 핵산을 정제의 질량은 50 μg / 더블 좌초된 DNA의 ML 또는 40 RNA 또는 OD 260에서 단일 좌초된 DNA = 1.0 중 하나에 해당하는 μg / ML로 계산됩니다. DNA를 추출 오염 물질은 PCR의 일반적인 저해제이며 신중하게 피해야한다. PCR의 일반적인 DNA 추출 억제제는 단백질, RNA, 유기 용제 및 세제를 포함합니다. 핵산 OD 260의 최대 흡수를 사용하면 단백질 OD280 (OD 280분의 260)의 비교, 그건 determin 수 있습니다추출된 DNA의 순도의 전자 견적. 이상적으로, OD 280분의 260의 비율이 1.8과 2.0 사이입니다. 낮은 OD 280분의 260 단백질 및 / 또는 아마도, PCR에 대한 문제가 될 것이며, 용매 오염을 나타내는 것입니다.
    템플릿 DNA, DNA의 수량의 최적화의 품질 이외에 크게 PCR 실험의 결과에 도움이됩니다. 그것은 종종 현대 nanospectrophotometers에 대한 출력 / NG μl에서 수량을 결정하는 것이 편리하지만, 성공적인 PCR 실험을위한 관련 단위는 분자의 개수입니다. 그것은 PCR의 primers로 보완 시퀀스를 포함하고 얼마나 많은 DNA를 템플릿의 복사본이다? 최적 표적 분자 10월 7일부터 10월 4일까지 사이의 분자 이상 노트에서 설명되었다로 계산됩니다.

9. 첨가제 시약

다른 모두가 실패할 때 첨가제 시약은 결과를 얻을 수 있습니다. 시약의 이해과 그들이 사용되는 것은 시약 원하는 PCR 제품의 인수에 가장 효과적 일지 모르지만, 결정하는 것이 중요합니다. 반응에 시약을 추가 하나 시약의 조작은 다른 시약의 사용 가능한 농도에 영향을 미칠 수있다는 사실에 의해 복잡하게된다. 아래에 나열된 시약 이외에 독점 시판 첨가제 많은 생명 공학 회사에서 사용할 수 있습니다.

10. GC 풍부한 템플릿 혜택 첨가제

  1. Dimethylsulfoxide (1-10%의 DMSO의 최종 반응 농도)
    템플릿의 DNA 특히 DMSO는 기본 페어링을 방해하고 효과적으로 T m을 낮추는 방법으로 반응을 향상시킬 수 있습니다 추가 GC 풍부한 (GC 함량> 60 %),되는 PCR 실험합니다. 일부 T 미터 계산기는 PCR 실험에서 원하는 DMSO의 농도를 추가하기위한 변수 항목을 포함합니다. 그러나, 이상의 2 % DMSO를 추가하는 것은 그것이 귀신 이래로 더 많은 DNA를 중합 효소를 추가 요구할 수 있습니다DNA 형성 촉매 장치의 DNA 중합 효소를 억제하는 strated.
  2. 포름 아미드 (1.25-10 %의 최종 반응 농도)
    덜 불특정 프라이밍 및 증가 증폭 효율에 결과 어닐링 프라이머의 엄중을 증가하면서 DMSO와 마찬가지로 포름 아미드는 기본 페어링을 방해. 포름 아미드는 GC 풍부한 템플릿 향상제 것으로 표시되었습니다.
  3. 7-deaza-2'-deoxyguanosine 5'-triphosphate (DC 7 GTP의 최종 반응 농도, 3 DC 7 GTP : 1 dGTP 50 μm의)
    한 부분, 또는 12.5 μm의와 함께 구아 노신 기지 아날로그 DC 7 GTP의 3 부분, 또는 37.5 μm의를 사용하여, dGTP이 제품에 이차 구조 형성을 불안정하게됩니다. amplicon 또는 템플릿의 DNA가 변성이기 때문에, 그것은 종종 같은 머리 핀의 자형 고리와 같은 이차 구조를 형성합니다. DNA의 amplicon에 DC 7 GTP의 설립은 이러한 탈선 구조의 형성을 금지합니다.

참고 :

7 GTP은 그것이 dGTP와 3시 1분 비율에 사용되는 이유입니다 ethidium의 브로마이드 염색법의 신호를 attenuates.

  1. 베타인 (2.5M로 0.5M의 최종 반응 농도)
    베타인 (N, N, N-trimethylglycine)은 감소하고 심지어 염기 조성에 DNA를 용해 온도 의존도를 없앨 수 있습니다 zwitterionic 아미노산 아날로그입니다. 이것은 GC 풍부한 대상의 PCR 증폭들을위한 첨가제로 사용됩니다. 베타인는 종종 DMSO와 함께 근무하고 있으며 크게 높은 GC 함량과 확장 대상 DNA의 가능성을 향상시킬 수 있습니다.

11. 억제제의 면전에서 PCR 도움말 첨가제

  1. 비 이온 세제는 이차 구조 형성을 억제하고 DNA를 중합 효소 안정화를 돕기 위해 기능을 수행합니다. 이러한 트리톤 X-100, 십대 초반 20, 또는 NP-40과 같은 비 이온 세제는 amplicon의 생산을 증가하기 위해서는 0.1-1 %의 반응 농도에서 사용될 수 있습니다. 그러나 concentr1퍼센트 위의 ations은 PCR로 억제 수도 있습니다. 비 이온 세제의 존재는 잠재적으로 가짜 제품 형성으로 이어지는, PCR의 엄중을 감소시킵니다. 그러나 그들이 사용도 억제가 SDS, DNA를 추출 프로토콜 가끔 오염 물질의 영향을 중화시킬 것입니다.
  2. 과 같은 특정 단백질의 추가 소의 혈청 알부민 (BSA) 등 FeCl 3, hemin, fulvic 산성, 후민산 등 억제제의 존재의 150 μl / NG 원조 PCR에서 400 μl / NG 및 / 또는 T4 유전자 32 단백질에 사용 타닌 성의 산, 또는 대변, 신선한 물, 해양 물에서 추출합니다. 그러나 담즙 염, 빌리루빈, EDTA (에틸렌 다이아 민 테트라 초산), NaCl, SDS, 또는 트리톤 X-100, 등 일부 PCR 억제제는 BSA 또는 T4 유전자 32 단백질 중의 추가에 의해 완화되지 않습니다.

12. 사이클링 조건에 대한 수정

  1. 어닐링 온도를 최적화하면 모든 PCR 반응을 향상시키는 등의 첨가제 및 / 또는 기타 MO와 함께 함께 고려되어야 사이클링 사정에 difications. 따라서, 최적 소둔 온도를 계산하기 위해 다음의 등식이 고용됩니다 :
    T OPT = 0.3 T 미터 프라이머 + 0.7 T m 제품 -14.9
    T 미터 프라이머는 방정식을 사용하여 덜 안정 쌍의 T의 m과 같이 계산됩니다 :
    T 미터 프라이머 = ((ΔH / (ΔS + R X 에선 (C / 4))) -273.15 + 16.6 로그 [K +] 어디 ΔH는 하이브리드에 대한 가장 가까운 이웃 엔탈피 변화의 합계이며 ΔS가의 합계이다 가까운 이웃 엔트로피 변화, C는 프라이머 농도이며, R은 상수 가스 (1.99 칼 K-1 몰-1)이며, [K +] 칼륨 농도입니다.
    후자의 방정식은 다음 웹사이트에 나와있는 T 미터 계산기 중 하나를 사용하여 계산할 수 있습니다 :
    RS / 용해 / sup_mat / servers_list.html "대상 ="_blank "> http://protein.bio.puc.cl/cardex/servers/melting/sup_mat/servers_list.html
    T m 제품은 다음과 같이 계산됩니다 :
    T 미터 제품 = 0.41 (% GC) + 16.6 로그 [K +] - 675/product 길이
    대부분의 PCR 반응의 경우 칼륨의 농도 ([K +]가) 50 MM 될 것입니다.
  2. 핫 시작 PCR은 초기 변성 시간이 (표 4) 급격하게 증가되는 다양한 변형입니다. 이 수정은 함께 또는 사이클링 조건에 다른 수정없이 포함될 수 있습니다. 더욱이, 그것은 종종 신경질 amplicon 형성을위한 첨가제와 함께 사용됩니다. 사실, 핫 시작 PCR은 점차 일반 자전거 조건 정기 측면으로 포함됩니다. 뜨거운 시작은 반응의 특이성과 충실도 증가하면서 amplicon 수율을 증가 입증되었습니다.핫 시작 PCR 뒤에 근거는 T m 아래의 반응이 설정의 결과로 발생할 수 있습니다 입문서 - 이합체 및 비 특정 마중물을 제거하는 것입니다. 따라서, 전형적인 핫 스타트 반응은 적어도 어떤 증폭이 발생할 수 ° C ~ 전에 60, 최적의 T m 이상의 온도에 샘플을 가열. 일반적으로 DNA의 중합 효소는 초기, 길쭉한, denaturing 시간 동안 반응에서 원천 징수됩니다. 반응의 다른 구성 요소가 때로는 DNA의 중합 효소 대신에 생략되어 있지만, 여기서 우리는 DNA의 중합 효소에 초점을 것입니다. 의 DNA 중합 효소가 비활성 또는 초기 변성 기간이 완료될 때까지 육체적으로 고체 왁스 장벽, 안티 DNA 중합 효소의 항체 및 액세서리 단백질의 사용을 포함하여 분리 남아 있도록 여러 가지 방법이 있습니다. 초기 변성주기가 완료된 후 또는 DNA의 중합 효소는 단순히 반응에 추가할 수 있습니다.
  3. 터치다운 PCR (TD-PCR)은입니다추측 일부 bracketing 계산 어닐링 온도에 의해 T 미터 계산 제한 해결 걸릴들입니다. 개념은 사이클링 조건의 두 단계 (표 5)를 설계하는 것입니다. 첫 단계는 ° C 이상의 10에서 시작하며 계산된 T m에서 마무리하거나 약간 아래 낮은 어닐링 온도에에게 연속 매초마다 사이클을 (전통적으로 1.0 ° C) 고용합니다. 2 단계는 어닐링 온도가 5 시에 설정과 표준 3 단계 조건을 활용 ° C에서 다른 20-25주기위한 계산된 T의 m 아래에. 첫 단계의 함수는 올바른 제품으로 4 배 혜택을 부여, mispriming을 경감한다. 따라서, 10 사이클 후, 410 배 장점은 어떠한 가짜 마중물을 통해 올바른 제품의 4,096 복사본을 얻을 것입니다.
    • Stepdown PCR은 마중물의 첫 단계에서보다 적은 단위로 TD-PCR과 유사합니다. 예를 들어, 첫 번째 단계는 어닐링 온도마다을 절감3 ° C에 의해 두번째 사이클은 ° C 이상 10 시에 시작하며 ° C에서 계산된 T m 아래 2 시에 마무리. TD-PCR과 마찬가지로, 2 단계는 어닐링 온도가 5 시에 설정과 표준 3 단계 조건을 활용 ° C에서 다른 20-25주기위한 계산된 T m 아래에. 이것은 올바른 제품가 거짓 마중물 제품에 비해 256 배 활용을 허용합니다.
    • 침체 PCR은 단순히 TD-PCR의 수정은 매우 풍부한 GC (위 83%) 시퀀스 (표 6) 증폭을위한 성공을 거두었습니다. 개념은 고려 램프 속도 조절뿐만 아니라 냉각 속도를 허용 현대 열 cyclers과 관련된 비교적 새로운 기능이 걸립니다. 프로토콜은 또한 반응을 막는 2 ° 구조 형성을 줄이기 위해 DC 7 GTP을 활용합니다. 램프 속도 2.5 져서 ° 소둔 사이클에 대해 1.5 ° C의 -1의 냉각 속도와 C의 -1. 첫 번째 단계로 시작70 ° C의 온도를 nealing하고하면 1 어닐링 온도를 감소 ° C에서 매 3 라운드가 58에 도달할 때까지 ° C. 두 번째 단계는 다음 추가 15주기위한 58 ° C의 소둔 온도를 계속합니다.
  4. 중첩된 PCR은 가짜 제품을 제거하는 데 사용되는 강력한 도구입니다. 단일 게놈의 여러 paralogous 유전자가거나 대상 시퀀스의 낮은 사본 번호가 orthologous 시퀀스의 이기종 인구 이내에있을 때 중첩된 primers의 사용은 특히 유용합니다. 기본 과정은 DNA의 단일 영역을 증폭 primers 두 세트를 포함합니다. 외부 primers 관심의 세그먼트를 두 다리로 버티기 종종 불특정 20-30 사이클의 위치 PCR 제품을 생성하는 데 사용됩니다. 작은 나누어지는, 처음 50 μl 반응에서 일반적으로 약 5 μl은 다음 내부 위치 친척에​​게 어닐링 primers의 두 번째 세트를 사용하여 증폭의 다른 20-30 순찰을 위해 템플릿의 DNA로 사용됩니다첫 번째 세트까지.

기타 PCR 프로토콜은보다 전문 있으며이 문서의 범위를 넘어. 예를 들면 인종 PCR, 멀티 플렉스-PCR, Vectorette-PCR, 양적-PCR 및 RT-PCR을 포함합니다.

13. 대표 결과

대표 PCR 결과는 기본적인 PCR 프로토콜은 위에서 설명한 다음에 의해 생성되었다. 결과는 반응을 다양한 시약 및 조건의 효과를 입증하기 위해 여러 가지 문제 해결 전략을 통합합니다. 신진 효모 Saccharomyces cerevisiae의 사용과 uncharacterized Mycobacteriophage의 유전자는이 실험에서 증폭되었다. 표 2에 제시된 표준 3 단계 PCR 프로토콜은 아래에서 설명하는 세 가지 실험을 위해 고용되었다.

S. 모두로부터 PCR 실험, 게놈 DNA를 설정하기 전에 cerevisiae와 Mycobacteriophage는 거예요 allo 농도에 계량 및 희석되었다반응 당 DNA의 w 7 4 10 ~ 10 분자. 작업 주식은 다음과 같이 준비되었습니다. 게놈 효모의 DNA 준비 μl / 10 4 NG 굴복. 10 NG / μl에 희석은 TE의 pH는 8.0 버퍼 452 μl에 48 μl를 추가하여 생성되었다. S. 이후 cerevisiae의 게놈 12.5 MB, NG는 7.41 X 10 5 분자를 포함하는 10 일로이다. 게놈 Mycobacteriophage의 DNA의 준비 313 NG / μl이 나왔고. 이 NG / μl에 희석은 TE의 pH는 8.0 버퍼의 993.6 μl로 6.4 μl를 추가하여 생성되었다. 이 파지의 DNA가 67 KB에 관한 것입니다. 따라서, 1 NG는 일반적으로 PCR에 사용되는 DNA의 상한에 있습니다 2.73 X 10 7 분자를 포함합니다. 작업 주식 그런 다음 표 7에 제시된 마스터 믹스 솔루션을 생성하는 데 사용되었습니다. 아래에 설명된대로 실험 사이클링 조건을 다양.

S.에서 그림 3A에서 게놈 DNA를 cerevisiae는 증폭하기 위해 템플릿으로 사용되었다갈락토 오스 대사에 관여하는 단백질을 암호화 GAL3 유전자. 이 실험의 목표는 시약의 집합에 대한 최적의 MG 2 + 농도를 결정하는 것이었습니다. 아무 MgCl 2는 원래 PCR 버퍼에 존재 없었다과 0.0 밀리미터에서 5.0 밀리미터로 시험 범위 표시 농도에서 보충해야했습니다. 다른 이름으로 그림과 같이 예상된 크기 (2,098 BP)의 PCR 제품은 MG이 4.0에서 최적의 농도로 2.5 mm의 + 농도 (레인 6) MM (레인 9)에서 시작 나타납니다. 제조 업체에서 제공하는 권장 농도는 일반적인 PCR 버퍼에 제공된 금액 1.5 밀리미터였다. 아마도 놀랍게도,이 실험의 제품 형성에 필요한 필요한 농도는이 금액을 초과했습니다.

다른 DNA를 템플릿 그림 3B에 제시된 실험을 위해 사용되었다. Mycobacteriophage에서 게놈 DNA가 보존되어 566 BP의 DNA 세그먼트를 증폭하는 데 사용되었다.이전 실험과 마찬가지로, 최적의 MG 2 + 농도는 결정했다. 다른 이름으로 그림 3B와 같이 원하는 PCR 제품의 증폭은 최소 2.0 밀리미터이 필요 MG 2 + (레인 5). MgCl 2의 농도를 증가에서 형성된 제품의 양을 더 많은 다양성이있다지만, 대부분의 PCR 제품은 4 밀리미터에서 관찰되었다 MG 2 + (레인 9), 효모 GAL3 유전자에 대한 관찰 같은 농도.

인물 3A 및 3B에 제시된 실험에서, 이산 밴드가 뇌관 어닐링 온도를 기반으로 최적의 것으로 생각 사이클링 조건을 사용하여 얻은 것을 확인할 수 있습니다. 특히, 변성 온도 61 ° C의 소둔 온도 95 ° C이었고, 확장 72시 1 분 진행되었습니다 ° C를 30 사이클. 마지막 5 분 연장 그러면 72에서 이루어졌다 ° C. 그림 3C에 표시 세번째 실험 그림 3C에 나타난 바와 같이, 그림 3A의 이산 밴드 뭔데이 하위 최적의 사이클링 조건에서 비 특정 제품의 얼룩이된다. 또한 감소 반응의 전체 엄중 함께 MG 2의 낮은 금액 + amplicon을 형성하는 데 필요합니다.

세 실험 MG 2 +의 농도가 너무 낮은 경우, 아무 amplicon 생산 없다는 것을 보여줍니다. 이러한 결과는 또한 보여주는 그 때 자전거 조건을 모두올바르게 설계 및 시약 최적 농도에 있습니다, PCR 실험은 예상 크기에 해당하는 신중한 amplicon을 생산하고 있습니다. 결과는 충분히 높은 엄중 (비방 대 예를 들어, 신중한 밴드)에서 PCR 실험을 수행의 중요성을 보여줍니다. 또한, 실험을 한 매개 변수를 변경하면 따라서 반응 결과에 영향을 미치는 다른 변수에 영향을 미칠 수있다는 것을 나타냅니다.

시약 주식 솔루션의 농도 음량 13X **
마스터 믹스
최종 농도
멸균 H 2 O 50 μl로 QS 650 μl의 QS
PCR 버퍼 10X 5 μl 65 μl 1X
dNTP의 10 MM 1 μl 13 μl 200 μm의
MgCl 2 25 MM 3 μl 39 μl 1.5 MM
앞으로 프라이머 20 μm의 = 20 pmol / μl 1 μl 13 μl 20 pmol
프라이머를 바꾸게되면 20 μm의 = 20 pmol / μl 1 μl 13 μl 20 pmol
템플릿의 DNA 변수 변수 변수 ~ 10 5 분자
DNA 형성 촉매 장치의 DNA 중합 효소 5 단위 / μl * 0.5 μl μl 6.5 2.5 단위
50 μl / 반응

순서 표 1. PCR의 시약들은이 추가되어야합니다.

* 단위 제조 업체 사이에 차이가있을 수 있습니다

** 적정 필요로 하나 또는 그 반응에 변수가 될 수 있습니다 제외한 마스터 믹스에 모든 시약을 추가합니다. 위의 테이블에 묘사된 마스터 믹스는 각 반응 튜브로 나누어지는 충분히있다 확보 피펫 전송 손실을 수용하기 위해 11 반응 플러스 2 개의 엑스트라 반응에 대해 계산됩니다.

표준 3 단계 PCR 사이클링
사이클 단계 온도 시간 사이클 수
초기 변성 94 ° C ~ 98 ° C 일분
변성
가열 냉각
확장
94 ° C
5 ° C - T m 이하
70 ° C 80 ° C
10-60초
삼십초
의존 Amplicon와 DNA 중합 효소
25-35
결승전 연장 70 & D예를 들어, C 80 ° C 오분
* 잡아 4 ° C

표 2. 표준 3 단계 PCR의 사이클링.

* 대부분의 열 cyclers는 ° C에서 무기한주기의 끝에 4에 일시 중지 기능이 있습니다.

70 ° C 80 ° C
2 단계 PCR 사이클링
사이클 단계 온도 시간 사이클 수
초기 변성 94 ° C ~ 98 ° C 일분
변성
/ 확장 풀림
10-60초
의존 Amplicon와 DNA 중합 효소
25-35
결승전 연장 70 ° C 80 ° C 오분

표 3. 2 단계 PCR의 사이클링.

핫 스타트 PCR 사이클링
사이클 단계 온도 시간 사이클
초기 변성 60 ° - 95 ° C에서 C 오분 후의 DNA 중합 효소를 추가
변성
가열 냉각
확장
94 ° C
5 ° C - T m 이하
70 ° C 80 ° C
10-60초
삼십초
의존 Amplicon와 DNA 중합 효소
25-35
결승전 연장 70 ° C 80 ° C 오분

표 4. 핫 스타트 PCR의 사이클링.

터치다운 PCR 사이클링
사이클 단계 온도 시간 사이클
초기 변성 94 ° C ~ 98 ° C
변성
가열 냉각
확장
94 ° C
X = 10 ° C에서 T m 이상
70 ° C 80 ° C
10-60초
삼십초
의존 Amplicon와 DNA 중합 효소
2
변성
가열 냉각


확장
94 ° C
X-1 ° C 감소 1 ° C 걸러주기
70 ° C 80 ° C
10-60초
삼십초
Amplicon 및 의존 효소
28
변성
가열 냉각
확장 94 ° C
5 ° C - T m 이하
70 ° C 80 ° C
10-60초
삼십초
의존 Amplicon와 DNA 중합 효소
20-25
결승전 연장 70 ° C 80 ° C 오분

표 5. 터치다운 PCR 사이클링.

침체 PCR 사이클링
사이클 단계 TEMperature 시간 사이클
초기 변성 94 ° C ~ 98 ° C 일분
변성
가열 냉각
확장
94 ° C
X ° C = 10 ° C에서 T m 이상
70 ° C 80 ° C
10-60초
삼십초
Amplicon 및 의존 효소
2
변성
가열 냉각


확장
94 ° C
X-1 ° C 감소 1 ° C 걸러주기
70 ° C 80 ° C *
10-60초
삼십초
mplicon 및 의존 효소
28
변성
가열 냉각
확장
94 ° C
5 ° C - T m 이하
70 ° C 80 ° C
10-60초
삼십초
Amplicon 및 의존 효소
20-25
결승전 연장 70 ° C 80 ° C 오분

표 6. 천천히 PCR 사이클링.

* 침체 PCR의 경우 램프 속도는 2.5 져서 ° 어닐링주기위한 1.5 ° C의 -1의 냉각 속도와 C의 -1.에게

증권 솔루션 볼륨 50 μl 반응에 추가 13 X 효모 마스터 믹스 13 X 파지 마스터 믹스 최종 농도
멸균 H 2 O 50 μl로 QS = 31 μl 또는 30.5 QS 650 μl로 = 396.5 520 μl = 403 μl에 QS
PCR 버퍼 10X 5 μl 65 μl 65 μl 1X
10 MM 1 μl 13 μl 13 μl 200 μm의
MgCl 2 적정 각 반응에 추가 각 반응에 추가 각 반응에 추가 적정을 참조 변수
앞으로 프라이머 20 μm의 = 20 pmol / μl 1 μl 13 μl 13 μl 20 pmol
프라이머를 바꾸게되면 20 μm의 = 20 pmol / μl 1 μl 13 μl 13 μl 20 pmol
템플릿의 DNA 2 μl / NG 파지 또는 10 μl / NG 효모 0.5 μl 파지 또는 1 μl 효모 μl 6.5 13 μl ~ 10 7 분자 파지거나 ~ 10 5 분자 효모
중합 효소 0.5 단위 / μl ** 0.5 μl μl 6.5 μl 6.5 0.5 단위 / 반응
40 μl + 10 (적정) μl / 반응 적정
[MgCl 2] 0.00 MM 0.5 MM 1.0 MM 1.5mM 2.0 MM 2.5 MM 3.0 MM 3.5 MM 4.0 MM 4.5 MM 5.0 MM
MgCl 2 0.00 μl 1.00 μl 2.00 μl 3.0 μl 4.00 μl 5.00 μl 6.00 μl 7.00 μl 8.00 μl 9.00 μl 10.00 μl
H 2 O 10.00 μl 9.00 μl 8.00 μl 7.00 μl 6.00 μl 5.00 μl 4.00 μl 3.00 μl 2.00 μl 1.00 μl 0.00 μl

<strong>을 표 7. MG 2의 적정 + 그림 3에 사용됩니다.

그림 1
그림 1. primers와 타겟 DNA의 3 단계 PCR 증폭과 함께 발생하는 일반적인 문제. () 보조 머리핀 루프 구조의 형성으로 인한 primers 자체 풀림. primers 항상 극단 끝에 어닐링하지 않으며 작은 루프 구조를 형성할 수 있습니다. (B) 프라이머 프라이머의 dimers를 만들어, 오히려 DNA를 템플릿보다 서로 풀림. primers 서로 어닐링하면 그들은 프라이머 종료로 길어지다됩니다. (다) PCR 사이클은 특정 amplicon을 생성. 표준 3 단계 PCR 자전거는 템플릿의 DNA 변성, primers의 어닐링하고, DNA를 중합 효소에 의한 대상의 DNA (ampl​​icon)의 확장자를 포함합니다.

그림 2
reag과 그림 2. 아이스 버킷엔트, pipettes, 그리고 랙은 PCR을 위해 필요합니다. (1.) P-200 피펫, (2.) P-1000 피펫, (3.) P-20 피펫 (4.) P-10 피펫, (5). 96 잘 판은 0.2 ML 얇은 벽으로 둘러싸인 PCR 튜브 , DNA 형성 촉매 효소, 10X PCR 버퍼, MgCl 2, 멸균 물, dNTPs, primers, 그리고 템플릿 DNA, (7.) 1.8 ML 튜브 및 랙 포함한 (6.) 시약.

그림 3
그림 3. 표준 3 단계 PCR 프로토콜을 사용하여 PCR 실험을 최적화하는 데 사용 MG 2 + titrations의 예. () S. cerevisiae 효모의 게놈의 DNA가 2,098 BP GAL3 유전자를 증폭하기위한 템플릿으로 사용되었다. 에서 차선 1-6, MG 2 + 농도가 너무 낮은 곳에 중 어떤 제품이 형성 (차선 1-5) 또는 매우 적은 제품 (레인 6) 형성 없습니다. 레인 7 - 2098 BP의 amplicon 제품의 존재에 표시된대로 11 + 본 PCR 실험을위한 MG 2의 최적 농도를 나타냅니다. (B) uncharacteri데이빗 mycobacteriophage의 게놈의 DNA 템플릿이 566 BP의 amplicon을 증폭하는 데 사용되었다. 레인 1-4은 MG 2 + 농도는 제품의 부재로 표시, 너무 낮습니다. 레인 5-11은 5백66킬로바이트의 amplicon 제품의 존재로 표시 +이 PCR을 위해 MG 2의 최적 농도를 나타냅니다. (다). S. cerevisiae 효모의 게놈의 DNA가 패널에 표시된대로 2,098 BP GAL3 유전자를 증폭하기위한 템플릿으로 사용되었다. 그러나 어닐링 온도가 58에 61 ° C에서 감소되었다 ° C, 아가로 오스 겔에 번짐 효과를 생산하는 가변 길이와 비 특정 PCR 밴드가 발생. 레인 1-4, MG 2 + 농도가 너무 낮은 곳에, 어떤 제품이 없다는 형성했다. 레인 5-8은 2,098킬로바이트의 amplicon 제품의 크기 주위 비방과 밴드의 존재로 바라보는 +이 PCR을위한 MG 2의 최적 농도를 나타냅니다. 레인 9-11가 형성없이 제품에 지나치게 엄격한 조건을 나타내는입니다. (AC) 레인 12 negati입니다모든 템플릿 DNA를 포함하지 않은 컨트롤이 있어요. 레인 M (마커)이 코 1킬로바이트 사다리 장전되어 있었어.

그림 4
4 그림. PCR에 사용되는 무균 튜브. (1.) 1.8 ML 튜브 (2.) 0.2 ML 개별 얇은 벽으로 둘러싸인 PCR 튜브, (3.) 0.2 ML 스트립 얇은 벽으로 둘러싸인 PCR 튜브와 모자.

그림 5
그림 5. 열전달 자전거 타는 사람. 자전거 타는 사람 열 왼쪽 이미지를 마감했다. 오른쪽 이미지는 오픈 열 자전거 타는 사람의 가열 블록에 배치 0.2 ML 얇은 벽으로 둘러싸인 PCR 튜브가 포함되어 있습니다.

Discussion

PCR은 생물 학적 과학 병기의 indispensible 도구가되었습니다. PCR은 genomes과 다양성뿐만 아니라, 더욱 생화 학적 분석을 위해 간단하게 복제 유전자에 대한 통찰력을 얻고, 구체적이고 정확한 임상 테스트를 수 있도록 생물학 자들이 genomes을 통해 권력을 양보하고, 새로운 기능과 하이브리드 유전자를 만들 수 있도록 과학의 진로를 변경했다. PCR 응용 프로그램은 자사의 강력한 힘을 가졌 과학자의 상상력에 의해 제한됩니다. 이 PCR의 새로운 특수 용도를 설명하는 많은 서적과 논문이 있으며, 많은는 생물 학적 과학의 차세대 걸쳐 개발됩니다. 그러나 관계없이 예상 접근법, 기본 프레임 워크는 동일 남아있다. PCR은 모든 과대에 DNA가 특정 세그먼트의 대량 생성의 체외 응용 프로그램입니다.

PCR 실험을 설계하는 것은 사상과 인내가 필요합니다. 그림 3에 표시된 결과는 주요 채널 중 하나를 예시PCR을위한 최적화 전략을 디자인할 때 allenges. PCR 중 하나가 매개 변수가 변경되면 그것은, 그것은 또 다른 영향을 미칠 수 있습니다. 초기 PCR은 최적의 MG이 2.0 mm의 + 농도와 하위 최적 어닐링 온도 (58 ° C)에서 실시되었다 경우 예를 들어, 다음, 결과는 그림 3C에서 볼로 얼룩을 생산합니다. 얼룩을 해결하기위한 시도가 2.0 밀리미터 MgCl 2를 포함하는 반응과 PCR 조건을 설정하고 61 ° C.로 어닐링 온도를 조정 관련 됐을지도 몰라요 그러나, 같은 그림 3A에서 본,이 모든 제품을 얻을 수없는 것이다. 따라서, 그것은 오히려 가짜 결과를 해결할 때, 단일 반응을 한 농도를 추가하는 것보다, 시약을 적정하다 것이 좋습니다. 또한, PCR 실험을 최적화하는 데 필요한 가장 일반적인 조정 MG 2 + 농도를 변경하고 어닐링 온도를 수정하는 것입니다. 그러나 이러한 변화는 최소화하거나 탈선 결과를 폐기하다, additi의 적정하지 않을 경우ves 및 / 또는 같은 표 2-6에 설명된 사이클링 조건 프로토콜을 변경하는 문제를 줄일 수 있습니다. 다른 모든 실패하면 primers를 다시 디자인하고 시도 다시 시도하십시오.

Disclosures

나는 공개 할게 없다.

Acknowledgments

시약을 설정 및 젤류를 따르고하고 UCLA의 에린 샌더스에 영감,지도 및 지원을하고 원고를 교정을위한 UCLA의 크리스 Reddi에 대한 특별 감사합니다. 나는 또한 GAL3 유전자를 증폭하기 위해 효모 게놈의 DNA와 primers를 공급을위한 감사 Giancarlo Costaguta과 그레고리 S. 페인에게 싶습니다. 4 - 나는 또한 실험실 장비 및 숫자 2를 만들기 위해 사용되는 시약의 사진을내어 Bhairav​​의 샤 감사드립니다. 이 프로젝트에 대한 자금 지원은 HHMI (HHMI 그랜트 번호 52006944)에 의해 제공되었다.

Materials

Name Company Catalog Number Comments
Taq Polymeras Sigma-Aldrich D4545-25UN
dNTPs Qiagen 201225
0.2 ml Thin Wall Tubes PCR tubes Bio-Rad 223-9469
0.2 ml Thin Wall Tube caps Bio-Rad 223-9472
EDTA disodium salt dihydrate Sigma-Aldrich E5134
Trizma-HCl Sigma-Aldrich T-3253
Custom Phage Primer Invitrogen 25441F_RL6_Contig2_68k TACTGCAACGCGATGTTGCG
Custom Phage Primer Invitrogen 26007R_RL6_ Contig2_68k TCACCATCAATCGTGGCGGT
Custom Yeast Primer Integrated DNA Technologies SacI-Gal3(-256) ACCTGGAGCTCCTATTT TAACATGTGGATTTCTTGAAAGAATGAAATCG
Custom Yeast Primer Integrated DNA Technologies Gal3(1848)-SacI CGGATGGAGCTCGCGT GAAGGTAATTTTTTTTTATGTCTCCG
Thermal Cycler Bio-Rad 170-9703 My Cycler
Agarose ISC BioExpress E-3120-500
Gel electrophoresis Hoeffer Scientific Instruments Model HE33
1 kb DNA Ladder New England Biolabs N3232S
Bio Rad Power Pack Bio-Rad 164-5050 PowerPac Basic
Gel Doc system Fotodyne Incorporated FOTO/Analyst Investigator FX Workstation

DOWNLOAD MATERIALS LIST

References

  1. Albert, J., Fenyo, E. M. Simple sensitive, and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers. J. Clin. Microbiol. 28, 1560-1564 (1990).
  2. Baskaran, N., et al. Uniform amplification of a mixture of deoxyribonucleic acids with varying GC content. Genome Res. 6, 633-638 (1996).
  3. Blanchard, M. M., Taillon-Miller, P., Nowotny, P., Nowotny, V. PCR buffer optimization with uniform temperature regimen to facilitate automation. PCR Methods Appl. 2, 234-240 (1993).
  4. Borer, P. N., Dengler, B., Tinoco, I. Jr, Uhlenbeck, O. C. Stability of ribonucleic acid double-stranded helices. J. Mol. Biol. 86, 843-853 (1974).
  5. Breslauer, K. J., Frank, R., Blocker, H., Marky, L. A. Predicting DNA duplex stability from the base sequence. Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750 (1986).
  6. Chou, Q., Russell, M., Birch, D. E., Raymond, J., Bloch, W. Prevention of pre-PCR mis-priming and primer dimerization improves low-copy-number amplifications. Nucleic Acids Res. 20, 1717-1723 (1992).
  7. Coleman, W. B., Tsongalis, G. J. Diagnostics for the clinical laboration. Humana Press. (2005).
  8. D'Aquila, R. T., et al. Maximizing sensitivity and specificity of PCR by pre-amplification heating. Nucleic Acids Res. 19, 3749 (1991).
  9. Dieffenbach, C. W., Lowe, T. M., Dveksler, G. S. General concepts for PCR primer design. PCR Methods Appl. 3, S30-S37 (1993).
  10. Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K., Mattick, J. S. 'Touchdown' PCR to circumvent spurious priming during gene amplification. Nucleic Acids Res. 19, 4008 (1991).
  11. Erlich, H. A., Gelfand, D., Sninsky, J. J. Recent advances in the polymerase chain reaction. Science. 252, 1643-1651 (1991).
  12. Frey, U. H., Bachmann, H. S., Peters, J., Siffert, W. PCR-amplification of GC-rich regions: 'slowdown PCR. Nat. Protoc. 3, 1312-1317 (2008).
  13. Haqqi, T. M., Sarkar, G., David, C. S., Sommer, S. S. Specific amplification with PCR of a refractory segment of genomic DNA. Nucleic Acids Res. 16, 11844 (1988).
  14. Henke, W., Herdel, K., Jung, K., Schnorr, D., Loening, S. A. Betaine improves the PCR amplification of GC-rich DNA sequences. Nucleic Acids Res. 25, 3957-3958 (1997).
  15. Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T. J. PCR Protocols: A guide to methods and applications. Academic Press, Inc. San Diego. (1990).
  16. King, N. Methods in Molecular Biology. 630, Humana Press. (2010).
  17. Kleppe, K., Ohtsuka, E., Kleppe, R., Molineux, I., Khorana, H. G. Studies on polynucleotides. XCVI. Repair replications of short synthetic DNA's as catalyzed by DNA polymerases. J. Mol. Biol. 56, 341-361 (1971).
  18. Korbie, D. J., Mattick, J. S. Touchdown PCR for increased specificity and sensitivity in PCR amplification. Nat. Protoc. 3, 1452-1456 (2008).
  19. Kramer, M. F., Coen, D. M. Enzymatic amplification of DNA by PCR: standard procedures and optimization. Curr. Protoc. Toxicol. Appendix 3, 1-14 (2001).
  20. Kramer, M. F., Coen, D. M. The polymerase chain reaction. Curr. Protoc. Protein Sci. Appendix 4, Appendix 4J (2002).
  21. Kreader, C. A. Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein. Appl. Environ. Microbiol. 62, 1102-1106 (1996).
  22. Kwok, S., et al. Identification of human immunodeficiency virus sequences by using in vitro enzymatic amplification and oligomer cleavage detection. J. Virol. 61, 1690-1694 (1987).
  23. McConlogue, L., Brow, M. A., Innis, M. A. Structure-independent DNA amplification by PCR using 7-deaza-2'-deoxyguanosine. Nucleic Acids Res. 16, 9869 (1988).
  24. Mullis, K. B. The unusual origin of the polymerase chain reaction. Sci. Am. 262, 56-65 (1990).
  25. Mullis, K. B. Target amplification for DNA analysis by the polymerase chain reaction. Ann. Biol. Clin. (Paris). 48, 579-582 (1990).
  26. Mullis, K. B. The polymerase chain reaction in an anemic mode: how to avoid cold oligodeoxyribonuclear fusion). PCR Methods Appl. 1, 1-4 (1991).
  27. Mullis, K. B., Faloona, F. A. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol. 155, 335-350 (1987).
  28. Paabo, S., Gifford, J. A., Wilson, A. C. Mitochondrial DNA sequences from a 7000-year old brain. Nucleic Acids Res. 16, 9775-9787 (1988).
  29. Rees, W. A., Yager, T. D., Korte, J., von Hippel, P. H. Betaine can eliminate the base pair composition dependence of DNA melting. Biochemistry. 32, 137-144 (1993).
  30. Roux, K. H., Hecker, K. H. One-step optimization using touchdown and stepdown PCR. Methods Mol. Biol. 67, 39-45 (1997).
  31. Rychlik, W., Spencer, W. J., Rhoads, R. E. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res. 18, 6409-6412 (1990).
  32. Saiki, R. K., et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 239, 487-491 (1988).
  33. Saiki, R. K., et al. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science. 230, 1350-1354 (1985).
  34. Sambrook, J. A. R., David, W. Molecular Cloning A Laboratory Manual. 2, 3, Cold Spring Harbor Laboratory Press. (2001).
  35. Sarkar, G., Kapelner, S., Sommer, S. S. Formamide can dramatically improve the specificity of PCR. Nucleic Acids Res. 18, 7465 (1990).
  36. Smit, V. T., et al. KRAS codon 12 mutations occur very frequently in pancreatic adenocarcinomas. Nucleic Acids Res. 16, 7773-7782 (1988).
  37. Wilson, I. G. Inhibition and facilitation of nucleic acid amplification. Appl. Environ. Microbiol. 63, 3741-3751 (1997).
  38. Wu, R. Methods in Enzymology. 218, Academic Press, Inc. San Diego. (1993).

Comments

1 Comment

  1. Thanks for the great overview of the all-important PCR procedure. I will no doubt reference it often in the future.

    I have a PCR troubleshooting question...what do to about streaking on the gel after a successful amplification? My bands are nice and bright and where they are supposed to be, but there is a heavily-streaked "path" starting at the wells and following until the end where my bands are. Is there something I can do about my PCR conditions, or the thermocycler settings? Any comments would be appreciated.

    Reply
    Posted by: Doug E.
    September 8, 2013 - 1:23 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics