Полимеразной цепной реакции: основные протокол Plus Устранение неполадок и оптимизация стратегии

Biology
 

Summary

ПЦР стала распространенной технологией во многих лабораториях молекулярной биологии. При условии, вот краткое руководство по несколько обычных протоколов ПЦР. Поскольку каждая реакция уникальный эксперимент, оптимальные условия, необходимые для создания продукта изменяются. Понимание переменных в реакции значительно повысит эффективность устранения неисправностей, тем самым увеличивая шансы получить желаемый результат.

Cite this Article

Copy Citation | Download Citations

Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J. Vis. Exp. (63), e3998, doi:10.3791/3998 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

В биологических наук были технические достижения, что катапультироваться дисциплины в золотой век открытий. Например, в области микробиологии была преобразована с появлением микроскопа Антони ван Левенгук, который позволил ученым визуализировать прокариот в первый раз. Развитие полимеразной цепной реакции (ПЦР) является одним из тех инноваций, которые изменили ход молекулярной науки с ее влияние охватывает бесчисленное поддисциплин в биологии. Теоретически процесс был намечен Keppe и его коллеги в 1971 году, однако, это было еще 14 лет, вплоть до полной процедуры ПЦР описаны и экспериментально применяться Кэри Маллис в то Cetus Корпорации в 1985 году. Автоматизация и совершенствование этой техники прогресс с внедрением тепловых стабильной ДНК-полимеразы из водяных бактерий Thermus, следовательно, ДНК-полимеразы Taq имя.

ПЦР Поуrful техника усиления, которые могут генерировать достаточный запас определенного сегмента ДНК (например, ампликона) только с небольшим количеством исходного материала (например, ДНК-матрицы или последовательности-мишени). В то время как простой и вообще без проблем, есть подводные камни, которые усложняют реакции производства ложные результаты. При ПЦР не удается, может привести ко многим неспецифический ДНК-продукты различных размеров, которые появляются как лестница или мазок из полос на агарозном геле. Иногда продукты не образуют вообще. Еще одна потенциальная проблема возникает при мутации непреднамеренно ввел в ампликонов, в результате гетерогенной популяции продуктов ПЦР. ПЦР неудачи может стать разочарование, если терпения и тщательного устранения неполадок работают, чтобы разобраться и решить проблему (ы). Этот протокол описывает основные принципы ПЦР, дает методику, которая приведет к усилению самой последовательности, цели, стратегии и представляет для оптимизации реакции. Следуя этой ПЦР руководство, улudents должны быть в состоянии:

  • Настройка реакций и тепловые условия для велосипедного обычного эксперимента ПЦР
  • Понимание функции различных компонентов реакции, и их общее влияние на эксперимент ПЦР
  • Разработка и оптимизация ПЦР эксперимент для любого шаблона ДНК
  • Устранение неполадок удалось ПЦР эксперименты

Protocol

1. Проектирование Грунтовки

Разработка соответствующих праймеров имеет важное значение для успешного завершения эксперимента ПЦР. При проектировании набора праймеров для конкретного региона ДНК для усиления желаемого, одна грунтовка должна отжига в плюс нить, которая по соглашению ориентирована в направлении 5 '→ 3' (также известный как чувство или нешаблонными нить) и другие грунтовки должны дополнять минус нить, которая ориентирована в 3 '→ 5' направлении (антисмысловых или шаблон прядь). Есть несколько общих проблем, возникающих при проектировании грунтовки: 1) самостоятельно отжига праймеров в результате образования вторичных структур, таких как шпильки петли (рис. 1а), 2) отжига праймеров друг с другом, а не ДНК-матрицы, создавая грунтовка димеров (рис. 1б), 3) резко отличается температура плавления (Т м) для каждого праймера, что затрудняет выбор температуры отжига, который будет всеой, грунтовок эффективно связываются с их целевой последовательности в themal велосипедные (рис. 1в) (см. разделы РАСЧЕТА температуры плавления (Т м) и изменения ВЕЛОСПОРТ условия для более подробной информации о Т т ы).

  1. Ниже приведен список характеристик, которые следует учитывать при разработке грунта.
    1. Грунтовка должна быть длиной 15-30 нуклеотидных остатков (основания).
    2. Оптимальное содержание GC должна составлять 40-60%.
    3. 3 'конце праймера должна содержать G или C, чтобы зажать грунтовки и не допустить «дыхание» целей, повышения эффективности грунтовки. ДНК "дыхания" происходит тогда, когда концы не остаться отжигали но драку или разделить на части. Эти три водородные связи в ГЦ-пар предотвратить дыхание, но и увеличить температуру плавления праймеров.
    4. Концы 3 'праймер набор, который включает в себя также грунтовки прядь и минус грунтовка пряди, не должно быть в omplementary друг к другу, не может 3'-конца одной грунтовка, дополняет другой последовательности в грунт. Эти два сценария приводит к образованию димеров праймеров и структуры петли шпильки, соответственно.
    5. Оптимальная температура плавления (Т м) для грунтовки в диапазоне от 52-58 ° C, хотя диапазон может быть расширен до 45-65 ° C. Окончательный м T для грунтовки должна отличаться не более чем на 5 ° C.
    6. Ди-нуклеотидных повторов (например, GCGCGCGCGC или ATATATATAT) или один работает база (например, AAAAA или ККККК) следует избегать, поскольку они могут вызвать скольжение по загрунтовать сегмент ДНК, или петли шпильки структуры в форме. Если неизбежно из-за характера ДНК-матрицы, а затем включать только повторяет или единая база работает с до 4 баз.

Примечания:

  1. Есть много компьютерных программ, предназначенный для оказания помощи в разработке пары праймеров. NCBI Primer инструмент проектированияw.ncbi.nlm.nih.gov / инструменты / грунтовка взрыва / "целевых =" _blank "> http://www.ncbi.nlm.nih.gov/tools/primer-blast/ и Primer3 http://frodo .wi.mit.edu/primer3 / рекомендуется сайты для этой цели.
  2. Для того, чтобы избежать усиления соответствующих псевдогенов или гомологов было бы полезно, чтобы запустить взрыв на NCBI для проверки целевого специфики праймеров.

2. Материалы и реагенты

  1. При настройке эксперимента ПЦР, важно быть подготовленным. Надевайте перчатки, чтобы избежать загрязнения реакционной смеси и реагентов. Включите отрицательный контроль, и, если возможно положительного контроля.
  2. Организовать все реагенты, необходимые для эксперимента ПЦР в только заполнить ведерко со льдом, и пусть они таять полностью перед установкой реакции (рис. 2). Храните реагенты на льду в течение всего эксперимента.
    • Стандартный ПЦР реагентов включаютустановить соответствующие праймеры для желаемого целевого гена или ДНК сегмент, который будет усиливаться, ДНК-полимераза, буфер для конкретной ДНК-полимеразы, дезоксинуклеотидов (дНТФ), ДНК-матрицы, и стерильной водой.
    • Дополнительные реагенты могут включать в себя соли магния Mg 2 + (в конечной концентрации от 0,5 до 5,0 ммоль), калия K + соль (в конечной концентрации от 35 до 100 мм), диметилсульфоксид (ДМСО, в конечной концентрации 1-10% ), формамид (в конечной концентрации 1.25-10%), бычий сывороточный альбумин (в конечной концентрации 10-100 мкг / мл) и бетаин (в конечной концентрации от 0,5 м до 2,5 м). Добавки более подробно рассматриваются в разделе поиска и устранения неисправностей.
  3. Организация лабораторного оборудования на рабочем месте.
    • Материалы включают ПЦР пробирок и шапки, стойки ПЦР трубки, этанол-маркера, устойчивого и набор micropipettors, которые обходятся в пределах 1 - 10 мкл (P10), 2 - 20 мкл (P20), 20 - 200 мкл (P200)и 200 - 1000 мкл (P1000), а также термоциклер.
    • При установке нескольких экспериментов ПЦР, что все используют те же реагенты, они могут быть расширены надлежащим образом и объединены в мастер-смесь (Master Mix). Этот шаг можно сделать в стерильном 1,8 трубки микроцентрифужных мл (см. Примечания).
    • Для анализа ампликонов в результате эксперимента ПЦР, реагентов и оборудования для гель-электрофореза в агарозном не требуется. Для приближения размеров ПЦР-продукт, соответствующий, имеющиеся в продаже молекулярный вес стандартного размера не требуется.

3. Настройка реакционной смеси

  1. Начнем с создания таблицы реагенты, которые будут добавлены к реакционной смеси (см. Таблицу 1).
  2. Далее, этикетки ПЦР труба (ы) с этанолом устойчивые маркером.
  3. Реакция объемы будут меняться в зависимости от концентрации реагентов акции. Конечной концентрации(CF) для типичного 50 мкл реакции заключаются в следующем.
    • X буфер (обычно поставляется производителем ДНК-полимеразы, может содержать 15 мМ MgCl 2). Добавьте 5 мкл 10X буфера в реакции.
    • 200 мкМ дНТФ (50 мкМ каждого из четырех нуклеотидов). Добавить 1 мкл 10 мМ дНТФ в реакции (дАТФ, дЦТФ, дТТФ и дГТФ являются 2,5 мм каждый).
    • 1,5 мМ Mg 2 +. Добавить только если он не присутствует в 10 раз буфера или по мере необходимости для оптимизации ПЦР. Например, чтобы получить 4,0 мМ Mg 2 +, необходимые для оптимального производства ампликона сохраняющегося 566 б.п. сегмента ДНК найдены в неохарактеризованной Mycobacteriophage добавить 8 мкл 25 мМ MgCl 2 в реакции (рис. 3).
    • От 20 до 50 пмоль каждого праймера. Добавить 1 мкл 20 мкМ грунт.
    • Добавить 10 4 -10 7 молекул (или от 1 до 1000 нг) ДНК. Добавить 0,5 мкл 2ng / и му; Л геномной ДНК Mycobacteriophage.
    • Добавить 0,5 до 2,5 единиц ДНК-полимеразы в 50 мкл реакции (см. рекомендации производителя), например, добавить 0,5 мкл Sigma 0,5 ед / мкл Taq ДНК-полимеразы.
    • Добавить QS стерильной дистиллированной воды для получения 50 мкл конечного объема в реакции, предварительно определяется в таблице реагентов (QS является Латинская аббревиатура для квантовых удовлетворяет то есть сумму, которая не требуется). Таким образом, 33 мкл на реакцию требуется довести объем до 50 мкл. Тем не менее, следует отметить, что вода добавляется первой, но требует сначала сделать таблицу реагентов и определения объемов всех других реагентов добавляют к реакционной.

4. Основные ПЦР протокола

  1. Поместите 96 пластины в ведерко со льдом, как держатель для 0,2 мл тонкостенных труб ПЦР. Разрешение ПЦР реагентов для добавления в холодные 0,2 мл тонкостенных труб ПЦР поможет предотвратить nucleasдеятельность электронных и неспецифические грунтовки.
  2. Пипетировать следующие реагенты ПЦР в следующем порядке: в 0,2 мл тонкостенных труб ПЦР (рис. 4): стерильная вода, 10х ПЦР буфер, дНТФ, MgCl 2, грунтовки, и шаблона ДНК (см. Таблицу 1). Поскольку эксперименты должны иметь по крайней мере, отрицательного контроля, и, возможно, положительный контроль, это полезно для создания Master Mix в 1,8 трубки микроцентрифужных мл (см. объяснение в примечаниях).
  3. В отдельном 0,2 мл тонкостенных труб ПЦР (рис. 4) добавить все реагенты за исключением матричной ДНК для отрицательного контроля (увеличение воды, чтобы компенсировать недостающий объем). Кроме того, другой реакции (если реагенты имеются) должны содержать позитивный контроль с использованием ДНК-матрицы и праймеров или ранее известных для усиления тех же условиях, как экспериментальные трубы ПЦР.
  4. Taq ДНК-полимераза, как правило, хранятся в 50% глицеринарешение и для полного разгона в реакционной смеси требует нежного смешивания реагентов ПЦР с помощью пипетки вверх и вниз, по крайней мере 20 раз. Micropipettor должен быть установлен около половины объема реакции мастер смесь при перемешивании, и следует проявлять осторожность, чтобы избежать введения пузыри.
  5. Установите крышки на 0,2 мл тонкостенных труб ПЦР и поместить их в термоциклер (рис. 5). Как только крышку термоциклер плотно закрыта запуска программы (см. таблицу 2).
  6. Когда программа закончилась, 0,2 мл тонкостенных труб ПЦР могут быть удалены и хранить при температуре 4 ° C. ПЦР-продукты могут быть обнаружены путем загрузки порции каждой реакции в лунки геля агарозы, то окрашивание ДНК, которые мигрировали в гель-электрофореза следующий бромидом этидия. Если продукт ПЦР настоящее время бромистого этидия будет расположиться между основаниями ДНК, что позволяет полосы для визуализации с УФ-подсветкой. </ LI>

Примечания:

  1. При установке нескольких экспериментов ПЦР, целесообразно собрать смесь реагентов, общие для всех реакций (например, Master Mix). Обычно коктейль содержит раствор ДНК-полимеразы, дНТФ, реакционного буфера, и вода собирается в 1,8 мл микроцентрифужных трубку. Количество каждого реагента добавлен Master Mix эквивалентно общее число реакций плюс 10% округляется до ближайшего целого реакции. Например, если есть 10 х 0,1 = 1 реакция, то (10 + 1) х 5 мкл 10X буфера равна 55 мкл 10X буфера для Master Mix. Реагенты в Master Mix тщательно перемешивают, осторожно насосных поршень micropipettor вверх и вниз примерно в 20 раз, как описано выше. Каждая трубка ПЦР получает аликвоту Master Mix в котором ДНК-матрицы, все необходимые праймеры и эксперимент-специфических реагентов, затем добавить (см. таблицы 1 и 7).
  2. Followiнг сайт предлагает калькулятор для определения числа копий ДНК-матрицы ( http://www.uri.edu/research/gsc/resources/cndna.html ). Общее количество копий двухцепочечной ДНК может быть рассчитана по следующей формуле:
    Количество копий ДНК = (количество ДНК (нг) х 6.022x10 23) / (длина х ДНК 1x10 9 нг / мл х 650 дальтон)
    Расчет количества копий ДНК используется, чтобы определить, сколько шаблон необходимо в реакции.
  3. Ложные срабатывания могут возникнуть в результате переноса из другой реакции ПЦР, которые будут визуализированы в виде нескольких нежелательных продуктов в агарозном геле после электрофореза. Таким образом, целесообразно использовать правильную технику, включать отрицательный контроль (и положительного контроля, когда это возможно).
  4. В то время как бромистый этидий является наиболее распространенным пятно еили нуклеиновых кислот есть несколько более безопасной и менее токсичных альтернатив. Следующий сайт описывает несколько альтернатив, включая метиленовый синий, фиолетовый кристалл, SYBR безопасной и гель красного вместе с легендой о том, как использовать и выявления конечного продукта ( http://bitesizebio.com/articles/ethidium-bromide-the- альтернативы / ).
  5. Хотя большинство современных машин ПЦР использовать 0,2 мл труб, в некоторых моделях может потребовать реакции в пробирок 0,5 мл. Обратитесь к тепловым ручной велосипедистов, чтобы определить соответствующий размер трубки.

5. Расчет температуры плавления (Т м)

  1. Зная температуру плавления (Т м) праймеров необходимо для успешного эксперимента ПЦР. Хотя есть несколько Т м калькуляторы, доступные, важно отметить, что эти расчеты оценки фактического Т м за счет в отсутствие конкретной информации о конкретной реакции и предположения, сделанные в алгоритмы для T м калькуляторы себя. Тем не менее, ближайшего соседа термодинамические модели являются предпочтительными по сравнению с более обычными расчета: T м ≈ 4 (GC) + 2 (К). В первом случае будут давать более точную оценку Т м, поскольку он учитывает укладки энергии соседних пар оснований. Последний используется чаще, поскольку расчеты просты и могут быть быстро от руки. См. раздел Устранение неисправностей для получения информации о том, как различные условия ПЦР и добавки влияют на температуру плавления.
    Для расчета T м ценностей ближайшего соседа термодинамических моделей, одной из следующих калькуляторы рекомендуется:
    http://www6.appliedbiosystems.com/support/techtools/calc/
    образование / ~ Zimmer / oligoTMcalc.html "целевых =" _blank "> http://www.cnr.berkeley.edu/ ~ Zimmer / oligoTMcalc.html
    http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/
    http://www.finnzymes.com/tm_determination.html~~V
    http://mobyle.pasteur.fr/cgi-bin/portal.py? # формы :: плавления

6. Установка теплового режима Велоспорт

  1. ПЦР тепловой велосипедистов быстрого нагрева и охлаждения реакционной смеси, что позволяет тепло-индуцированной денатурации ДНК-дуплекса (нить разделение), отжиг праймеров на плюс и минус нити ДНК-матрицы, и удлинение продукта ПЦР. Велоспорт раз рассчитываются на основе размера шаблона и GC содержание ДНК. Общая formulначинается с первого шага денатурации при 94 ° C до 98 ° C в зависимости от оптимальной температуры для ДНК-полимеразы, а деятельность ГК содержимое шаблона ДНК. Типичная реакция начнется с минуты денатурации при 94 ° C. Любой более 3 минут может инактивировать ДНК-полимеразы, разрушая его ферментативной активности. Один метод, известный как горячий старт ПЦР, существенно расширяет начальный момент времени денатурации от 3 минут до 9 минут. С горячего старта ПЦР, ДНК-полимераза добавляется после первого шага преувеличенными денатурации закончена. Эта модификация протокола исключает вероятность инактивации фермента ДНК-полимеразы. Обратитесь к разделу Устранение неисправностей этого протокола для получения дополнительной информации о горячий старт ПЦР и другие альтернативные методы.
  2. Следующим шагом является установка термоциклер инициировать первое от 25 до 35 раундов трехступенчатый температура цикла (табл. 2). В то время как увеличение числа циклов выше 35 приведет кбольшее количество продуктов ПЦР, слишком много раундов часто приводит к обогащению нежелательных вторичных продуктов. Три температурных шагов за один цикл выполнить три задачи: первый шаг денатурирует шаблон (и в более поздних циклов, ампликонов, а), второй шаг позволяет оптимально отжига праймеров, а третий шаг позволяет ДНК-полимераза связывается с шаблона ДНК и синтез продукта ПЦР. Продолжительность и температура каждого шага в цикле может быть изменена, чтобы оптимизировать производство желаемого ампликона.
    Время для денатурации шаг хранится как можно короче. Обычно от 10 до 60 секунд вполне достаточно для большинства шаблонов ДНК. Время денатурации и температура может варьироваться в зависимости от GC содержимое шаблона ДНК, а также скорость изменения, что время, необходимое термоциклер переходить от одной температуры к другой. Температура на этом этапе, как правило, те же, что и для начальной стадии денатурации(Шаг 1 выше, например, 94 ° C).
    30 секунд отжига следующим в цикле при температуре установить около 5 ° С ниже очевидным м Т праймеров (в идеале, между 52 ° C до 58 ° C).
    Цикл завершается удлинение шага. Температура зависит от ДНК-полимеразы, отобранных для эксперимента. Например, Taq ДНК-полимераза обладает оптимальной температуре удлинение 70 ° C до 80 ° С и требует 1 минута, чтобы удлинить первых 2 Кб, то требуется дополнительная минута за каждый дополнительный 1 кб усиливается. Pfu ДНК-полимераза другой термостабильный фермент, который имеет оптимальную температуру удлинение 75 ° C. Pfu ДНК-полимераза рекомендуется для использования в ПЦР и удлинения праймера реакции, которые требуют высокой точности и требует 2 минуты на каждый 1 Кб должны быть усилены. См. рекомендации производителя для точной температуре удлинение и удлинение срока, указанного для каждой конкретной ДНК-полимеразы.
  3. Taq, допускает добавление остатка аденина к 3 'концы всех продуктов ПЦР. Данная модификация посредничестве терминал трансферазы активности ДНК-полимеразы Taq и полезно для последующего молекулярного клонирования процедур, которые требуют 3'-навес.
  4. Прекращение реакции достигается за счет охлаждения смеси до 4 ° C и / или путем добавления EDTA до конечной концентрации 10 мМ.

7. Важные замечания При диагностике ПЦР

Если стандартные условия ПЦР не дают желаемого ампликона, ПЦР оптимизации, необходимые для достижения лучших результатов. Жесткость реакции могут видоизменяться, что специфика регулируется путем изменения переменных (например, реагентконцентрациях, езда на велосипеде условия), которые влияют на результат ампликона профиля. Например, если реакция не является строгим достаточно много ложных ампликонов будет создан с переменной длиной. Если реакция является слишком жестким, не продукт будет производиться. Устранение неполадок ПЦР может быть разочарование усилия в разы. Тем не менее, тщательный анализ и хорошее понимание того, реагенты, используемые в эксперименте ПЦР может снизить количество времени, и испытания, необходимые для получения желаемых результатов. Из всех соображений, которые влияют ПЦР жесткости, титрование Mg 2 + и / или управление температуры отжига скорее всего, будет решить большинство проблем. Однако, прежде чем что-то менять, убедитесь, что ошибочный результат был не в результате человеческой ошибки. Сначала подтверждающие все реагенты были добавлены к данной реакции и реагенты не были загрязнены. Также обратите внимание на ошибочный результат, и ответить на следующие вопросы: грунтовка димеры видны на гель после электрофотографическихсопротивления (они выполняются как небольшие группы <100 б в нижней части полосы)? Есть неспецифические продукты (группы, которые мигрируют в различные размеры, чем желаемый продукт)? Было ли отсутствие какого-либо продукта? Это ДНК-мишени на плазмиды или геномной ДНК экстракт? Кроме того, имеет смысл проанализировать содержание GC желаемого ампликона.

  1. Сначала определите, если любой из реагентов ПЦР катастрофические последствия для вашей реакции. Это может быть достигнуто путем разработки новых реагентов (например, новую рабочую акции, новые разведения), а затем систематически добавление одного нового реагента в то время в реакционной смеси. Этот процесс будет определить, какой реагент был виновником неудачного эксперимента ПЦР. В случае очень старых ДНК, которые часто накапливается ингибиторов, было показано, что добавление бычьего сывороточного альбумина может помочь решить проблему.
  2. Грунтовка димеров могут образовываться, когда грунтовки преимущественно самостоятельно отжига или отжига для другого праймера в реакции. Если это произойдет, малыйпродукта менее 100 б.п. появится на агарозном геле. Начните с изменения отношения шаблон для грунтовки, если грунтовка концентрации в экстремальных превышение концентрации шаблон, то грунтовки будет больше шансов для отжига для себя или друг друга по ДНК. Добавление и ДМСО или с помощью горячего старта термическим методом езда на велосипеде может решить проблему. В конце концов, это может быть необходимо для разработки новых праймеров.
  3. Неспецифические продукция производится при ПЦР жесткости является чрезмерно низкой в ​​результате неспецифических полос ПЦР с переменной длиной. Это приводит к лестнице влияние на агарозном геле. После этого рекомендуется выбрать ПЦР условия, которые повышают жесткость. Мазков различных размеров может также быть результатом грунтовки предназначены для часто повторяющихся последовательностей при усилении геномной ДНК. Однако те же праймеры могут усиливать целевой последовательности на плазмиды, не сталкиваясь с той же проблемой.
  4. Отсутствие продуктов ПЦР, вероятно, из-за условий реакции, которые являются слишком жесткими. Грунтовка димеров и структуры петли шпильки, которые образуют с грунтовки или денатурированной ДНК шаблон может также предотвратить усиление продуктов ПЦР, потому что эти молекулы могут больше не пара оснований с нужной ДНК аналога.
  5. Если содержание GC не были проанализированы, пришло время сделать это. ПЦР GC богатых регионов (GC содержание> 60%) представляют некоторые из самых больших проблем для ПЦР. Тем не менее, существует много добавок, которые были использованы, чтобы помочь облегчить проблемы.

8. Управление ПЦР реагентов

Понимание функции реагентов, используемых в обычной ПЦР имеет решающее значение при первом решении, как лучше изменить условия реакции, чтобы получить желаемый продукт. Успех просто могут рассчитывать на изменения концентрации MgCl 2, KCl, дНТФ, грунтовки, шаблон ДНК, или ДНК-полимеразы. Тем не менее, неправильно концентрация таких реагентов может привести к ложным результатам, снижение stringencу реакции. При устранении ПЦР, только один реагент следует манипулировать временем. Тем не менее, оно может быть разумным для титрования манипулировать реагента.

  1. Соли магния Mg 2 + (конечная концентрация реакции от 0,5 до 5,0 ммоль)
    Термостабильной ДНК-полимеразы требуется наличие магния в качестве кофактора в процессе реакции. Изменение концентрации магния является одним из самых простых реагентов для работы с, пожалуй, наибольшее влияние на жесткость ПЦР. В общем, выход ПЦР-продукта будет увеличиваться с добавлением большей концентрации Mg 2 +. Тем не менее, повышение концентрации Mg 2 + также будет уменьшаться специфичность и точность ДНК-полимеразы. Большинство производителей включают раствора хлористого магния (MgCl 2) вместе с ДНК-полимеразой и 10х ПЦР буфер решение. 10 х ПЦР буферных растворов может содержать 15 мМ MgCl 2, что достаточно для типичной ПЦРреакции, или он может быть добавлен отдельно в концентрации оптимизирована для конкретной реакции. Mg 2 + на самом деле не потребляется в реакции, но реакции не могут происходить без его присутствия. Когда слишком много Mg 2 +, это может помешать полной денатурации ДНК-матрицы, стабилизируя дуплекс нити. Слишком много Mg 2 + также может стабилизировать ложных отжига праймеров к неправильному сайтов шаблон и снижению специфичности в результате нежелательных продуктов ПЦР. Когда не хватает Mg 2 +, реакция не пойдет, в результате чего нет ни ПЦР.
  2. Калий соли K + (конечная концентрация реакция 35 до 100 мм)
    Более продуктов ПЦР (от 10 до 40 кб) выгоды от снижения соли калия (KCl) от нормальной реакции 50 мМ концентрации, часто в сочетании с добавлением ДМСО и / или глицерин. Если нужный ампликона менее 1000 б.п. и долго неспецифические продукты формирования, specificiти может быть улучшена путем титрования хлорида калия, увеличение концентрации с шагом 10 мм до 100 мм. Увеличение концентрации соли позволяет коротких молекул ДНК к денатурации преимущественно на длинных молекул ДНК.
  3. Дезоксинуклеотида 5'-трифосфата (конечная концентрация реакции 20 и 200 мкм каждый)
    Дезоксинуклеотида 5'-трифосфата (дНТФ) может вызвать проблемы для ПЦР, если они не в соответствующих эквивалентных концентрациях (например, [А] = [T] = [C] = [G]) и / или в связи с их нестабильностью от повторных замораживания и оттаивания. Обычная концентрация дНТФ 50 мкМ каждого из четырех дНТФ. Тем не менее, ПЦР может терпеть концентрации от 20 до 200 мкм каждая. Нижняя концентрации дНТФ может увеличиться как специфичность и точность реакции, тогда как чрезмерная концентрация дНТФ действительно может препятствовать ПЦР. Тем не менее, для более ПЦР-фрагментов, более дНТФ концентрации могут быть необходимы. Большое изменение концентрации дНТФ может потребовать соответствуюствующих изменений в концентрации Mg 2 +.
  4. Тепловая стабильной ДНК-полимеразы
    ПЦР ферментов и буферы, связанные с этими ферментами прошли долгий путь с начальной Taq ДНК-полимеразы был впервые применен. Таким образом, выбирая соответствующий фермент может быть полезно для получения целевых продуктов ампликона. Например, использование ДНК-полимеразы Taq может быть предпочтительнее, чем ДНК-полимеразы Pfu если процессивность и / или добавление остатка аденина к концам 3 'ПЦР продукт лучшего. Добавление 3 'аденин стала полезной стратегией для клонирования продуктов ПЦР в векторы TA ничуть 3' свесы тимин. Однако, если верность является более важным ферментом, таких как Pfu может быть лучшим выбором. Некоторые производители имеют множество конкретных ДНК-полимеразы разработана для специализированных потребностей. Посмотрите на реакцию условия и характеристики желаемого ампликона, а затем соответствующие ПЦР эксперимент с соответствующей ДНК сolymerase. Большинство производителей есть таблицы, которые помогают ДНК-полимеразы выбор список таких характеристик, как верность, доходность, скорость, оптимальную длину цель, и насколько это полезно для GC богатых усиления или горячий старт ПЦР.
  5. Шаблона ДНК
    Качество и чистоту ДНК будет иметь существенное влияние на вероятность успешного эксперимента ПЦР. ДНК и РНК концентрации можно определить, используя их измерения оптической плотности при 260 нм (диаметр 260). Масса очищенной нуклеиновых кислот в растворе рассчитывается на 50 мкг / мл двухцепочечной ДНК или 40 мкг / мл или РНК или одноцепочечной ДНК в OD 260 = 1.0. Загрязнений экстракции ДНК являются общими ингибиторов ПЦР и должны быть тщательно избегать. Общие экстракции ДНК ингибиторов ПЦР включает белки, РНК, органических растворителей и моющих средств. Использование максимального поглощения нуклеиновых кислот OD 260 по сравнению с белками OD280 (ОП 260/280), можно определяющимэлектронная оценка чистоты извлекли ДНК. В идеале соотношение ОП 260/280 между 1.8 и 2.0. Нижний диаметр 260/280 свидетельствует о белка и / или растворитель загрязнений, которые, по всей вероятности, будет проблематично для ПЦР.
    В дополнение к качеству ДНК-матрицы, оптимизация количества ДНК, могут извлечь большую пользу исход эксперимента ПЦР. Хотя это и удобно для определения количества в нг / мл, что часто является выходом для современного nanospectrophotometers, соответствующее подразделение для успешного эксперимента ПЦР число молекул. То есть, сколько копий ДНК-матрицы содержат последовательность дополнением к ПЦР-праймеры? Оптимальное целевых молекул от 10 4 до 10 7 молекул и может быть рассчитана, как было описано в примечаниях выше.

9. Аддитивные реагенты

Аддитивные реагенты могут давать результаты, когда все остальное не даст результатов. Понимание реагентови для чего они используются для имеет решающее значение в определении того, какие реагенты могут быть наиболее эффективными в приобретении желаемого продукта ПЦР. Добавление реагентов для реакции осложняется тем, что манипуляции один реагент может повлиять на концентрацию использовать другой реагент. В дополнение к реагентам, перечисленных ниже, собственность коммерчески доступных добавок можно приобрести во многих биотехнологических компаний.

10. Добавки, которые приносят пользу ГК Богатые шаблоны

  1. Диметилсульфоксида (конечная концентрация реакция 1-10 ДМСО%)
    В ПЦР эксперименты, в которых ДНК-матрицы особенно богатым GC (GC содержание> 60%), добавив, ДМСО могут усилить реакцию на нарушения спаривания оснований и эффективного снижения Т м. Некоторые Т м калькуляторы включают переменная запись для добавления концентрации ДМСО желаемого в эксперименте ПЦР. Однако, добавление более чем на 2% ДМСО может потребоваться добавить больше ДНК-полимераза, как это было демонапродемонстрировали препятствовать Taq ДНК-полимеразы.
  2. Формамид (конечная концентрация реакция 1.25-10%)
    Как ДМСО, формамид также нарушает спаривания оснований при увеличении жесткости грунта отжига, что приводит к менее неспецифические грунтовки и повышения эффективности усиления. Формамид также было показано, что усилитель для GC богатых шаблонов.
  3. 7-деаза-2'-дезоксигуанозина 5'-трифосфата (конечная концентрация реакция DC 7 GTP, 3 DC 7 GTP: 1 дГТФ 50 мкм)
    Использование 3-х частей, или 37,5 мкм, в гуанозин базе аналоговых DC 7 ГТУ в сочетании с 1 часть, или 12,5 мкм, дГТФ дестабилизирует образования вторичных структур в продукте. Как ампликона или шаблона ДНК, денатурированные, он будет часто образуют вторичные структуры, такие как шпильки петли. Включение DC 7 ГТФ в ДНК ампликона запрещает формирование этих аберрантных структур.

Примечание:

7 GTP ослабляет сигнал бромистого этидия окрашивания, поэтому он используется в соотношении 3:1 с дГТФ.

  1. Бетаин (конечная концентрация реакция на 0,5 м 2,5 м)
    Бетаин (N, N, N-триметилглицин) является цвиттерионные аминокислоты аналоговых кислоты, которая снижает и даже может устранить температуры плавления ДНК зависимости от нуклеотидного состава. Он используется в качестве добавки к помощи ПЦР-амплификации GC богатых целей. Бетаин часто используется в сочетании с ДМСО и может значительно повысить шансы на усиливающую ДНК мишени с высоким содержанием GC.

11. Добавки, помогающие ПЦР в присутствии ингибиторов

  1. Non ионные детергенты работать для подавления вторичного структуру и способствовать стабилизации ДНК-полимеразы. Non ионных детергентов, таких как Тритон Х-100, твин-20, или NP-40 может быть использован в реакции концентрации от 0,1 до 1% с целью повышения ампликона производства. Тем не менее, концентробъема более 1% может быть подавляют ПЦР. Наличие без ионные детергенты уменьшается ПЦР жесткости, что может привести к ложным формирование продукта. Тем не менее, их использование также нейтрализовать тормозной влияет на SDS, случайных загрязнений протоколов экстракции ДНК.
  2. Добавление специфические белки, такие как бычий сывороточный альбумин (BSA), используемых при 400 нг / мкл и / или Т4 ген белка 32 150 нг / мкл помощью ПЦР в присутствии ингибиторов, таких как FeCl 3, гемин, фульвокислоты, гуминовые кислоты, дубильные кислоты, или выписки из фекалий, пресной воды и морской воды. Тем не менее, некоторые ингибиторы ПЦР, в том числе соли желчных кислот, билирубина, ЭДТА, NaCl, SDS, или Тритон Х-100, не облегчено путем добавления или BSA или T4 ген белка 32.

12. Изменения в условиях Велоспорт

  1. Оптимизация температуры отжига будет способствовать любой реакции ПЦР и их следует рассматривать в сочетании с другими добавками и / или вместе с другими момента difications для велосипедных условиях. Таким образом, для расчета оптимальной температуры отжига следующей формуле используется:
    T OPT = 0,3 Тл м грунтовка + 0,7 т продуктов -14,9 м
    Т м Primer рассчитывается как м Т менее стабильной пары по следующей формуле:
    Т м Primer = ((H / (ΔS + R х п (С / 4))) -273,15 + 16,6 журнал [K +] Где ΔH это сумма ближайшего соседа изменения энтальпии для гибридов; ΔS является суммой Ближайший сосед изменения энтропии, R-газовая постоянная (1,99 кал K-1 моль-1); С грунтовкой концентрации и [K +] является концентрация калия.
    Последнее уравнение можно вычислить с помощью одного из T калькуляторы м перечислены на сайте:
    RS / плавления / sup_mat / servers_list.html "целевых =" _blank "> http://protein.bio.puc.cl/cardex/servers/melting/sup_mat/servers_list.html
    Т т продукта рассчитывается следующим образом:
    Т м = 0,41 продукта (% GC) + 16,6 журнал [K +] - длина 675/product
    Для большинства реакций ПЦР концентрация калия ([K +]) будет составлять 50 мм.
  2. Горячий старт ПЦР является универсальной модификации, в котором в начальный момент времени денатурации резко возросло (табл. 4). Эта модификация может быть включена с или без других изменений в велосипедных условиях. Кроме того, он часто используется в сочетании с добавками для темпераментных формирование ампликона. На самом деле, горячий старт ПЦР чаще включены в регулярный аспект общих условий езды на велосипеде. Горячий старт был продемонстрирован увеличить ампликона выход, а при увеличении специфичности и точности реакции.Смысл горячего старта ПЦР заключается в устранении праймер-димеров и неспецифические грунтовки, которые могут привести, как следствие, создания реакции ниже T м. Таким образом, типичный горячий начала реакции нагревает образец до температуры выше оптимальной Т м, по крайней мере до 60 ° С до любой усиление может происходить. В общем, ДНК-полимераза удерживается от реакции на начальном, удлиненные, денатурирующих времени. В отличие от других компонентов реакции, иногда опускается, а ДНК-полимеразы, здесь мы остановимся на ДНК-полимеразы. Есть несколько методов, которые позволяют ДНК-полимеразы, чтобы оставаться в бездействии или физически отделена до начального периода денатурации завершена, в том числе использование твердого воска барьер, анти-ДНК-полимеразы антитела, белки и аксессуаров. Кроме того, ДНК-полимераза может быть просто добавляется к реакции после первого цикла денатурации является полным.
  3. Touchdown PCR (TD-PCR) являетсянамерены принять некоторые предположения выработать ограничений T м расчет брекетинг расчетных температурах отжига. Концепция заключается в разработке двух фаз езда на велосипеде (табл. 5). На первом этапе работают последовательно ниже температуры отжига каждый второй цикл (традиционно 1.0 ° C), начиная с 10 ° C выше, и заканчивая рассчитывается T м или чуть ниже. На втором этапе используется стандартный 3-х ступенчатый условиях температуры отжига установлена ​​на 5 ° C ниже расчетной Т м еще на 20 до 25 циклов. Функция первого этапа должны облегчить mispriming, присвоение 4-кратное преимущество правильный продукт. Таким образом, после 10 циклов, 410 раз преимущество даст 4096 копий правильный продукт по любой ложный грунтовки.
    • Ступенчатого снижения ПЦР похож на TD-ПЦР с меньшим шагом на первом этапе грунт. Например, на первом этапе снижает температуры отжига каждыйВторой цикл на 3 ° C, начиная с 10 ° C выше и заканчивается в 2 ° С ниже расчетной T м. Как и TD-PCR, второй этап использует стандартный 3-х ступенчатый условиях температуры отжига установлена ​​на 5 ° C ниже расчетной Т м еще на 20 до 25 циклов. Это позволило бы правильный продукт 256 раз преимущество перед ложным продуктов грунтовки.
    • Замедление ПЦР это просто изменение TD-ПЦР и была успешной для усиления GC очень богатые (более 83%) последовательности (табл. 6). Концепция учитывает относительно новая особенность, связанная с современными тепловыми велосипедистов, которая позволяет регулировать скорость разгона, а также от скорости охлаждения. В протоколе также использует DC 7 GTP сократить 2 ° формирование структуры, которые могут препятствовать реакции. Рампы скорость снижается до 2,5 ° С с-1 при скорости охлаждения 1,5 ° C с -1 для отжига циклы. Первый этап начинается сотжига температуру 70 ° C и снижает температуру отжига на 1 ° С каждые 3 раунда, пока не достигнет 58 ° C. Второй этап продолжается с температуры отжига 58 ° C в течение 15 циклов.
  4. ПЦР является мощным инструментом для устранения ложных продуктов. Использование вложенных грунтовки особенно полезно при наличии нескольких паралогичные генов в геноме одного или когда есть небольшое количество копию последовательности-мишени в гетерогенной популяции ортологичных последовательности. Основная процедура включает в себя два набора праймеров, которые усиливают одной области ДНК. Внешний грунтовки колебаться сегменте интерес и используются для создания продуктов ПЦР, которые часто являются неспецифическими в от 20 до 30 циклов. Небольшой аликвоты, как правило, около 5 мкл с первого по 50 мкл реакции, затем используется в качестве шаблона ДНК еще от 20 до 30 патронов усиления использование второго набора праймеров, которые отжига на внутренние относительное расположениев первом сете.

Другие протоколы ПЦР более специализированных и выходит за рамки данной статьи. Примеры включают в себя RACE-PCR, Мультиплекс-PCR, Vectorette-PCR, количественный ПЦР и ОТ-ПЦР.

13. Представитель Результаты

Представитель результатов ПЦР были получены от следующих основных протоколов ПЦР, описанных выше. Результаты включают несколько стратегий устранения неполадок, чтобы продемонстрировать влияние различных реагентов и условий реакции. Гены от начинающего CEREVISIAE дрожжей Saccharomyces и от неохарактеризованной Mycobacteriophage были усилены в этих экспериментах. Стандартный 3-х ступенчатый ПЦР протокола приведены в Таблице 2, занятых во всех трех экспериментах, описанных ниже.

Перед установкой эксперимента ПЦР с геномной ДНК и С. CEREVISIAE и Mycobacteriophage количественно и разбавляют до концентрации, которая бы аллоW от 10 до 4 и 10 7 молекул ДНК в реакции. Рабочая запасы готовят следующим образом. Геномной ДНК дрожжей подготовку дали 10 4 нг / мкл. Разбавление до 10 нг / мкл была создана путем добавления 48 мкл в 452 мкл ТЕ буфера рН 8,0. С С. CEREVISIAE генома составляет около 12.5 Mb, 10 нг содержат 7,41 х 10 5 молекул. Геномной ДНК подготовки Mycobacteriophage дали 313 нг / мкл. Разбавления до 2 нг / мкл была создана путем добавления 6,4 мкл в 993,6 мкл ТЕ буфера рН 8,0. Это ДНК фага составляет около 67 Кб. Таким образом, 1 нг содержит 2,73 х 10 7 молекул, которая находится на верхнем пределе ДНК обычно используется для ПЦР. Рабочая запасы были использованы для создания Master Mix решений, перечисленных в таблице 7. Опыты варьировались велосипедные условиях, описанных ниже.

На рисунке 3а, геномной ДНК S. CEREVISIAE был использован в качестве шаблона для усиленияGAL3 ген, который кодирует белок, участвующий в метаболизме галактозы. Целью этого эксперимента было определение оптимальных Mg 2 + концентрации для этого набора реагентов. Нет MgCl 2 было в исходном буфере ПЦР и должен быть дополнен в концентрациях, указанных в диапазоне испытания с 0,0 мм до 5,0 мм. Как показано на рисунке, ПЦР продукт ожидаемого размера (2098 б.п.) появляется, начиная с Mg 2 + концентрации 2,5 мМ (дорожка 6) с оптимальной концентрацией в 4,0 мм (переулок 9). Рекомендуемая концентрация, предоставляемых производителем в 1,5 мм, что суммы, предусмотренной в типовых буферов PCR. Удивительно, но необходимая концентрация необходима для образования продукта в этом эксперименте превышал эту сумму.

Различных шаблонов ДНК был использован для эксперимента представлена ​​на рисунке 3b. Геномная ДНК из Mycobacteriophage был использован для усиления консервативных 566 б.п. сегмента ДНК.Как и в предыдущем эксперименте, оптимальные Mg 2 + концентрация должна быть определена. Как показано на рисунке 3b, усиление целевого продукта ПЦР требует по крайней мере 2,0 мМ Mg 2 + (дорожка 5). В то время было больше различия в количестве продукта, образующегося при повышении концентрации MgCl 2, наиболее ПЦР-продукта наблюдалась в 4 мМ Mg 2 + (дорожка 9), той же концентрации наблюдается дрожжи GAL3 ген.

Обратите внимание, что в экспериментах, представлены на рисунках 3A и 3B, дискретные группы была получена с помощью велосипедных условиях считается оптимальным на основе грунтовки температуры отжига. В частности, денатурации температура составила 95 ° С и температуре отжига 61 ° C, и был выполнен в течение 1 минуты при 72 ° С в течение 30 циклов. Окончательный 5 минут расширение было сделано, то при 72 ° C. Для третьего эксперимента представлена ​​на рисунке 3, рисунке 3, в то, что было дискретной группы на рисунке 3а, становится мазок неспецифических продуктов под эти суб-оптимальных условий езды на велосипеде. Кроме того, с общей жесткости реакции снижается, меньшее количество Mg 2 +, необходимых для формирования ампликона.

Все три эксперимента показывают, что при концентрации Mg 2 + являются слишком низкими, нет ампликона производства. Эти результаты также показывают, что когда оба условия, езда на велосипедеправильно спроектирована и реагентов при оптимальной концентрации, эксперимент ПЦР дает сдержанный ампликона соответствующие ожидаемые размеры. Полученные результаты свидетельствуют о важности проведения ПЦР эксперименты на достаточно высокую жесткость (например, сдержанный группы по сравнению с мазком). Кроме того, эксперименты показали, что изменение одного параметра может повлиять еще один параметр, влияя таким образом на исход реакции.

Реагент Концентрация растворы Объем 13X **
Master Mix
Конечная концентрация
Стерильные H 2 O QS до 50 мкл QS до 650 мкл
ПЦР-буфера 10X 5 мкл 65 мкл 1X
дНТФ в 10 мМ 1 мкл 13 мкл 200 мкМ
MgCl 2 25 мМ 3 мкл 39 мкл 1,5 мМ
Прямой праймер 20 мкМ = 20 пмоль / мкл 1 мкл 13 мкл 20 пмоль
Обратный праймер 20 мкМ = 20 пмоль / мкл 1 мкл 13 мкл 20 пмоль
Шаблона ДНК Переменная Переменная Переменная ~ 10 5 молекул
Taq ДНК-полимераза 5 единиц / мкл * 0,5 мкл 6,5 мкл 2,5 единиц
50 мкл / Реакция

Таблица 1. ПЦР реагентов в порядке, они должны быть добавлены.

* Единицы могут отличаться у разных производителей

** Добавить все реагенты Master Mix исключая необходимость в титрования или что может быть переменной реакции. Master Mix изображено на приведенной выше таблице рассчитывается для 11 реакций, а также 2 дополнительных реакций, для размещения пипетки передачи потеря обеспечения есть достаточно аликвоту каждой реакционной трубки.

Стандартный 3-х ступенчатый ПЦР Велоспорт
Цикл шаг Температура Время Количество циклов
Начальная Денатурация 94 ° C до 98 ° C 1 минута 1
Денатурация
Отжиг
Расширение
94 ° C
5 ° C ниже T м
70 ° C до 80 ° C
От 10 до 60 секунд
30 секунд
Amplicon и зависимой ДНК-полимеразы
25-35
Окончательное расширение 70-йнапример, C до 80 ° C 5 минут 1
Держите * 4 ° C 1

Таблица 2. Стандартный 3-х ступенчатый ПЦР Велоспорт.

* Большинство тепловыми велосипедистов есть возможность сделать паузу на 4 ° C до бесконечности в конце цикла.

70 ° C до 80 ° C
2-х ступенчатый ПЦР Велоспорт
Цикл шаг Температура Время Количество циклов
Начальная Денатурация 94 ° C до 98 ° C 1 минута 1
Денатурация
Отжиг / Расширение
От 10 до 60 секунд
Amplicon и зависимой ДНК-полимеразы
25-35
Окончательное расширение 70 ° C до 80 ° C 5 минут 1

Таблица 3. 2-х ступенчатый ПЦР Велоспорт.

Горячий старт ПЦР Велоспорт
Цикл шаг Температура Время Циклы
Начальная Денатурация 60 ° C до 95 ° C 5 минут добавьте ДНК-полимеразы 1
Денатурация
Отжиг
Расширение
94 ° C
5 ° C ниже T м
70 ° C до 80 ° C
От 10 до 60 секунд
30 секунд
Amplicon и зависимой ДНК-полимеразы
25-35
Окончательное расширение 70 ° C до 80 ° C 5 минут 1

Таблица 4. Горячий старт ПЦР Велоспорт.

Touchdown PCR Велоспорт
Цикл шаг Температура Время Циклы
Начальная Денатурация 94 ° C до 98 ° C 1
Денатурация
Отжиг
Расширение
94 ° C
X = 10 ° С выше Т м
70 ° C до 80 ° C
От 10 до 60 секунд
30 секунд
Amplicon и зависимой ДНК-полимеразы
2
Денатурация
Отжиг


Расширение
94 ° C
X-1 ° C уменьшить 1 ° С каждые другой цикл
70 ° C до 80 ° C
От 10 до 60 секунд
30 секунд
Amplicon и полимеразной зависимость
28
Денатурация
Отжиг
Расширение 94 ° C
5 ° C ниже T м
70 ° C до 80 ° C
От 10 до 60 секунд
30 секунд
Amplicon и зависимой ДНК-полимеразы
20-25
Окончательное расширение 70 ° C до 80 ° C 5 минут 1

Таблица 5. Touchdown PCR Велоспорт.

Замедление ПЦР Велоспорт
Цикл шаг Temтемпература Время Циклы
Начальная Денатурация 94 ° C до 98 ° C 1 минута 1
Денатурация
Отжиг
Расширение
94 ° C
X ° C = 10 ° С выше Т м
70 ° C до 80 ° C
От 10 до 60 секунд
30 секунд
Amplicon и полимеразной зависимость
2
Денатурация
Отжиг


Расширение
94 ° C
X-1 ° C уменьшить 1 ° С каждые другой цикл
70 ° C до 80 ° C *
От 10 до 60 секунд
30 секунд
mplicon и полимеразной зависимость
28
Денатурация
Отжиг
Расширение
94 ° C
5 ° C ниже T м
70 ° C до 80 ° C
От 10 до 60 секунд
30 секунд
Amplicon и полимеразной зависимость
20-25
Окончательное расширение 70 ° C до 80 ° C 5 минут 1

Таблица 6. Замедление ПЦР Велоспорт.

* Для замедления ПЦР, рампы скорость снижается до 2,5 ° С с-1 при скорости охлаждения 1,5 ° C с -1 для отжига циклы.

Основной раствор Объем добавляли к 50 мкл реакции 13 X дрожжей Master Mix 13 X фага Master Mix Конечная концентрация
Стерильные H 2 O достаточное количество до 50 мкл = 31 мкл или 30,5 достаточное количество до 650 мкл = 396,5 достаточное количество до 520 мкл = 403 мкл
ПЦР-буфера 10X 5 мкл 65 мкл 65 мкл 1X
10 мМ 1 мкл 13 мкл 13 мкл 200 мкМ
MgCl 2 Титрование Добавлено в каждой реакции Добавлено в каждой реакции Добавлено в каждой реакции Переменную увидеть титрования
Прямой праймер 20 мкМ = 20 пмоль / мкл 1 мкл 13 мкл 13 мкл 20 пмоль
Обратный праймер 20 мкМ = 20 пмоль / мкл 1 мкл 13 мкл 13 мкл 20 пмоль
Шаблона ДНК 2 нг / мкл фага или 10 нг / мкл дрожжевой 0,5 мкл фага или 1 мкл дрожжей 6,5 мкл 13 мкл ~ 10 7 молекул фага или ~ 10 5 молекул дрожжей
Полимеразная 0,5 ед / мкл ** 0,5 мкл 6,5 мкл 6,5 мкл 0,5 ед / Реакция
40 мкл + 10 (титрование) мкл / Реакция ТИТРОВАНИЯ
[MgCl 2] 0,00 ммоль 0,5 мМ 1,0 мМ 1,5 мм 2,0 мМ 2,5 мМ 3,0 мМ 3,5 мм 4,0 мМ 4,5 мм 5,0 ммоль
MgCl 2 0,00 мкл 1,00 мкл 2,00 мкл 3,0 мкл 4,00 мкл 5,00 мкл 6,00 мкл 7,00 мкл 8,00 мкл 9,00 мкл 10,00 мкл
H 2 O 10,00 мкл 9,00 мкл 8,00 мкл 7,00 мкл 6,00 мкл 5,00 мкл 4,00 мкл 3,00 мкл 2,00 мкл 1,00 мкл 0,00 мкл

<сильный> Таблица 7. Титрование Mg 2 +, используемые в рисунке 3.

Рисунок 1
Рисунок 1. Общие проблемы, которые возникают с грунтовки и 3-х ступенчатый ПЦР-амплификации ДНК-мишени. (А) Self-отжига праймеров приводит к образованию вторичной структуры петля шпильки. Следует отметить, что грунтовки не всегда отжиг при крайних и может образовывать более мелкие структуры цикла. (Б) Primer отжига друг с другом, а не ДНК-матрицы, создавая грунтовка димеров. После отжига праймеров друг к другу, они удлиненной на грунтовку целей. (С) циклов ПЦР создания конкретных ампликона. Стандартный 3-х ступенчатый ПЦР велосипедные включают денатурация шаблона ДНК, отжига праймеров и расширение целевой ДНК (ампликонов) ДНК-полимеразы.

Рисунок 2
Рисунок 2. Ice ведро с Reagродителей, пипетки, и стойки, необходимые для ПЦР. (1). P-200 пипетки (2). P-1000 пипетки (3). P-20 пипетки (4). P-10 пипетки (5). 96 ячейках и 0,2 мл тонкостенных труб ПЦР (6). Реагенты в том числе Taq полимеразы, 10х ПЦР буфер, MgCl 2, стерильная вода, дНТФ, грунтовки, и шаблона ДНК, (7.) 1.8 мл трубы и стойки.

Рисунок 3
Рисунок 3. Пример Mg 2 + титрования используется для оптимизации ПЦР эксперимент с использованием стандартных 3-х ступенчатый ПЦР протокола. (А) С. CEREVISIAE дрожжевой геномной ДНК был использован в качестве шаблона для усиления 2098 б.п. GAL3 ген. В полос 1 - 6, где Mg 2 + концентрация слишком мала, то либо не образуется продукт (полосы 1-5) или очень мало продукта, образующегося (дорожка 6). Дорожки 7 - 11 представляют собой оптимальные концентрации Mg 2 + для этого эксперимента ПЦР как указано наличие продукта ампликона 2098 базисных пунктов. (Б) uncharacteriZED mycobacteriophage геномной ДНК шаблон используется для усиления 566 б.п. ампликона. Дорожки 1 - 4, Mg 2 + концентрация слишком мала, о чем свидетельствует отсутствие продукта. Дорожки 5 - 11 представляют собой оптимальные концентрации Mg 2 + для этой ПЦР как указано в присутствии 566 продуктов ампликона кб. (С). С. CEREVISIAE дрожжевой геномной ДНК был использован в качестве шаблона для усиления 2098 б.п. GAL3 ген, как указано в панели. Тем не менее, температура отжига была снижена с 61 ° C до 58 ° C, в результате неспецифических полос ПЦР с переменной длиной производству эффект смазывания на агарозном геле. Дорожки 1 - 4, в которых Mg 2 + концентрация слишком мала, нет продукта, образующегося. Дорожки 5 - 8 представляют собой оптимальные концентрации Mg 2 + для этой ПЦР с точки зрения наличия клеветы и полоса вокруг 2098 кб размер продукта ампликона. Переулки 9 - 11, свидетельствуют о чрезмерно жестких условиях, не продукт формируется. (Ас) Lanes 12 negatiве управления, которые не содержали ДНК-матрицы. Лейн M (маркер) был загружен с лестницы НЭБ 1 КБ.

Рисунок 4
Рисунок 4. Стерильные пробирки для ПЦР. (1). 1,8 мл трубки (2). 0,2 мл отдельные тонкостенные трубки ПЦР (3). 0,2 мл полоса тонкостенных труб ПЦР и шапки.

Рисунок 5
Рисунок 5. Термоциклер. Закрытое термоциклер левое изображение. Право изображение содержит 0,2 мл тонкостенных труб ПЦР помещают в нагревательный блок открытого термоциклер.

Discussion

ПЦР стала незаменимым инструментом в арсенале биологических наук. ПЦР изменил курс науки позволяет биологам уступить власть над геномов, и сделать гибридные гены с новыми функциями, что позволяет конкретные и точные клинические испытания, получить понимание и разнообразие геномов, а также просто клонирование генов для дальнейшего биохимического анализа. ПЦР применение ограничено только воображением ученого, обладающее своей власти. Есть много книг и статей, которые описывают новые специализированные использовании ПЦР, и многие другие будут разработаны в течение следующего поколения биологической науки. Однако, несмотря на ожидаемое подходы, фундаментальные основы остались прежними. ПЦР, во всем своем величии, есть в пробирке приложение для создания большого количества конкретных сегментов ДНК.

Проектирование эксперимента ПЦР требует мыслей и терпения. Результат показан на рисунке 3 иллюстрируют одно из главных каналовallenges при разработке стратегии оптимизации для ПЦР. То есть, как один параметр PCR изменится, это может сказаться на другом. Например, если начальная ПЦР проводили при неоптимальной температуры отжига (58 ° C) с оптимальным Mg 2 + концентрации 2,0 мм, то результат будет производить мазков, как показано на рисунке 3в. Попытка решить мазок может включать в себя создание условий ПЦР с реакциями, содержащий 2,0 мМ MgCl 2 и регулировки температуры отжига до 61 ° C. Однако, как показано на рисунке 3а, это не принесет какого-либо продукта. Следовательно, целесообразно для титрования реагенты, а не добавлением одного концентрации одной реакции, при устранении ложных результатов. Кроме того, наиболее распространенные изменения, которые необходимы для оптимизации эксперимента ПЦР изменить Mg 2 + концентрацию и исправить температуры отжига. Однако, если эти изменения не минимизировать или аннулировать аберрантных результатов титрования дополнительВес и / или изменение условий велосипедного протоколы, как описано в таблицах 2-6 ​​может решить проблему. Если ничего не изменить структуру праймеров и попробуйте, попробуйте еще раз.

Disclosures

Мне нечего раскрывать.

Acknowledgments

Отдельное спасибо Крис Редди в Лос-Анджелесе для создания реагентов и заливки гелей и Эрин Сандерс в Лос-Анджелесе для вдохновения, руководства и поддержки и редактирование рукописи. Я также хотел бы поблагодарить Джанкарло Costaguta и Грегори С. Пэйн для питания дрожжей ДНК генома и грунтовки для усиления GAL3 ген. Я также хотел бы поблагодарить Бхайрав Шах для съемки лабораторное оборудование и реагенты, используемые, чтобы сделать цифры 2 - 4. Финансирование этого проекта была предоставлена ​​HHMI (HHMI грант № 52006944).

Materials

Name Company Catalog Number Comments
Taq Polymeras Sigma-Aldrich D4545-25UN
dNTPs Qiagen 201225
0.2 ml Thin Wall Tubes PCR tubes Bio-Rad 223-9469
0.2 ml Thin Wall Tube caps Bio-Rad 223-9472
EDTA disodium salt dihydrate Sigma-Aldrich E5134
Trizma-HCl Sigma-Aldrich T-3253
Custom Phage Primer Invitrogen 25441F_RL6_Contig2_68k TACTGCAACGCGATGTTGCG
Custom Phage Primer Invitrogen 26007R_RL6_ Contig2_68k TCACCATCAATCGTGGCGGT
Custom Yeast Primer Integrated DNA Technologies SacI-Gal3(-256) ACCTGGAGCTCCTATTT TAACATGTGGATTTCTTGAAAGAATGAAATCG
Custom Yeast Primer Integrated DNA Technologies Gal3(1848)-SacI CGGATGGAGCTCGCGT GAAGGTAATTTTTTTTTATGTCTCCG
Thermal Cycler Bio-Rad 170-9703 My Cycler
Agarose ISC BioExpress E-3120-500
Gel electrophoresis Hoeffer Scientific Instruments Model HE33
1 kb DNA Ladder New England Biolabs N3232S
Bio Rad Power Pack Bio-Rad 164-5050 PowerPac Basic
Gel Doc system Fotodyne Incorporated FOTO/Analyst Investigator FX Workstation

DOWNLOAD MATERIALS LIST

References

  1. Albert, J., Fenyo, E. M. Simple sensitive, and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers. J. Clin. Microbiol. 28, 1560-1564 (1990).
  2. Baskaran, N., et al. Uniform amplification of a mixture of deoxyribonucleic acids with varying GC content. Genome Res. 6, 633-638 (1996).
  3. Blanchard, M. M., Taillon-Miller, P., Nowotny, P., Nowotny, V. PCR buffer optimization with uniform temperature regimen to facilitate automation. PCR Methods Appl. 2, 234-240 (1993).
  4. Borer, P. N., Dengler, B., Tinoco, I. Jr, Uhlenbeck, O. C. Stability of ribonucleic acid double-stranded helices. J. Mol. Biol. 86, 843-853 (1974).
  5. Breslauer, K. J., Frank, R., Blocker, H., Marky, L. A. Predicting DNA duplex stability from the base sequence. Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750 (1986).
  6. Chou, Q., Russell, M., Birch, D. E., Raymond, J., Bloch, W. Prevention of pre-PCR mis-priming and primer dimerization improves low-copy-number amplifications. Nucleic Acids Res. 20, 1717-1723 (1992).
  7. Coleman, W. B., Tsongalis, G. J. Diagnostics for the clinical laboration. Humana Press. (2005).
  8. D'Aquila, R. T., et al. Maximizing sensitivity and specificity of PCR by pre-amplification heating. Nucleic Acids Res. 19, 3749 (1991).
  9. Dieffenbach, C. W., Lowe, T. M., Dveksler, G. S. General concepts for PCR primer design. PCR Methods Appl. 3, S30-S37 (1993).
  10. Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K., Mattick, J. S. 'Touchdown' PCR to circumvent spurious priming during gene amplification. Nucleic Acids Res. 19, 4008 (1991).
  11. Erlich, H. A., Gelfand, D., Sninsky, J. J. Recent advances in the polymerase chain reaction. Science. 252, 1643-1651 (1991).
  12. Frey, U. H., Bachmann, H. S., Peters, J., Siffert, W. PCR-amplification of GC-rich regions: 'slowdown PCR. Nat. Protoc. 3, 1312-1317 (2008).
  13. Haqqi, T. M., Sarkar, G., David, C. S., Sommer, S. S. Specific amplification with PCR of a refractory segment of genomic DNA. Nucleic Acids Res. 16, 11844 (1988).
  14. Henke, W., Herdel, K., Jung, K., Schnorr, D., Loening, S. A. Betaine improves the PCR amplification of GC-rich DNA sequences. Nucleic Acids Res. 25, 3957-3958 (1997).
  15. Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T. J. PCR Protocols: A guide to methods and applications. Academic Press, Inc. San Diego. (1990).
  16. King, N. Methods in Molecular Biology. 630, Humana Press. (2010).
  17. Kleppe, K., Ohtsuka, E., Kleppe, R., Molineux, I., Khorana, H. G. Studies on polynucleotides. XCVI. Repair replications of short synthetic DNA's as catalyzed by DNA polymerases. J. Mol. Biol. 56, 341-361 (1971).
  18. Korbie, D. J., Mattick, J. S. Touchdown PCR for increased specificity and sensitivity in PCR amplification. Nat. Protoc. 3, 1452-1456 (2008).
  19. Kramer, M. F., Coen, D. M. Enzymatic amplification of DNA by PCR: standard procedures and optimization. Curr. Protoc. Toxicol. Appendix 3, 1-14 (2001).
  20. Kramer, M. F., Coen, D. M. The polymerase chain reaction. Curr. Protoc. Protein Sci. Appendix 4, Appendix 4J (2002).
  21. Kreader, C. A. Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein. Appl. Environ. Microbiol. 62, 1102-1106 (1996).
  22. Kwok, S., et al. Identification of human immunodeficiency virus sequences by using in vitro enzymatic amplification and oligomer cleavage detection. J. Virol. 61, 1690-1694 (1987).
  23. McConlogue, L., Brow, M. A., Innis, M. A. Structure-independent DNA amplification by PCR using 7-deaza-2'-deoxyguanosine. Nucleic Acids Res. 16, 9869 (1988).
  24. Mullis, K. B. The unusual origin of the polymerase chain reaction. Sci. Am. 262, 56-65 (1990).
  25. Mullis, K. B. Target amplification for DNA analysis by the polymerase chain reaction. Ann. Biol. Clin. (Paris). 48, 579-582 (1990).
  26. Mullis, K. B. The polymerase chain reaction in an anemic mode: how to avoid cold oligodeoxyribonuclear fusion). PCR Methods Appl. 1, 1-4 (1991).
  27. Mullis, K. B., Faloona, F. A. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol. 155, 335-350 (1987).
  28. Paabo, S., Gifford, J. A., Wilson, A. C. Mitochondrial DNA sequences from a 7000-year old brain. Nucleic Acids Res. 16, 9775-9787 (1988).
  29. Rees, W. A., Yager, T. D., Korte, J., von Hippel, P. H. Betaine can eliminate the base pair composition dependence of DNA melting. Biochemistry. 32, 137-144 (1993).
  30. Roux, K. H., Hecker, K. H. One-step optimization using touchdown and stepdown PCR. Methods Mol. Biol. 67, 39-45 (1997).
  31. Rychlik, W., Spencer, W. J., Rhoads, R. E. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res. 18, 6409-6412 (1990).
  32. Saiki, R. K., et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 239, 487-491 (1988).
  33. Saiki, R. K., et al. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science. 230, 1350-1354 (1985).
  34. Sambrook, J. A. R., David, W. Molecular Cloning A Laboratory Manual. 2, 3, Cold Spring Harbor Laboratory Press. (2001).
  35. Sarkar, G., Kapelner, S., Sommer, S. S. Formamide can dramatically improve the specificity of PCR. Nucleic Acids Res. 18, 7465 (1990).
  36. Smit, V. T., et al. KRAS codon 12 mutations occur very frequently in pancreatic adenocarcinomas. Nucleic Acids Res. 16, 7773-7782 (1988).
  37. Wilson, I. G. Inhibition and facilitation of nucleic acid amplification. Appl. Environ. Microbiol. 63, 3741-3751 (1997).
  38. Wu, R. Methods in Enzymology. 218, Academic Press, Inc. San Diego. (1993).

Comments

1 Comment

  1. Thanks for the great overview of the all-important PCR procedure. I will no doubt reference it often in the future.

    I have a PCR troubleshooting question...what do to about streaking on the gel after a successful amplification? My bands are nice and bright and where they are supposed to be, but there is a heavily-streaked "path" starting at the wells and following until the end where my bands are. Is there something I can do about my PCR conditions, or the thermocycler settings? Any comments would be appreciated.

    Reply
    Posted by: Doug E.
    September 8, 2013 - 1:23 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics