Polymerase Chain Reaction: Basic protokoll Plus Felsökning och optimering strategier

Biology
 

Summary

PCR har blivit en vanlig teknik i många molekylärbiologiska laboratorier. Förutsatt här är en sammanfattning av flera konventionella PCR-protokoll. Eftersom varje reaktion är en unik experiment optimala betingelser som krävs för att generera en produkt variera. Förstå variabler i en reaktion kommer att betydligt öka effektiviteten felsökning, vilket ökar chansen att erhålla det önskade resultatet.

Cite this Article

Copy Citation | Download Citations

Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J. Vis. Exp. (63), e3998, doi:10.3791/3998 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

I de biologiska vetenskaperna har det tekniska framsteg som katapult disciplin i gyllene åldern upptäckt. Till exempel inom mikrobiologi transformerats med tillkomsten av Anton van Leeuwenhoek s mikroskop, vilket gjorde forskarna att visualisera prokaryoter för första gången. Utvecklingen av polymerase chain reaction (PCR) är en av de innovationer som förändrat molekylära vetenskap med dess inverkan spänner otaliga subdiscipliner i biologi. Den teoretiska Processen beskrivs av Keppe och medarbetare i 1971, men det var ytterligare 14 år innan hela PCR-metoden beskrevs och experimentellt tillämpas av Kary Mullis medan Cetus Corporation 1985. Automatisering och förfining av denna metod utvecklades med införandet av en termisk stabil DNA-polymeras från bakterien Thermus aquaticus, följaktligen namnet Taq DNA-polymeras.

PCR är en Kraftenrful förstärkningsteknik som kan generera en riklig tillförsel av en specifik DNA-segment (dvs en amplikon) från endast en liten mängd utgångsmaterial (det vill säga, DNA-templat eller målsekvens). Medan enkelt och generellt problemfri, det finns fallgropar som försvårar reaktionen producerar falska resultat. När PCR misslyckas kan leda till många icke-specifika DNA-produkter av olika storlekar som visas som en stege eller smeta av band på agarosgeler. Ibland inga produkter bildas alls. Ett annat potentiellt problem uppstår när mutationer oavsiktligt introduceras i amplikonema, vilket resulterar i en heterogen population av PCR-produkter. PCR-fel kan bli frustrerande om tålamod och noggrann felsökning används för att reda ut och lösa problemet (s). Detta protokoll beskriver de grundläggande principerna för PCR, ger en metod som kommer att resultera i amplifiering av de flesta målsekvenser, och presenterar strategier för optimering av en reaktion. Genom att följa denna PCR guide, students kunna:

  • Inrättat reaktioner och termiska cykliseringsbetingelser för en konventionell PCR-experiment
  • Förstå funktionen hos olika reaktionskomponenterna och den totala effekten på en PCR-experiment
  • Designa och optimera en PCR-experiment för varje DNA-mall
  • Felsöka misslyckade PCR-experiment

Protocol

1. Utformning Primrar

Utforma lämpliga primers är avgörande för ett framgångsrikt resultat av en PCR-experiment. När man utformar en uppsättning primrar för en specifik region av DNA som önskas för amplifiering, skulle en primer para till plussträngen, som konventionellt är orienterad i riktningen 5 '→ 3' riktning (även känd som sense-eller nontemplate strängen) och den andra primern bör komplettera minussträngen, som är orienterad i 3 '→ 5' riktning (antisens-eller schablonsträngen). Det finns några vanliga problem som uppstår vid konstruktion av primers: 1) self-påkoppling av primers som resulterar i bildandet av sekundära strukturer som hårnålsöglor (Figur 1a), 2) primerhybridisering till varandra, snarare än DNA-mallen, skapar primer dimerer (fig 1b), 3) drastiskt olika smälttemperaturer (Tm) för varje primer, vilket gör det svårt att välja en glödgningstemperatur som kommer allaow båda primers att effektivt binda till sitt mål sekvens under Värmeskydd cykling (figur 1c) (se avsnitten BERÄKNA smälttemperatur (T m) och ändringar till cykling förutsättningar för mer information om T M S).

  1. Nedan finns en förteckning över variabler som bör beaktas när man utformar primers.
    1. Primer längd bör vara 15-30 nukleotidrester (baser).
    2. Optimal GC innehåll bör ligga mellan 40-60%.
    3. 3 '-änden av primrama skulle innehålla en G eller C i syfte att klämma fast primer och förhindra "andning" hos ändarna, vilket ökar primning effektivitet. DNA "andas" uppstår när slutar inte stanna glödgat, men striden eller dela isär. De tre vätebindningar i GC par hjälpa till att förhindra att andas utan även öka smälttemperaturen för de primrar.
    4. 3'-ändarna av en primeruppsättning, vilket inkluderar en plus sträng-initieringsmedlet och en minus sträng-initieringsmedlet, bör inte vara c omplementary till varandra, kan inte heller den 3 '-änden av en enda primer vara komplementär till andra sekvenser i primern. Dessa två fall resultera i bildning av primer-dimerer och håmålsstrukturer loop, respektive.
    5. Optimala smälttemperaturer (T m) för primers ligger mellan 52-58 ° C, även om området kan utvidgas till 45-65 ° C. Den slutliga Tm för båda primrarna bör inte skiljer sig mer än 5 ° C.
    6. Di-nukleotid upprepningar (t.ex. GCGCGCGCGC eller ATATATATAT) eller av enstaka körningar bas (t.ex. AAAAA eller CCCCC) bör undvikas eftersom de kan orsaka halka längs grundade segmentet av DNA och eller hårnål loop strukturer bildas. Om oundvikliga på grund av naturen av DNA-mallen, då endast innehålla upprepningar eller enstaka grunden är med maximalt 4 baser.

Anmärkningar:

  1. Det finns många datorprogram som syftar till att underlätta utformningen primer par. NCBI Primer designverktygw.ncbi.nlm.nih.gov / verktyg / primer-Blast / "target =" _blank "> http://www.ncbi.nlm.nih.gov/tools/primer-blast/ och primer3 http://frodo .wi.mit.edu/primer3 / är rekommenderade webbplatser för detta ändamål.
  2. För att undvika förstärkning av relaterade pseudogener eller homologer det kunde vara lämpligt att köra en blast på NCBI för att kontrollera målet specificitet primers.

2. Material och reagenser

  1. När du ställer in en PCR-experiment, är det viktigt att vara förberedd. Använd handskar för att undvika kontaminering av reaktionsblandningen eller reagens. Inkludera en negativ kontroll, och om möjligt en positiv kontroll.
  2. Ordna alla reagens som behövs för PCR experiment i en nyligen fylld ishink, och låt dem tina helt innan du ställer in en reaktion (figur 2). Håll reagensen på is under hela experimentet.
    • Standard-PCR-reagens innefattar enrad lämpliga primrar för den önskade mål-genen eller DNA-segment som skall amplifieras, DNA-polymeras, en buffert för den specifika DNA-polymeras, deoxinukleotider (dNTP), DNA-templat, och sterilt vatten.
    • Ytterligare reagens kan innefatta mg magnesium-salt 2 + (vid en slutlig koncentration av 0,5 till 5,0 mM), kalium-salt K + (vid en slutlig koncentration av 35 till 100 mM), dimetylsulfoxid (DMSO; vid en slutlig koncentration av 1-10% ), formamid (vid en slutlig koncentration av 1,25-10%), bovint serumalbumin (vid en slutlig koncentration av 10-100 ng / ml), och Betain (vid en slutlig koncentration av 0,5 M till 2,5 M). Tillsatser diskuteras vidare i felsökningen sektionen.
  3. Organisera laboratorieutrustning på arbetsbänken.
    • Material inkluderar PCR-rör och mössor, en PCR-rör rack, en etanol-resistent markör och en uppsättning micropipettors att avstå mellan 1 - 10 ^ (P10), 2 - 20 ^ (P20), 20 - 200 ^ (P200)och 200 - 1000 | il (P1000), såväl som en anordning för cyklisk värmebehandling.
    • När du ställer in flera PCR-experiment att alla använder samma reagens kan de skalas lämpligt och kombineras tillsammans i en master blandning (Master Mix). Detta steg kan göras i ett sterilt 1,8 ml mikrocentrifugrör (se not).
    • Att analysera de amplikoner erhållna från en PCR-experiment, reagens och utrustningar för agarosgelelektrofores krävs. Att approximera storleken av en PCR-produkt, är en lämplig, kommersiellt tillgänglig molekylvikt storleksstandard behövs.

3. Ställa in en reaktionsblandning

  1. Börja med en tabell av reagens som kommer att läggas till reaktionsblandningen (se tabell 1).
  2. Därefter etikett PCR-rör (er) med etanol-resistenta markören.
  3. Reaktionsvolymerna varierar beroende på koncentrationen av de lager reagens. De slutliga koncentrationerna(CF) för en typisk 50 pl reaktion är enligt följande.
    • X buffert (vanligen levereras av tillverkaren av DNA-polymeras; kan innehålla 15 mM MgCl2). Tillsätt 5 yl 10X buffert per reaktion.
    • 200 pM dNTP (50 | iM av vardera av de fyra nukleotiderna). Tillsätt 1 pl av 10 mM dNTP per reaktion (dATP, dCTP, dTTP och dGTP, är vid 2,5 mM vardera).
    • 1,5 mM Mg2 +. Lägg endast om det inte finns i 10X buffert eller som behövs för PCR optimering. Till exempel, för att erhålla den 4,0 mM Mg 2 + som krävs för optimal amplikonframställning i en bevarad 566 bp DNA-segmentet visat i ett okarakteriserat Mycobacteriophage tillsätt 8 | il av 25 mM MgCl2 till reaktionen (figur 3).
    • 20 till 50 pmol av varje primer. Tillsätt 1 pl av vardera 20 | iM primer.
    • Tillsätt 10 4 till 10 7-molekyler (eller ca 1 till 1000 ng) DNA-mall. Tillsätt 0,5 pl 2 ng / & mu; L genomiskt Mycobacteriophage DNA.
    • Tillsätt 0,5 till 2,5 enheter DNA-polymeras per 50 pl reaktion (se tillverkarens rekommendationer) kan till exempel lägga 0,5 pl Sigma 0,5 enheter / ul Taq DNA-polymeras.
    • Lägg QS sterilt destillerat vatten för att få en 50 pl slutlig volym per reaktion som i förväg fastställda i tabellen av reagenser (QS är en latinsk förkortning för quantum satis vilket innebär att beloppet som behövs). Således är 33 | il per reaktion som krävs för att bringa volymen upp till 50 | il. Emellertid bör det noteras att vatten tillsätts först, men kräver initialt framställning av en tabell av reagens och bestämning av volymen av alla andra reagens tillsätts till reaktionsblandningen.

4. Grundläggande PCR protokoll

  1. Placera en platta med 96 brunnar in i ishink som en hållare för de 0,2 ml tunnväggiga PCR-rör. Att låta PCR-reagens som ska läggas in i kalla 0,2 ml tunnväggiga PCR-rör kommer att bidra till att förhindra nuclease aktivitet och icke-specifik priming.
  2. Pipettera följande PCR-reagens i följande ordning i en 0,2 ml tunnväggiga PCR-rör (fig. 4): Sterilt vatten, 10 X PCR-buffert, dNTP: er, MgCl2, primrar och mall-DNA (se tabell 1). Eftersom experiment bör ha minst en negativ kontroll, och eventuellt en positiv kontroll, är det fördelaktigt att tillsätta en Huvudblandning i en 1,8 ml mikrocentrifugrör (Se förklaring i anmärkningarna).
  3. I ett separat 0,2 ml tunnväggiga PCR-rör (fig. 4) tillsätta alla reagens med undantag av templat-DNA för en negativ kontroll (öka vattenlösligheten för att kompensera för saknade volym). Dessutom bör en annan reaktion (om reagenser finns) innehåller en positiv kontroll med DNA-mall och eller primers tidigare kända för att förstärka på samma villkor som de experimentella PCR-rör.
  4. Taq DNA-polymeras lagras vanligtvis i ett 50% glycerollösning och för fullständig dispergering i reaktionsblandningen kräver försiktig blandning av PCR-reagens genom att pipettera upp och ner under minst 20 gånger. Den mikropipett bör sättas till ungefär halv reaktion volymen Master Mix vid blandning, och försiktighet bör vidtas för att undvika att införa bubblor.
  5. Sätt lock på 0,2 ml tunnväggiga PCR-rör och placera dem i den termiska cykler (Figur 5). När väl locket till den termiska cyklem är ordentligt stängd starta programmet (se tabell 2).
  6. När programmet är klart, kan de 0,2 ml tunnväggiga PCR-rör skall avlägsnas och förvaras vid 4 ° C. PCR-produkter kan detekteras genom att ladda alikvoter av varje reaktion i brunnar i en agarosgel därefter färgning av DNA som har migrerat in i gelén efter elektrofores med etidiumbromid. Om en PCR-produkt finns, kommer etidiumbromid inskjuta mellan baserna i DNA-strängar, vilket band som visualiseras med en UV-lampan. </ Li>

Anmärkningar:

  1. När du ställer in flera PCR-experiment, är det fördelaktigt att montera en blandning av reagenser som är gemensamma för alla reaktioner (dvs Master Mix). Vanligtvis cocktail innehåller en lösning av DNA-polymeras, dNTP, reaktionsbuffert och vatten monteras till en 1,8 ml mikrocentrifugrör. Mängden av varje reagens till Master Mix är lika med det totala antalet reaktioner plus 10% avrundas uppåt till närmaste hela reaktionen. Till exempel, om det finns 10 x 0,1 = 1 reaktion sedan (10 + 1) x 5 ^ 10 x buffert lika 55 pl 10X buffert för Master Mix. Reagensen i Master Mix blandas väl genom att försiktigt pumpande av kolven i en mikropipett upp och ned omkring 20 gånger såsom beskrivits ovan. Varje PCR-rör mottager en alikvot av Master Mix till vilken DNA-mallen, som krävs för dess primrar och experiment-specifika reagens tillsättes sedan (se tabell 1 och 7).
  2. Following webbplats erbjuder en miniräknare för att bestämma antalet kopior av en mall DNA ( http://www.uri.edu/research/gsc/resources/cndna.html ). Det totala antalet kopior av dubbelsträngad DNA kan beräknas med följande ekvation:
    Antal kopior av DNA = (DNA belopp (ng) x 6.022x10 23) / (längden av DNA-x 1x10 9 ng / ml x 650 Dalton)
    Beräkning av antalet kopior av DNA används för att bestämma hur mycket templat behövs per reaktion.
  3. Falska positiva kan förekomma som en konsekvens av överfört från en annan PCR-reaktion som skulle kunna visualiseras som multipla oönskade produkter på en agarosgel efter elektrofores. Därför är det klokt att använda rätt teknik, inkluderar en negativ kontroll (och positiv kontroll när det är möjligt).
  4. Medan etidiumbromid är den vanligaste fläcken feller nukleinsyror Det finns flera säkrare och mindre giftiga alternativ. Följande webbplats beskriver flera av de alternativ, inklusive Methylene Blue, Crystal Violet, SYBR säker och Gel Red tillsammans med beskrivningar av hur man använder och detektera den slutliga produkten ( http://bitesizebio.com/articles/ethidium-bromide-the- alternativ / ).
  5. Medan de flesta moderna PCR maskiner använder 0,2 ml rör, kan vissa modeller kräver reaktioner i 0,5 ml rör. Se din värmecykler manual för att bestämma lämplig storlek röret.

5. Beräkning smälttemperatur (Tm)

  1. Med kännedom om smälttemperaturen (Tm) av primrama är absolut nödvändigt för en framgångsrik PCR-experiment. Även om det finns flera T m räknare finns tillgängliga är det viktigt att notera att dessa beräkningar är en uppskattning av den faktiska T m på grund brist på specifik information om en viss reaktion och antaganden gjorda i algoritmerna för T m räknare själva. Dock närmast intilliggande termodynamiska modeller föredra framför den mer konventionella beräkningen: T m ≈ 4 (GC) + 2 (AT). Den förstnämnda kommer att ge mer exakt T m uppskattning eftersom det tar hänsyn till stapling energi angränsande baspar. Den senare används oftare eftersom beräkningarna är enkel och kan göras snabbt för hand. Se Felsökning för information om hur olika PCR förhållanden och tillsatser påverkar smälttemperatur.
    För beräkning av T m värdena genom närmaste-granne termodynamiska modeller, en av följande räknare rekommenderas:
    http://www6.appliedbiosystems.com/support/techtools/calc/
    edu / ~ Zimmer / oligoTMcalc.html "target =" _blank "> http://www.cnr.berkeley.edu/ ~ Zimmer / oligoTMcalc.html
    http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/
    http://www.finnzymes.com/tm_determination.html~~V
    http://mobyle.pasteur.fr/cgi-bin/portal.py? # former :: smältpunkter

6. Ställa in Thermal Cycling Villkor

  1. PCR värmecykler snabbt värma och kyla reaktionsblandningen, vilket möjliggör för värmeinducerad denaturering av duplex-DNA (strängseparation), annealing av primers till plus-och minus-strängarna i DNA-mallen, och töjning av PCR-produkten. Cykeltider beräknas baserat på storleken av mallen och GC-halten i DNA. Den allmänna Formulen börjar med ett initialt denatureringssteg vid 94 ° C till 98 ° C beroende på den optimala temperaturen för DNA-polymerasaktivitet och GC-halten i DNA-mallen. En typisk reaktion startar med en minut denaturering vid 94 ° C. Längre än 3 minuter kan inaktivera DNA-polymeras, förstör dess enzymatiska aktivitet. En metod, känd som hot-start-PCR, sträcker drastiskt den initiala denatureringen tid från 3 minuter till 9 minuter. Med het-start PCR, är DNA-polymeraset tillsättas efter den initiala överdriven denatureringssteget är avslutad. Detta protokoll modifiering undviker sannolikt inaktivering av DNA-polymeras-enzym. Se avsnittet Felsökning i detta protokoll för mer information om hot start PCR och andra alternativa metoder.
  2. Nästa steg är att sätta den termiska cyklem att initiera den första av 25 till 35 omgångar av ett tre-stegs temperaturcykel (tabell 2). Medan en ökning av antalet cykler över 35 kommer att resultera i enstörre mängd av PCR-produkter, resulterar alltför många rundor ofta i anrikning av icke önskvärda sekundära produkter. De tre temperaturen steg i en enda cykel utföra tre uppgifter: det första steget denaturerar mallen (och i senare cykler, amplikoner liksom), gör det andra steget optimala påkoppling av primers och det tredje steget tillåter DNA-polymeras att binda till DNA-mallen och syntetisera PCR-produkten. Varaktigheten och temperaturen av varje steg i en cykel kan ändras för att optimera produktionen av den önskade amplikon.
    Tiden för denatureringssteget hålls så kort som möjligt. Vanligen 10 till 60 sekunder är tillräcklig för de flesta DNA-mallar. Denaturering och temperaturen kan variera beroende på den GC-halten i DNA-mallen, liksom ramphastighet, som är den tid det tar för cyklisk värmebehandling för att ändra från en temperatur till nästa. Temperaturen för detta steg är vanligen samma som den som användes för den initiala denatureringen fasen(Steg 1 ovan, t.ex., 94 ° C).
    En 30 sekunders glödgningssteget följande under cykeln vid en temperatur som ca 5 ° C under den skenbara Tm för primrarna (helst mellan 52 ° C till 58 ° C).
    Cykeln avslutas med en förlängning steg. Temperaturen beror på det DNA-polymeras väljas för experimentet. Exempelvis har Taq DNA-polymeras en optimal töjning temperatur av 70 ° C till 80 ° C och kräver 1 minut till långsträckta de första 2 kb, då kräver en extra minut för varje ytterligare amplifierade 1 kb. Pfu DNA-polymeras är ett annat termostabilt enzym som har en optimal töjning temperatur av 75 ° C. Pfu DNA-polymeras rekommenderas för användning i PCR och primer reaktioner förlängning som kräver hög trohet och kräver 2 minuter för varje 1 kb som skall amplifieras. Se tillverkarens rekommendationer för exakta förlängning temperaturer och förlängning tid som anges för varje specifik DNA-polymeras.
  3. Taq DNA-polymeras, tillåter tillsats av en adeninrest till 3'-ändarna av alla PCR-produkter. Denna modifiering åstadkoms genom den terminala transferasaktiviteten hos Taq DNA-polymeras och är användbar för efterföljande molekylär kloning förfaranden som kräver en 3'-överhäng.
  4. Avslutandet av reaktionen åstadkoms genom kylning av blandningen till 4 ° C och / eller genom tillsats av EDTA till en slutkoncentration av 10 mM.

7. Viktiga överväganden vid felsökning PCR

Om standard PCR-betingelser inte ger önskat amplikonet är PCR optimering nödvändigt för att uppnå bättre resultat. Stringensen av en reaktion kan moduleras så att specificiteten justeras genom att förändra variablerna (t.ex. reagenskoncentrationer, cykling villkor) som påverkar resultatet av amplicon profilen. Till exempel, om reaktionen inte är tillräckligt stränga kommer många falska amplikoner genereras med variabla längder. Om reaktionen är alltför stränga, kommer ingen produkt framställas. Felsökning PCR-reaktioner kan vara en frustrerande strävan ibland. Emellertid kan noggrann analys och en god förståelse av de reagens som används i ett PCR-experiment reducera den mängd tid och försök som behövs för att erhålla de önskade resultaten. Av alla de överväganden som påverkar PCR stringens, titrering av Mg 2 + och / eller manipulera glödgningstemperaturer sannolikt kommer att lösa de flesta problem. Men innan du ändrar något, vara säker på att ett felaktigt resultat inte beror på mänskliga fel. Börjar med att bekräfta alla reagens sattes till en given reaktion, och att de reagens som inte är förorenade. Ta också del av den felaktiga resultat, och ställa följande frågor: Är primerdimerer synliga på gelén efter electrophomotstånd (dessa kör som små band <100 B nära botten av banan)? Är det icke-specifika produkter (band som migrerar vid en annan storlek än den önskade produkten)? Fanns det en brist på någon produkt? Är mål-DNA på en plasmid eller i ett genomiskt DNA-extrakt? Dessutom är det klokt att analysera GC innehållet i den önskade amplicon.

  1. Först avgöra om någon av PCR-reagens är katastrofala för din reaktion. Detta kan uppnås genom framställning av nya reagens (t.ex. färska arbetsstamlösningar, nya spädningar), och sedan systematiskt tillsätta en ny reagens vid en tidpunkt till reaktionsblandningarna. Denna process kommer att bestämma vilken reagens var boven i dramat för den misslyckade PCR experimentet. I fallet med mycket gamla DNA: t, vilket ofta ackumuleras inhibitorer, har det visats att tillsats av bovint serumalbumin kan bidra till att lindra problemet.
  2. Primerdimerer kan bildas när primrar företrädesvis själv härda eller para till den andra primern i reaktionen. Om detta inträffar, en litenprodukt av mindre än 100 bp visas på agarosgel. Starta genom att ändra förhållandet mellan mall och primer; om primerkoncentrationen är i extrem överskott över mallkoncentrationen, då de primrar kommer att vara mer benägna att para till själva eller med varandra över DNA-mallen. Lägga DMSO och eller med hjälp av en varm start termisk cykling metod kan lösa problemet. I slutändan kan det vara nödvändigt att utforma nya primers.
  3. Icke-specifika produkter bildas vid PCR stringens är alltför låg resulterar i icke-specifika PCR-band med varierande längder. Detta producerar en stege effekt på en agarosgel. Det är då lämpligt att välja PCR förhållanden som ökar stringensen. En utstryk av olika storlekar kan också härröra från primrar utformade för att höggradigt repetitiva sekvenser när amplifiering genom-DNA. Emellertid kan samma primrar amplifierar en målsekvens i en plasmid utan att stöta på samma problem.
  4. Bristen på PCR-produkter beror sannolikt på reaktionsbetingelsernasom är alltför stränga. Primerdimerer och håmålsstrukturer loop som bildar de primrar eller i denaturerad mall-DNA kan också förhindra amplifiering av PCR-produkter, eftersom dessa molekyler kan inte längre basparas med den önskade DNA-motsvarighet.
  5. Om GC-innehållet inte har analyserats, är det dags att göra det. PCR av GC rika regioner (GC-halt> 60%) utgör några av de största utmaningarna för PCR. Det finns emellertid många tillsatser som har använts för att lindra de problem.

8. Manipulera PCR-reagens

Att förstå funktionen av reagens som används för konventionell PCR är kritisk när det först bestämma hur man bäst att ändra reaktionsförhållandena för att erhålla den önskade produkten. Framgång kan helt enkelt förlita sig på att förändra koncentrationen av MgCl 2, KCl, dNTPs, primers, mall DNA, eller DNA-polymeras. Emellertid kan den felaktiga koncentrationen av sådana reagens leder till falska resultat, minskar stringency av reaktionen. När du felsöker PCR bör endast en reagens kan manipuleras på en gång. Emellertid kan det vara klokt att titrera manipulerade reagens.

  1. Magnesiumsaltet Mg 2 + (slutlig reaktionsvolym koncentration av 0,5 till 5,0 mM)
    Termostabila DNA-polymeraser kräver närvaro av magnesium för att fungera som en kofaktor under reaktionsprocessen. Ändra magnesium koncentrationen är en av de enklaste reagenser att manipulera med kanske störst påverkan på stringens PCR. I allmänhet kommer PCR-produkten utbyte öka med tillsats av större koncentrationer av Mg 2 +. Emellertid ökade koncentrationer av Mg 2 + kommer också att minska den specificitet och tillförlitlighet när det gäller DNA-polymeras. De flesta tillverkare innefattar en lösning av magnesiumklorid (MgCl2) tillsammans med DNA-polymeras och en 10 X PCR-buffert-lösning. De 10 x PCR-buffert-lösningar kan innehålla 15 mM MgCl2, vilket är tillräckligt för en typisk PCR-reaktion, eller den kan tillsättas separat vid en koncentration optimerad för en särskild reaktion. Mg 2 + förbrukas inte i reaktionen, men reaktionen kan inte gå vidare utan att det är närvarande. När det finns för mycket Mg 2 +, kan den förhindra fullständig denaturering av DNA-mallen genom att stabilisera duplex strängen. För mycket Mg 2 + kan också stabilisera falsk påkoppling av primers till felaktiga mallsidor och minska specificitet resulterar i oönskade PCR-produkter. När det inte finns tillräckligt Mg2 +, kommer reaktionen inte fortgå, vilket resulterar i ingen PCR-produkt.
  2. Kaliumsalt K + (slutlig reaktionsvolym koncentration av 35 till 100 mM)
    Längre PCR-produkter (10 till 40 kb) nytta av att reducera kaliumsalt (KCl) från dess normala 50 mM reaktion koncentration, ofta i samband med tillsats av DMSO och / eller glycerol. Om den önskade amplikon är lägre än 1000 bp och långa icke-specifika produkter bildar, specificihet kan förbättras genom att titrera KCl, ökning av koncentrationen i 10 mM steg upp till 100 mM. Ökning av saltkoncentrationen gör det möjligt kortare DNA-molekyler för att denaturera företrädesvis till längre DNA-molekyler.
  3. Deoxinukleotid-5'-trifosfater (slutlig reaktionsvolym koncentration av 20 och 200 ^ M vardera)
    Deoxinukleotid 5'-trifosfater (dNTP) kan orsaka problem för PCR om de inte är på lämpliga ekvivalenta koncentrationer (dvs. [A] = [T] = [C] = [G]) och / eller på grund av deras instabilitet från upprepad frysning och upptining. Den vanliga dNTP-koncentration är 50 | iM av vardera av de fyra dNTP. Emellertid kan PCR-tolerera koncentrationer mellan 20 och 200 ^ M vardera. Lägre koncentrationer av dNTP kan öka både specificitet och trohet reaktionen, medan alltför dNTP koncentrationer kan faktiskt hämma PCR. Emellertid längre PCR-fragment, kan en högre dNTP-koncentration erfordras. En stor förändring i dNTP-koncentrationen kan nödvändiggöra en motsvarande förändring i koncentrationen av Mg 2 +.
  4. Termiska stabila DNA-polymeraser
    PCR enzymer och buffertar i samband med dessa enzymer har kommit en lång väg sedan den första Taq DNA-polymeras först användes. Således kan välja en lämplig enzym vara till hjälp för att få önskade amplicon produkter. Exempelvis användning av Taq DNA-polymeras kan föredras över Pfu DNA-polymeras om processivitet och / eller tillsats av en adeninrest till 3'-ändarna av PCR-produkt önskas. Tillsats av en 3 'adenin har blivit en användbar strategi för kloning av PCR-produkter in i TA-vektorer whit 3' tymin överhäng. Men om trohet är viktigare ett enzym såsom Pfu kan vara ett bättre val. Flera tillverkare har en rad specifika DNA-polymeras är avsedda för särskilda behov. Ta en titt på reaktionsbetingelserna och egenskaper hos den önskade amplikon, och sedan matcha PCR experimentera med lämpliga DNA polymerase. De flesta tillverkar har tabeller som stödet DNA-polymeras val genom att lista egenskaper såsom trohet, avkastning, hastighet, optimala längder mål, och om det är användbart för GC rika förstärkning eller varmstart PCR.
  5. Templat-DNA
    DNA-kvalitet och renhet kommer att ha en väsentlig effekt på sannolikheten för en lyckad PCR experiment. DNA-och RNA-koncentrationen kan bestämmas med hjälp av deras optiska densitetsmätningar vid 260 nm (OD 260). Massan av renade nukleinsyror i lösning beräknas vid 50 | ig / ml av dubbelsträngat DNA eller 40 | ig / ml för antingen RNA eller enkelsträngat DNA vid en OD 260 = 1,0. DNA-extraktion föroreningar är vanliga inhibitorer i PCR och bör noga undvikas. Vanliga DNA extraktion inhibitorer av PCR inkluderar protein, RNA, organiska lösningsmedel och rengöringsmedel. Användning av den högsta absorptionen av nukleinsyror OD 260 jämfört med den för proteiner OD280 (OD 260/280), är det möjligt att fastställbarae en uppskattning av renhet av extraherat DNA. Idealt är förhållandet OD 260/280 mellan 1,8 och 2,0. Lägre OD 260/280 är ett tecken på protein och / eller lösningsmedel förorening som med all sannolikhet kommer att vara problematiskt för PCR.
    Förutom att kvaliteten på mall-DNA, optimering av mängden DNA kan vara till stor nytta av resultatet av en PCR-experiment. Fastän det är lämpligt att bestämma kvantiteten i ng / pl, vilket ofta är utsignalen för moderna nanospectrophotometers, är den relevanta enhet för en framgångsrik PCR-experiment antalet molekyler. Dvs hur många kopior av DNA-mall innehåller en sekvens som är komplementär till de PCR-primers? Optimala målmolekyler är mellan 10 April-10 juli molekyler och kan beräknas enligt beskrivningen i avsnittet ovan.

9. Additiva Reagens

Additiva reagenser kan ge resultat när allt annat misslyckas. Förstå reagenseroch vad de används för är kritisk vid bestämning vilken reagens kan vara mest effektiv när det gäller erhållande av den önskade PCR-produkten. Tillsätta reagens till reaktionsblandningen kompliceras av det faktum att manipuleringen av en reagens kan påverka den användbara koncentrationen av ett annat reagens. Utöver de reagenser som anges nedan, egna kommersiellt tillgängliga tillsatser finns från många bioteknikföretag.

10. Tillsatser som gynnar GC Rich mallar

  1. Dimetylsulfoxid (slutlig reaktionsvolym koncentration av 1-10% DMSO)
    I PCR-experiment där mall-DNA är särskilt GC-rika (GC-innehåll> 60%), tillsats av DMSO kan öka reaktionshastigheten genom att störa basparning och effektivt sänka Tm. Vissa Tm räknare innefattar en variabel post för tillsats av den koncentration av DMSO som önskas i den PCR-experiment. Kan dock lägga till mer än 2% DMSO kräver att lägga till mer DNA-polymeras som det har varit demonenstrated att inhibera Taq DNA-polymeras.
  2. Formamid (slutlig reaktion koncentration av 1,25-10%)
    Liksom DMSO, formamid stör också baspaming samtidigt öka stringens primerhybridisering, vilket resulterar i mindre icke-specifik priming och ökad förstärkning effektivitet. Formamid har också visat sig vara en förstärkare för GC-rika mallar.
  3. 7-deaza-2'-deoxiguanosin-5'-trifosfat (slutlig reaktion koncentration av DC 7 GTP, 3 st 7 GTP: 1 dGTP 50 M)
    Med 3 delar, eller 37,5 iM, av guanosin basen analoga fm 7 GTP i samband med 1 del, eller 12,5 M kommer dGTP destabilisera bildandet av sekundära strukturer i produkten. Som amplikon eller mall-DNA denatureras, bildar ofta sekundära strukturer såsom hårnålsöglor. Införlivande av DC 7 GTP i DNA amplikonen kommer att förbjuda bildandet av dessa avvikande strukturer.

Obs:

7 GTP dämpar signalen etidiumbromidfärgning varför det används i ett förhållande 3:1 med dGTP.

  1. Betain (slutlig reaktion koncentration av 0,5 till 2,5 m)
    Betain (N, N, N-trimetylglycin) är en zwitterjonisk aminosyraanalog som minskar och kan även eliminera DNA-beroende smälttemperaturen på nukleotidsammansättning. Det används som en tillsats för att underlätta PCR-amplifiering av GC-rika mål. Betain används ofta i kombination med DMSO och kan avsevärt förbättra chanserna för amplifiering mål-DNA med högt GC-innehåll.

11. Tillsatser som hjälper PCR i närvaro av inhibitorer

  1. Icke joniska detergenter fungera för att undertrycka sekundär strukturbildning och hjälper till att stabilisera DNA-polymeras. Icke joniska detergenter såsom Triton X-100, Tween 20, eller NP-40 kan användas vid reaktionsbetingelser koncentrationer av 0,1 till 1% för att öka amplikonframställning. Emellertid concentrtioner över 1% kan vara hämmande för PCR. Förekomsten av icke-joniska detergenter minskar PCR stringens, kan leda till falska produktbildning. Men kommer deras användning neutralisera också hämmande effekterna av SDS, en tillfällig förorening i protokoll DNA-extraktion.
  2. Tillsats av specifika proteiner såsom bovint serumalbumin (BSA) användes vid 400 ng / pl och / eller T4-gen 32-protein vid 150 ng / pl stöd PCR i närvaro av hämmare såsom FeCls 3, hemin, fulvosyra, humussyra, garvsyror, eller utdrag ur avföring, sötvatten och saltvatten. Det finns dock vissa PCR-inhibitorer, inklusive gallsalter, bilirubin, EDTA, NaCl, SDS eller Triton X-100, inte lindras genom tillsats av antingen BSA eller T4-gen 32-protein.

12. Ändringar Cykling Villkor

  1. Optimera glödgningstemperaturen kommer att öka något PCR-reaktion och bör övervägas i kombination med andra tillsatser och / eller tillsammans med andra mo difications till cykling förhållanden. Således, för att beräkna den optimala hybridiseringstemperaturen följande ekvation användes:
    T en OPT = 0,3 T m Primer + 0,7 T M Produkt -14,9
    T m Primer beräknas som T m av mindre stabila paret med hjälp av ekvationen:
    T m Primer = ((AH ​​/ (AS + R x ln (c / 4))) -273,15 + 16,6 log [K +] Var AH är summan av de närmaste förändringar granne entalpi för hybrider, AS är summan av närmaste granne-entropi förändringar; R är gaskonstanten (1,99 cal K-1 mol-1), C är primern koncentration, och [K +] är kaliumhalten.
    Den senare ekvationen kan beräknas med hjälp av någon av T m räknare som räknas upp på följande webbplats:
    RS / smältning / sup_mat / servers_list.html "target =" _blank "> http://protein.bio.puc.cl/cardex/servers/melting/sup_mat/servers_list.html
    Tm Produkten beräknas enligt följande:
    Tm Produkt = 0,41 (% GC) + 16,6 log [K +] - 675/product längd
    För de flesta PCR-reaktioner av koncentrationen av kalium ([K +]) kommer att vara 50 mM.
  2. Hot start PCR är en mångsidig modifiering i vilken den ursprungliga denaturering tid ökat dramatiskt (tabell 4). Denna modifiering kan införlivas med eller utan andra modifieringar cykelbetingelser. Vidare är det ofta används i samband med tillsatser för temperamentsfull amplikon-bildning. Faktum är att hot start PCR allt ingår som en vanlig del av allmänna cykling villkor. Hot start har visats öka amplikon avkastning, samtidigt som man ökar specificiteten och trohet av reaktionen.Den logiska grunden bakom varmstart PCR är att eliminera primer-dimer och icke-specifik primning som kan resultera som en konsekvens av att upprätta det reaktion under Tm. Sålunda värms en typisk varmstart reaktion provet till en temperatur över den optimala Tm, åtminstone till 60 ° C innan varje amplifiering kan ske. I allmänhet sätts DNA-polymeras innehållna från reaktionen under den initiala, långsträckta, denaturerande tid. Även om andra komponenter i reaktionen ibland utelämnas i stället för DNA-polymeras, här kommer vi att fokusera på DNA-polymeras. Det finns flera metoder som tillåter DNA-polymeras för att vara inaktiv eller fysikaliskt separerade tills den initiala denatureringen tid har avslutats, inklusive användning av en fast vax barriär, anti-DNA antikroppar polymeras, och proteiner accessoriska. Alternativt kan DNA-polymeras helt enkelt sättas till reaktionen efter den initiala denatureringen cykeln är fullbordad.
  3. Sättningen PCR (TD-PCR) ärsyftar till att ta del av gissa arbeta ute hos T m beräkning begränsningar genom att bracketing de beräknade glödgningstemperaturer. Konceptet är att utforma två faser cykelbetingelser (tabell 5). Den första fasen arbetar successivt lägre glödgningstemperaturer varannan cykel (traditionellt 1,0 ° C), med start vid 10 ° C över och slutar vid den beräknade T m eller något under. Fas två utnyttjar standard 3-steg betingelser med annealing temperatur inställd på 5 ° C under den beräknade Tm under ytterligare 20 till 25 cykler. Funktionen av den första fasen bör minska mispriming, ger en 4-faldig fördel för rätt produkt. Alltså, efter 10 cykler, skulle en 410-faldig fördel ge 4096 exemplar av rätt produkt över en falsk priming.
    • Stepdown PCR liknar TD-PCR med färre steg i den första fasen av primning. Som ett exempel, sänker den första fasen glödgningstemperaturer varjeandra cykeln med 3 ° C, med start vid 10 ° C över och med avslutning vid 2 ° C under den beräknade Tm. Liksom TD-PCR, utnyttjar fas två standard 3-steg villkor med glödgningstemperaturen inställd på 5 ° C under den beräknade T m för ytterligare 20 till 25 cykler. Detta skulle göra det möjligt att rätt produkt ett 256-faldig fördel jämfört med falska grundning produkter.
    • Avmattning PCR är helt enkelt en modifiering av TD-PCR och har varit framgångsrik för att förstärka extremt GC rika (över 83%) sekvenser (tabell 6). Konceptet tar hänsyn till en relativt ny funktion i samband med moderna termocykliska, vilket möjliggör justering av rampen hastigheten och kylningshastigheten. Protokollet utnyttjar även fm 7 GTP för att reducera bildningen 2 ° struktur som kan inhibera reaktionen. Rampen hastighet sänks till 2,5 ° C er -1 med en kylningshastighet av 1,5 ° C ar -1 för de glödgningscykler. Den första fasen inleds med en ennealing temperatur av 70 ° C och minskar glödgningstemperaturen genom 1 ° C var 3 omgångar tills den når 58 ° C. Den andra fasen fortsätter sedan med en hybridiseringstemperatur av 58 ° C under ytterligare 15 cykler.
  4. Innesluten PCR är ett kraftfullt verktyg som används för att eliminera falska produkter. Användningen av kapslade primers är särskilt användbart när det finns flera paraloga gener i en enda genomet eller när det är låg antalet kopior av en målsekvens i en heterogen population av ortologa sekvenser. Den grundläggande proceduren innefattar två uppsättningar av primrar som amplifierar en inre region av DNA. De yttre primermolekylema grenslar segmentet av intresse och används för att generera PCR-produkter som ofta ospecifik inom 20 till 30 cykler. En liten alikvot, vanligtvis omkring 5 ul av den första 50 pl reaktion, används sedan som templat-DNA under ytterligare 20 till 30 omgångar av amplifiering med användning av andra uppsättning primrar som hybridiserar till en inre position i förhållandeatt den första uppsättningen.

Andra PCR-protokoll är mer specialiserade och gå utanför ramen för denna uppsats. Exempel innefattar RACE-PCR, Multiplex-PCR, Vectorette-PCR, Kvantitativ-PCR och RT-PCR.

13. Representativa resultat

Representativa PCR-resultat genererades genom att följa de grundläggande PCR-protokoll som beskrivits ovan. Resultaten inkorporera flera felsökning strategier för att demonstrera effekten av olika reagens och på reaktionen. Gener från den knoppande jästen Saccharomyces cerevisiae och från en okarakteriserad Mycobacteriophage amplifierades i dessa experiment. Standard 3-stegs PCR-protokoll som beskrivs i tabell 2 användes för alla tre experimenten som beskrivs nedan.

Innan du ställer in PCR experimentet genom-DNA från både S. cerevisiae och Mycobacteriophage kvantifierades och späddes till en koncentration som skulle allow mellan 10 4 och 10 7 molekyler av DNA per reaktion. De arbetande lager framställdes enligt följande. Ett genomiskt jäst-DNA-framställning gav 10 4 ng / | il. En spädning till 10 ng / pl genererades genom tillsats av 48 | il i 452 pl TE-buffert med pH 8,0. Sedan S. cerevisiae genomet är cirka 12,5 Mb, 10 ng innehåller 7,41 x 10 5 molekyler. Det genomiska DNA: t Mycobacteriophage framställning gav 313 ng / | il. En spädning till 2 ng / | il genererades genom tillsats av 6,4 pl i 993,6 | il TE-buffert med pH 8,0. Denna fag DNA är ca 67 Kb. Således innehåller 1 ng 2,73 x 10 7 molekyler, som är vid den övre gränsen av DNA som allmänt används för en PCR. De arbetande lager användes sedan för att generera de lösningar huvudblandning beskrivs i Tabell 7. Experiment varierades cykelbetingelser som beskrivs nedan.

I figur 3a, genomiskt DNA från S. cerevisiae användes som en mall för att amplifieraden GAL3 genen, som kodar för ett protein involverat i metabolismen galaktos. Målet för detta experiment var att bestämma den optimala Mg2 +-koncentrationen för denna uppsättning av reagens. Ingen MgCl 2 var närvarande i den ursprungliga PCR-buffert och måste kompletteras på de koncentrationer som anges med ett intervall testas från 0,0 mM till 5,0 mM. Såsom visas i figuren, visas en PCR-produkt med den förväntade storleken (2098 bp) som börjar vid en Mg 2 + koncentration av 2,5 mM (fält 6) med en optimal koncentration på 4,0 mM (fält 9). Den rekommenderade koncentrationen från tillverkaren var 1,5 mm, vilket är det belopp som fastställs i typiska PCR buffertar. Kanske något förvånande, översteg den nödvändiga koncentrationen som behövs för produktbildning i detta experiment detta belopp.

En annan DNA-mall användes för experimentet som presenteras i Figur 3b. Genomiskt DNA från en Mycobacteriophage användes för att amplifiera en konserverad 566 bp DNA-segmentet.Liksom det tidigare experimentet, hade den optimala Mg2 +-koncentrationen kan bestämmas. Såsom visas i figur 3b, kräver amplifiering av den önskade PCR-produkten på minst 2,0 mM Mg 2 + (spår 5). Medan det inte var större variabilitet i en mängd av produkt som bildas vid ökande koncentrationer av MgCl2, var den mest PCR-produkten observerades vid 4 mM Mg 2 + (spår 9), samma koncentration som observeras för jäst GAL3 genen.

Notera att i de experiment som presenteras i fig 3A och 3B, har en diskret band erhållna med användning av de cykliska betingelser tros vara optimala baserat på primer glödgningstemperaturer. Närmare bestämt var denatureringstemperaturen 95 ° C med en hybridiseringstemperatur av 61 ° C och förlängning utfördes under 1 minut vid 72 ° C under 30 cykler. Den slutliga 5 minuters förlängning utfördes sedan vid 72 ° C. För det tredje experimentet som presenteras i Figur 3c figur 3c, vilka var en diskret band i figur 3a, blir ett utstryk av icke-specifika produkter under dessa suboptimala cykelbetingelser. Vidare, med den totala stringensen av reducerad reaktionen + en lägre mängd av Mg 2 krävs för att bilda en amplikon.

Alla tre experiment illustrerar att när Mg2 +-halten är för låg finns det ingen amplikonframställning. Dessa resultat visar också att när de båda cykliska betingelserkorrekt utformad och reagensen är vid optimala koncentrationer producerar PCR-experiment en diskret amplikon som motsvarar den förväntade storleken. Resultaten visar att det är viktigt att utföra PCR experiment vid en tillräckligt hög stringens (t.ex. diskreta band jämfört med ett utstryk). Dessutom experimenten visar att ändra en parameter kan påverka en annan parameter, vilket påverkar reaktionen resultatet.

Reagens Koncentration av stamlösningar Volym 13X **
Master Mix
Slutkoncentration
Sterilt H2O QS till 50 | il QS till 650 pl
PCR-buffert 10X 5 pl 65 pl 1X
dNTP 10 mM 1 il 13 pl 200 pM
MgCl2- 25 mM 3 il 39 pl 1,5 mM
Framåt primer 20 | iM = 20 pmol / | il 1 il 13 pl 20 pmol
Omvänd primer 20 | iM = 20 pmol / | il 1 il 13 pl 20 pmol
Templat-DNA Variabel Variabel Variabel ~ 10 5 Molekyler
Taq DNA-polymeras 5 enheter / | il * 0,5 pl 6,5 pl 2,5 enheter
50 | il / reaktion

Tabell 1. PCR-reagens i den ordning de ska läggas.

* Enheter kan variera mellan tillverkare

** Lägg till alla reagenser till Master Mix med undantag för någon i behov av titrering eller som kan vara variabel för att reaktionen. Master Mix visas i tabellen ovan beräknas för 11 reaktioner plus 2 extra reaktioner för att tillgodose pipett överföra förlusten säkerställa en tillräckligt portion till varje reaktionsrör.

Standard 3-stegs PCR Cykling
Cykelsteg Temperatur Tid Antal cykler
Initial denaturering 94 ° C till 98 ° C 1 minut 1
Denaturering
Glödgning
Förlängning
94 ° C
5 ° C under Tm
70 ° C till 80 ° C
10 till 60 sekunder
30 sekunder
Amplikon och DNA-polymeras beroende
25-35
Slutlig förlängning 70 & dt.ex., C till 80 ° C 5 minuter 1
Håll * 4 ° C 1

Tabell 2. Standard 3-steg PCR Cykling.

* De flesta värmecykler har förmågan att göra en paus vid 4 ° C under obegränsad tid vid slutet av cyklerna.

70 ° C till 80 ° C
2-stegs PCR-cykling
Cykelsteg Temperatur Tid Antal cykler
Initial denaturering 94 ° C till 98 ° C 1 minut 1
Denaturering
Annealing / förlängning
10 till 60 sekunder
Amplikon och DNA-polymeras beroende
25-35
Slutlig förlängning 70 ° C till 80 ° C 5 minuter 1

Tabell 3. 2-stegs PCR Cykling.

Hot Start PCR Cykel
Cykelsteg Temperatur Tid Cykler
Initial denaturering 60 ° C till 95 ° C 5 minut och tillsätt sedan DNA-polymeras 1
Denaturering
Glödgning
Förlängning
94 ° C
5 ° C under Tm
70 ° C till 80 ° C
10 till 60 sekunder
30 sekunder
Amplikon och DNA-polymeras beroende
25-35
Slutlig förlängning 70 ° C till 80 ° C 5 minuter 1

Tabell 4. Hot Start PCR Cykling.

Touchdown PCR Cykling
Cykelsteg Temperatur Tid Cykler
Initial denaturering 94 ° C till 98 ° C 1
Denaturering
Glödgning
Förlängning
94 ° C
X = 10 ° C över Tm
70 ° C till 80 ° C
10 till 60 sekunder
30 sekunder
Amplikon och DNA-polymeras beroende
2
Denaturering
Glödgning


Förlängning
94 ° C
X-1 ° C reducera 1 ° C varannan cykel
70 ° C till 80 ° C
10 till 60 sekunder
30 sekunder
Amplikon och polymeras beroende av
28
Denaturering
Glödgning
Förlängning 94 ° C
5 ° C under Tm
70 ° C till 80 ° C
10 till 60 sekunder
30 sekunder
Amplikon och DNA-polymeras beroende
20-25
Slutlig förlängning 70 ° C till 80 ° C 5 minuter 1

Tabell 5. Touchdown PCR Cykling.

Avmattning PCR Cykel
Cykelsteg Temperatur Tid Cykler
Initial denaturering 94 ° C till 98 ° C 1 minut 1
Denaturering
Glödgning
Förlängning
94 ° C
X ° C = 10 ° C över Tm
70 ° C till 80 ° C
10 till 60 sekunder
30 sekunder
Amplikon och polymeras beroende av
2
Denaturering
Glödgning


Förlängning
94 ° C
X-1 ° C reducera 1 ° C varannan cykel
70 ° C till 80 ° C *
10 till 60 sekunder
30 sekunder
Enmplicon och polymeras beroende av
28
Denaturering
Glödgning
Förlängning
94 ° C
5 ° C under Tm
70 ° C till 80 ° C
10 till 60 sekunder
30 sekunder
Amplikon och polymeras beroende av
20-25
Slutlig förlängning 70 ° C till 80 ° C 5 minuter 1

Tabell 6. Svagare PCR-cyklisering.

* För dämpning PCR är ramphastigheten sänktes till 2,5 ° C er -1 med en kylningshastighet av 1,5 ° C ar -1 för de glödgningscykler.

Förrådslösning Volym sattes till 50 pl reaktion 13 X Jäst Master Mix 13 X Fag Master Mix Slutkoncentration
Sterilt H2O qs till 50 pl = 31 | il eller 30,5 qs till 650 pl = 396,5 qs till 520 | il = 403 | il
PCR-buffert 10X 5 pl 65 pl 65 pl 1X
10 mM 1 il 13 pl 13 pl 200 pM
MgCl2- Titrering Tillsattes till varje reaktion Tillsattes till varje reaktion Tillsattes till varje reaktion Variabel se titrering
Framåt primer 20 | iM = 20 pmol / | il 1 il 13 pl 13 pl 20 pmol
Omvänd primer 20 | iM = 20 pmol / | il 1 il 13 pl 13 pl 20 pmol
Templat-DNA 2 ng / | il fag eller 10 ng / | il jäst 0,5 pl Fag eller 1 pl jäst 6,5 pl 13 pl ~ 10 7 Molekyler Fag eller ~ 10 5 molekyler jäst
Polymeras 0,5 enheter / | il ** 0,5 pl 6,5 pl 6,5 pl 0,5 enheter / reaktion
40 | il + 10 (titrering) il / reaktion TITRERING
[MgCl 2] 0,00 mM 0,5 mM 1,0 mM 1,5 mM 2,0 mM 2,5 mM 3,0 mM 3,5 mM 4,0 mM 4,5 mM 5,0 mM
MgCl2- 0,00 ^ il 1,00 ^ il 2,00 ^ il 3,0 pl 4,00 ^ il 5,00 ^ il 6,00 ^ il 7,00 ^ il 8,00 ^ il 9,00 ^ il 10,00 il
H 2 O 10,00 il 9,00 ^ il 8,00 ^ il 7,00 ^ il 6,00 ^ il 5,00 ^ il 4,00 ^ il 3,00 ^ il 2,00 ^ il 1,00 ^ il 0,00 ^ il

<stark> Tabell 7. Titrering av Mg2 + som används i figur 3.

Figur 1
Figur 1. Vanliga problem som uppstår med primrar och 3-stegs PCR-amplifiering av mål-DNA. (A) själv-annealing av primers som resulterar i bildning av sekundära hårnålslingestrukturen. Notera att primrar inte alltid aducering vid de yttersta ändarna och kan bilda mindre slingstrukturer. (B) primerhybridisering till varandra, snarare än DNA-schablonen och skapar primerdimerer. När väl dessa primers hybridiseras till varandra kommer de att långsträckt till primern ändar. (C) PCR-cykler alstra en specifik amplikon. Standard 3-stegs PCR-cykling innefattar denaturering av templat-DNA, hybridisering av primrar och förlängning av mål-DNA (amplikon) genom DNA-polymeras.

Figur 2
Figur 2. Ice hink med Reagent, pipetter och kuggstänger som krävs för en PCR. (1.) P-200 pipett (2.) P-1000 pipett (3.) P-20 pipett, (4.) P-10 pipett, (5). 96 brunnars platta och 0,2 ml tunnväggiga PCR-rör , (6.) Reagens innefattande Taq-polymeras, 10 X PCR-buffert, MgCl2, sterilt vatten, dNTP, primrar och mall-DNA, (7.) 1,8-ml och kuggstång.

Figur 3
Figur 3. Exempel på en Mg 2 + titreringar som används för att optimera en PCR-experiment med en vanlig 3-stegs PCR-protokollet. (A) S. cerevisiae-jäst genomiskt DNA användes som mall för att amplifiera en 2098 bp GAL3 genen. I raderna 1 - 6, där Mg 2 +-koncentrationen är alltför låg kan det antingen inte finns någon produkt som bildas (spår 1-5) eller mycket lite produkt bildades (spår 6). Banorna 7 - 11 representerar optimala koncentrationer av Mg 2 + för denna PCR-experiment som indikeras av närvaron av den 2098 bp långa amplikonet produkt. (B) En uncharacterized mycobacteriophage genomiskt DNA-mall användes för att amplifiera en 566 bp amplikon. Banorna 1 - 4, är den Mg 2 + koncentration är för låg, såsom indikeras av frånvaron av produkten. Banorna 5 - 11 representerar optimala koncentrationer av Mg 2 + för denna PCR såsom indikeras genom närvaron av den 566 kb amplikon produkt. (C). S. cerevisiae-jäst genomiskt DNA användes som mall för att amplifiera en 2098 bp GAL3 genen såsom indikeras i panelen en. Emellertid var glödgningstemperaturen minskas från 61 ° C till 58 ° C, vilket resulterade i ett icke-specifika PCR-band med varierande längder som producerar en utsmetning effekt på agarosgel. Banorna 1 - 4, där Mg 2 +-koncentrationen är alltför låg, det finns ingen produkt bildas. Banorna 5 - 8 representerar optimala koncentrationer av Mg 2 + för denna PCR-sedda genom närvaron av ett utstryk och band runt 2098 kb amplikon produktstorlek. Banorna 9 - 11 är indikativ för överdrivet stränga betingelser med ingen formade produkten. (AC) Lanes 12 är en negative kontroll som inte innehöll någon mall DNA. Lane M (markör) var lastad med NEB 1KB Ladder.

Figur 4
Figur 4. Sterila rör som användes för PCR. (1.) 1,8 ml rör (2.) 0,2 ml individuella tunnväggiga PCR-rör, (3.) 0,2 ml remsor tunnväggiga PCR-rör och mössor.

Figur 5
Figur 5. Thermal cycler. Slutna termiska cykler vänstra bilden. Högra bilden innehåller 0,2 ml tunnväggiga PCR-rör placerade i värmeblocket i en öppen termocykelapparat.

Discussion

PCR har blivit ett oumbärligt verktyg i den biologiska vetenskapen arsenal. PCR har ändrat loppet av vetenskap låta biologer för att ge makt över genomen och göra hybrid gener med nya funktioner så att de specifika och exakta kliniska tester, få insikt i genom och mångfald, samt enkelt klona gener för vidare biokemisk analys. PCR ansökan begränsas endast av fantasin hos den vetenskapsman som utövar sin makt. Det finns många böcker och andra dokument som beskriver nya specialiserade användningsområden för PCR, och många fler kommer att utvecklas under nästa generations biologiska vetenskapen. Men oavsett de förväntade metoder, har den grundläggande ramen förblev densamma. PCR, i alla dess storhet är en in vitro-ansökan för att generera stora kvantiteter av ett specifikt DNA-segment.

Utforma en PCR-experiment kräver eftertanke och tålamod. De resultat som visas i figur 3 exemplifierar en av de större lmallenges när man utformar en optimering strategi för PCR. Det vill säga som en parameter av PCR ändras kan det påverka varandra. Som ett exempel, om den initiala PCR utfördes på en sub-optimala härdningstemperaturen (58 ° C) med en optimal Mg2 +-koncentrationen av 2,0 mM, då resultatet skulle producera ett utstryk som ses i figur 3c. Ett försök att lösa smeta kan innebära att upprätta PCR-betingelser med reaktioner innehållande 2,0 mM MgCl2 och justering av glödgningstemperatur till 61 ° C. Emellertid, såsom visas i figur 3a, skulle detta inte någon produkt. Därför är det lämpligt att titrera reagenser, snarare än att lägga en koncentration till en enda reaktion, när du felsöker falska resultat. Även de vanligaste justeringar som krävs för att optimera ett PCR-experiment är att ändra Mg2 +-koncentrationen och att korrigera glödgningstemperaturer. Men om dessa förändringar inte minimerar inte eller upphäva avvikande resultat, titrering av additives och / eller ändra de protokoll cykling tillstånd som beskrivits i tabellerna 2-6 kan lindra problemet. Om allt annat misslyckas, omforma primrarna och försök, försök igen.

Disclosures

Jag har ingenting att lämna ut.

Acknowledgments

Speciellt tack till Kris Reddi vid UCLA för att ställa in reagenser och hälla geler och Erin Sanders vid UCLA för inspiration, vägledning och stöd och korrekturläsning manuskriptet. Jag skulle också vilja tacka Giancarlo Costaguta och Gregory S. Payne för att leverera DNA jästen genomiska och primers för att förstärka GAL3 genen. Jag vill också tacka Bhairav ​​Shah för att ta bilder av lab utrustning och reagens som används för att göra figurerna 2 - 4. Finansieringen för detta projekt har tillhandahållits av HHMI (HHMI Grant nr 52.006.944).

Materials

Name Company Catalog Number Comments
Taq Polymeras Sigma-Aldrich D4545-25UN
dNTPs Qiagen 201225
0.2 ml Thin Wall Tubes PCR tubes Bio-Rad 223-9469
0.2 ml Thin Wall Tube caps Bio-Rad 223-9472
EDTA disodium salt dihydrate Sigma-Aldrich E5134
Trizma-HCl Sigma-Aldrich T-3253
Custom Phage Primer Invitrogen 25441F_RL6_Contig2_68k TACTGCAACGCGATGTTGCG
Custom Phage Primer Invitrogen 26007R_RL6_ Contig2_68k TCACCATCAATCGTGGCGGT
Custom Yeast Primer Integrated DNA Technologies SacI-Gal3(-256) ACCTGGAGCTCCTATTT TAACATGTGGATTTCTTGAAAGAATGAAATCG
Custom Yeast Primer Integrated DNA Technologies Gal3(1848)-SacI CGGATGGAGCTCGCGT GAAGGTAATTTTTTTTTATGTCTCCG
Thermal Cycler Bio-Rad 170-9703 My Cycler
Agarose ISC BioExpress E-3120-500
Gel electrophoresis Hoeffer Scientific Instruments Model HE33
1 kb DNA Ladder New England Biolabs N3232S
Bio Rad Power Pack Bio-Rad 164-5050 PowerPac Basic
Gel Doc system Fotodyne Incorporated FOTO/Analyst Investigator FX Workstation

DOWNLOAD MATERIALS LIST

References

  1. Albert, J., Fenyo, E. M. Simple sensitive, and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers. J. Clin. Microbiol. 28, 1560-1564 (1990).
  2. Baskaran, N., et al. Uniform amplification of a mixture of deoxyribonucleic acids with varying GC content. Genome Res. 6, 633-638 (1996).
  3. Blanchard, M. M., Taillon-Miller, P., Nowotny, P., Nowotny, V. PCR buffer optimization with uniform temperature regimen to facilitate automation. PCR Methods Appl. 2, 234-240 (1993).
  4. Borer, P. N., Dengler, B., Tinoco, I. Jr, Uhlenbeck, O. C. Stability of ribonucleic acid double-stranded helices. J. Mol. Biol. 86, 843-853 (1974).
  5. Breslauer, K. J., Frank, R., Blocker, H., Marky, L. A. Predicting DNA duplex stability from the base sequence. Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750 (1986).
  6. Chou, Q., Russell, M., Birch, D. E., Raymond, J., Bloch, W. Prevention of pre-PCR mis-priming and primer dimerization improves low-copy-number amplifications. Nucleic Acids Res. 20, 1717-1723 (1992).
  7. Coleman, W. B., Tsongalis, G. J. Diagnostics for the clinical laboration. Humana Press. (2005).
  8. D'Aquila, R. T., et al. Maximizing sensitivity and specificity of PCR by pre-amplification heating. Nucleic Acids Res. 19, 3749 (1991).
  9. Dieffenbach, C. W., Lowe, T. M., Dveksler, G. S. General concepts for PCR primer design. PCR Methods Appl. 3, S30-S37 (1993).
  10. Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K., Mattick, J. S. 'Touchdown' PCR to circumvent spurious priming during gene amplification. Nucleic Acids Res. 19, 4008 (1991).
  11. Erlich, H. A., Gelfand, D., Sninsky, J. J. Recent advances in the polymerase chain reaction. Science. 252, 1643-1651 (1991).
  12. Frey, U. H., Bachmann, H. S., Peters, J., Siffert, W. PCR-amplification of GC-rich regions: 'slowdown PCR. Nat. Protoc. 3, 1312-1317 (2008).
  13. Haqqi, T. M., Sarkar, G., David, C. S., Sommer, S. S. Specific amplification with PCR of a refractory segment of genomic DNA. Nucleic Acids Res. 16, 11844 (1988).
  14. Henke, W., Herdel, K., Jung, K., Schnorr, D., Loening, S. A. Betaine improves the PCR amplification of GC-rich DNA sequences. Nucleic Acids Res. 25, 3957-3958 (1997).
  15. Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T. J. PCR Protocols: A guide to methods and applications. Academic Press, Inc. San Diego. (1990).
  16. King, N. Methods in Molecular Biology. 630, Humana Press. (2010).
  17. Kleppe, K., Ohtsuka, E., Kleppe, R., Molineux, I., Khorana, H. G. Studies on polynucleotides. XCVI. Repair replications of short synthetic DNA's as catalyzed by DNA polymerases. J. Mol. Biol. 56, 341-361 (1971).
  18. Korbie, D. J., Mattick, J. S. Touchdown PCR for increased specificity and sensitivity in PCR amplification. Nat. Protoc. 3, 1452-1456 (2008).
  19. Kramer, M. F., Coen, D. M. Enzymatic amplification of DNA by PCR: standard procedures and optimization. Curr. Protoc. Toxicol. Appendix 3, 1-14 (2001).
  20. Kramer, M. F., Coen, D. M. The polymerase chain reaction. Curr. Protoc. Protein Sci. Appendix 4, Appendix 4J (2002).
  21. Kreader, C. A. Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein. Appl. Environ. Microbiol. 62, 1102-1106 (1996).
  22. Kwok, S., et al. Identification of human immunodeficiency virus sequences by using in vitro enzymatic amplification and oligomer cleavage detection. J. Virol. 61, 1690-1694 (1987).
  23. McConlogue, L., Brow, M. A., Innis, M. A. Structure-independent DNA amplification by PCR using 7-deaza-2'-deoxyguanosine. Nucleic Acids Res. 16, 9869 (1988).
  24. Mullis, K. B. The unusual origin of the polymerase chain reaction. Sci. Am. 262, 56-65 (1990).
  25. Mullis, K. B. Target amplification for DNA analysis by the polymerase chain reaction. Ann. Biol. Clin. (Paris). 48, 579-582 (1990).
  26. Mullis, K. B. The polymerase chain reaction in an anemic mode: how to avoid cold oligodeoxyribonuclear fusion). PCR Methods Appl. 1, 1-4 (1991).
  27. Mullis, K. B., Faloona, F. A. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol. 155, 335-350 (1987).
  28. Paabo, S., Gifford, J. A., Wilson, A. C. Mitochondrial DNA sequences from a 7000-year old brain. Nucleic Acids Res. 16, 9775-9787 (1988).
  29. Rees, W. A., Yager, T. D., Korte, J., von Hippel, P. H. Betaine can eliminate the base pair composition dependence of DNA melting. Biochemistry. 32, 137-144 (1993).
  30. Roux, K. H., Hecker, K. H. One-step optimization using touchdown and stepdown PCR. Methods Mol. Biol. 67, 39-45 (1997).
  31. Rychlik, W., Spencer, W. J., Rhoads, R. E. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res. 18, 6409-6412 (1990).
  32. Saiki, R. K., et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 239, 487-491 (1988).
  33. Saiki, R. K., et al. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science. 230, 1350-1354 (1985).
  34. Sambrook, J. A. R., David, W. Molecular Cloning A Laboratory Manual. 2, 3, Cold Spring Harbor Laboratory Press. (2001).
  35. Sarkar, G., Kapelner, S., Sommer, S. S. Formamide can dramatically improve the specificity of PCR. Nucleic Acids Res. 18, 7465 (1990).
  36. Smit, V. T., et al. KRAS codon 12 mutations occur very frequently in pancreatic adenocarcinomas. Nucleic Acids Res. 16, 7773-7782 (1988).
  37. Wilson, I. G. Inhibition and facilitation of nucleic acid amplification. Appl. Environ. Microbiol. 63, 3741-3751 (1997).
  38. Wu, R. Methods in Enzymology. 218, Academic Press, Inc. San Diego. (1993).

Comments

1 Comment

  1. Thanks for the great overview of the all-important PCR procedure. I will no doubt reference it often in the future.

    I have a PCR troubleshooting question...what do to about streaking on the gel after a successful amplification? My bands are nice and bright and where they are supposed to be, but there is a heavily-streaked "path" starting at the wells and following until the end where my bands are. Is there something I can do about my PCR conditions, or the thermocycler settings? Any comments would be appreciated.

    Reply
    Posted by: Doug E.
    September 8, 2013 - 1:23 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics