Polymerase Chain Reaction: Protocole Basic Plus Stratégies de dépannage et d'optimisation

Biology
 

Summary

PCR a émergé comme une technique courante dans de nombreux laboratoires de biologie moléculaire. Pourvu voici un guide rapide à plusieurs protocoles de PCR classiques. Parce que chaque réaction est une expérience unique, les conditions optimales nécessaires pour générer un produit varie. Comprendre les variables dans une réaction permettra d'améliorer grandement l'efficacité de dépannage, augmentant ainsi les chances d'obtenir le résultat souhaité.

Cite this Article

Copy Citation | Download Citations

Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J. Vis. Exp. (63), e3998, doi:10.3791/3998 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Dans le domaine des sciences biologiques, il ya eu des avancées technologiques qui catapultent la discipline dans les âges d'or de la découverte. Par exemple, le domaine de la microbiologie a été transformée avec l'avènement du microscope Anton van Leeuwenhoek, qui a permis aux scientifiques de visualiser les procaryotes pour la première fois. Le développement de la réaction en chaîne par polymérase (PCR) est une de ces innovations qui ont changé le cours de la science moléculaire avec son impact s'étend sous-disciplines de la biologie innombrables. Le processus théorique a été décrite par Keppe et ses collègues en 1971, mais il a fallu encore 14 ans jusqu'à ce que la procédure complète de PCR a été décrit et appliqué expérimentalement par Kary Mullis, tout en Cetus Corporation en 1985. Automatisation et raffinement de cette technique progressé avec l'introduction d'une ADN polymérase stable thermique de la bactérie Thermus aquaticus, par conséquent, la Taq ADN polymérase nom.

La PCR est une Powetechnique d'amplification rful qui peut générer une grande quantité d'un segment spécifique de l'ADN (c.-à-un amplicon) à partir de seulement une petite quantité de matériau de départ (par exemple, la matrice d'ADN ou la séquence cible). Bien que simple et généralement sans problème, il ya des pièges qui compliquent la réaction produisant des résultats erronés. Lorsque PCR échoue, il peut conduire à de nombreux produits d'ADN non-spécifiques de différentes tailles qui apparaissent comme une échelle ou un frottis de bandes sur des gels d'agarose. Parfois, aucun produit se former à tous. Un autre problème potentiel se produit lorsque les mutations sont introduites involontairement dans les amplicons, résultant dans une population hétérogène de produits de PCR. Échecs PCR peut devenir frustrant à moins de patience et de dépannage attention sont employées pour trier et résoudre le problème (s). Ce protocole énonce les principes fondamentaux de la PCR, fournit une méthodologie qui se traduira par l'amplification de séquences cibles la plupart des, et présente des stratégies pour optimiser une réaction. En suivant ce guide PCR, students devrait être en mesure de:

  • Mettre en place des réactions et des conditions de cyclage thermique pour une expérience PCR conventionnelle
  • Comprendre le fonctionnement des composants de réaction différentes et leur effet global sur une expérience de PCR
  • Concevoir et optimiser une expérience de PCR pour toute matrice d'ADN
  • Résoudre les problèmes liés échoué expériences de PCR

Protocol

1. Concevoir des amorces

Conception des amorces appropriées est essentiel à la réussite d'une expérience de PCR. Lors de la conception d'un ensemble d'amorces à une région spécifique de l'ADN désiré pour l'amplification, une amorce doit s'hybrider au brin plus, qui, par convention est orienté dans le sens 5 '→ 3' (aussi connu comme le sens ou nontemplate brin) et le autre amorce doit compléter le brin moins, qui est orientée dans la 3 '→ 5' (antisens ou brin matrice). Il ya quelques problèmes communs qui se posent lors de la conception des amorces: 1) Auto-hybridation avec les amorces entraînant la formation de structures secondaires telles que des boucles en épingle à cheveux (Figure 1a), 2) hybridation des amorces à l'autre, plutôt que de la matrice d'ADN, la création d'amorce dimères (figure 1b), 3) des températures de fusion radicalement différents (T m) pour chaque amorce, ce qui rend difficile de sélectionner une température de recuit qui seront tousomment les deux amorces pour lier efficacement à leur séquence cible au cours Thermal vélo (figure 1c) (voir les sections calcul de la température de fusion (T m) et modifications des conditions de CYCLISME pour plus d'informations sur les T m s).

  1. Voici une liste de caractéristiques qui devraient être considérés lors de la conception des amorces.
    1. Longueur de l'amorce doit être 15-30 résidus nucléotidiques (bases).
    2. Optimal teneur en GC devrait se situer entre 40-60%.
    3. L'extrémité 3 'des amorces devrait contenir un G ou C en vue de serrer l'amorce et d'empêcher "respire" d'extrémités, en augmentant l'efficacité d'amorçage. ADN «respiration» se produit lorsque les extrémités ne restent pas recuit, mais une bagarre ou diviser. Les trois liaisons hydrogène dans les paires GC aider à prévenir la respiration, mais aussi d'augmenter la température de fusion des amorces.
    4. Le extrémités 3 'd'un jeu d'amorces, qui comprend une amorce brin plus et une amorce brin moins, ne doivent pas être c COMPLEMENTAIRES une à l'autre, ni l'extrémité 3 'd'une amorce simple être complémentaire à d'autres séquences dans l'amorce. Ces deux scénarios entraîner la formation de dimères d'amorces et les structures en boucle en épingle à cheveux, respectivement.
    5. Températures de fusion optimales (T m) pour la gamme des amorces entre 52-58 ° C, bien que la gamme peut être étendu à 45-65 ° C. Le m final T pour les deux amorces devraient ne diffèrent pas de plus de 5 ° C.
    6. Di-nucléotidiques répétitions (par exemple, ou GCGCGCGCGC ATATATATAT), les pistes de base unique (par exemple, AAAAA ou CCCCC) devraient être évités car ils peuvent provoquer le glissement le long du segment amorcée des structures de boucle en épingle à cheveux d'ADN et ou à la forme. Si inévitables dues à la nature de la matrice d'ADN, puis seulement comprennent répétitions ou à une base unique fonctionne avec un maximum de 4 bases.

Notes:

  1. Il ya de nombreux programmes informatiques conçus pour aider à concevoir des paires d'amorces. Outil de conception d'amorce NCBIw.ncbi.nlm.nih.gov / outils / amorce-fourneaux / "target =" _blank "> http://www.ncbi.nlm.nih.gov/tools/primer-blast/ et Primer3 http://frodo .wi.mit.edu/primer3 / sites recommandés sont à cet effet.
  2. Afin d'éviter l'amplification de pseudogènes connexes ou homologues il pourrait être utile d'exécuter un coup sur NCBI pour vérifier la spécificité de la cible des amorces.

2. Matériels et réactifs

  1. Lorsque la mise en place d'une expérience de PCR, il est important d'être préparé. Porter des gants pour éviter de contaminer le mélange réactionnel ou réactifs. Inclure un contrôle négatif, et si possible un contrôle positif.
  2. Disposer tous les réactifs nécessaires pour l'expérience PCR dans un seau à glace fraîchement rempli, et laissez-les dégeler complètement avant de mettre en place une réaction (Figure 2). Gardez les réactifs sur la glace tout au long de l'expérience.
    • Standard réactifs PCR comprend undéfinir des amorces appropriées pour le gène cible désirée ou d'un segment d'ADN à amplifier, l'ADN polymérase, une mémoire tampon pour la polymérase d'ADN spécifique, désoxynucléotides (dNTP), la matrice d'ADN, et de l'eau stérile.
    • Des réactifs supplémentaires peuvent comprendre sel de magnésium Mg 2 + (à une concentration finale de 0,5 à 5,0 mM), K sel de potassium + (à une concentration finale de 35 à 100 mM), diméthylsulfoxyde (DMSO; à une concentration finale de 1-10% ), le formamide (à une concentration finale de 1,25 à 10%), la sérum albumine bovine (à une concentration finale de 10-100 pg / ml), et la bétaïne (à une concentration finale de 0,5 M à 2,5 M). Les additifs sont discutées plus loin dans la section dépannage.
  3. Organiser le matériel de laboratoire sur l'établi.
    • Le matériel comprend des tubes PCR et casquettes, d'une étagère tube de PCR, un marqueur résistant à l'éthanol, et un ensemble de micropipettes qui distribuent entre 1 à 10 pi (P10), 2 - 20 pi (P20), 20 - 200 pi (P200)et 200 - 1000 pl (P1000), ainsi que un cycleur thermique.
    • Lorsque la mise en place de plusieurs expériences de PCR qui utilisent tous les mêmes réactifs, ils peuvent être mis à l'échelle appropriée et combinés entre eux dans un mélange maître (Master Mix). Cette étape peut être effectuée dans un stérile 1,8 ml microtube (voir Notes).
    • Pour analyser les amplicons résultant d'une expérience de PCR, réactifs et du matériel pour l'électrophorèse sur gel d'agarose est nécessaire. À estimer la taille d'un produit de PCR, une échéant, disponible dans le commerce type moléculaire taille poids est nécessaire.

3. Mise en place d'un mélange réactionnel

  1. Commencez par faire une table des réactifs qui seront ajoutés au mélange réactionnel (voir tableau 1).
  2. Ensuite, l'étiquette PCR tube (s) avec le marqueur résistant à l'éthanol.
  3. Des volumes de réaction varie en fonction des concentrations des réactifs d'achat d'actions. Les concentrations finales(FC) pour un type réactionnel de 50 ul sont les suivantes.
    • X tampon (généralement fourni par le fabricant de l'ADN polymérase; peut contenir 15 mM MgCl 2). Ajouter 5 pi de tampon 10X par réaction.
    • 200 uM de dNTP (50 uM de chacun des quatre nucléotides). Ajouter 1 ul de 10 mM de dNTPs par réaction (dATP, dCTP, dTTP et dGTP sont à 2,5 mM chacun).
    • 1,5 mM de Mg 2 +. Ajouter uniquement si elle n'est pas présente dans le tampon 10X ou comme nécessaire pour l'optimisation de PCR. Par exemple, pour obtenir le 4,0 mM Mg 2 + nécessaire à la production optimale d'un amplicon conservé 566 pb segment d'ADN trouvé dans une mycobactériophage non caractérisés ajouter 8 pi de 25 mM MgCl 2 à la réaction (figure 3).
    • 20 à 50 pmol de chaque amorce. Ajouter 1 ul de chaque amorce 20 uM.
    • Ajouter 10 4 à 10 7 molécules (ou d'environ 1 à 1000 ng) matrice d'ADN. Ajouter 0,5 pi de 2ng / & mu; L'ADN génomique mycobactériophage l.
    • Ajouter 0,5 à 2,5 unités d'ADN polymérase par réactionnel de 50 ul (Voir les recommandations du fabricant) Par exemple, ajouter 0,5 pi de Sigma 0,5 unités / ul ADN polymérase Taq.
    • Ajouter QS eau distillée stérile pour obtenir un volume de 50 ul final par réaction comme pré-déterminée dans le tableau de réactifs (QS est une abréviation latine pour quantum satis-dire le montant qui est nécessaire). Ainsi, 33 pi par réaction est nécessaire pour porter le volume à 50 ul. Toutefois, il convient de noter que l'eau est ajouté en premier, mais exige d'abord faire une table de réactifs et de déterminer les volumes de tous les autres réactifs ajoutés à la réaction.

4. Basic PCR protocole

  1. Placez une plaque de 96 puits dans le seau à glace en tant que titulaire pour les 0,2 ml minces parois des tubes PCR. Permettre réactifs de PCR pour être ajouté dans le froid de 0,2 ml minces parois des tubes PCR aidera à prévenir nucleasl'activité e et d'amorçage non spécifique.
  2. Introduire à la pipette les réactifs de PCR suivantes dans l'ordre suivant dans un tube de 0,2 ml PCR à paroi mince (Figure 4): de l'eau stérile, un tampon PCR 10X, les dNTP, de MgCl 2, amorces et l'ADN matrice (voir tableau 1). Comme les expériences doivent avoir au moins un contrôle négatif, et éventuellement un contrôle positif, il est avantageux de mettre en place un Master Mix dans un tube de 1,8 ml de microcentrifugation (Voir l'explication dans les notes).
  3. Dans quelques 0,2 ml séparés minces parois des tubes PCR (Figure 4) ajouter tous les réactifs à l'exception de l'ADN modèle pour un contrôle négatif (augmentation de l'eau pour compenser le volume manquant). En outre, une autre réaction (si réactifs sont disponibles) doit contenir un contrôle positif en utilisant l'ADN matrice et d'amorces précédemment connues ou d'amplifier dans les mêmes conditions que les tubes PCR expérimentales.
  4. Taq ADN polymérase est généralement stocké dans un glycérol à 50%solution et la dispersion complète dans le mélange réactionnel nécessite douce mélanger des réactifs de PCR en pipetant au moins 20 fois. La micropipette devrait être fixé à environ la moitié du volume de réaction du mélange maître lors du mélange, et les soins devraient être prises pour éviter d'introduire des bulles.
  5. Placer des bouchons sur les tubes de 0,2 ml minces parois PCR et les placer dans le thermocycleur (Figure 5). Une fois le couvercle pour le thermocycleur est correctement fermé démarrer le programme (voir tableau 2).
  6. Lorsque le programme est terminé, les 0,2 ml à paroi mince tubes PCR peut être enlevé et stocké à 4 ° C. Les produits de PCR peut être détectée par le chargement des parties aliquotes de chaque réaction dans des puits d'un gel d'agarose puis coloration d'ADN qui a migré dans l'électrophorèse sur gel suivant au bromure d'éthidium. Si un produit de PCR est présent, le bromure d'éthidium se intercaler entre les bases des brins d'ADN, ce qui permet de visualiser les bandes avec un illuminateur UV. </ Li>

Notes:

  1. Lorsque la mise en place de multiples expériences de PCR, il est avantageux de monter un mélange de réactifs communs à toutes les réactions (c.-à-Mix Master). Habituellement le cocktail contient une solution de l'ADN polymérase, dNTP, un tampon de réaction, et de l'eau assemblé dans un tube de microcentrifugation 1,8 ml. La quantité de chaque réactif ajouté au mélange maître est équivalent au nombre total de réactions plus 10% arrondi au plus proche de réaction entière. Par exemple, si il ya 10 x 0,1 = 1 réaction, alors (10 + 1) x 5 pi de tampon 10X est égal à 55 pi de tampon 10X pour le Master Mix. Les réactifs dans le Mix Master sont mélangés minutieusement en faisant doucement le piston de pompage d'une micropipette de haut en bas environ 20 fois comme décrit ci-dessus. Chaque tube de PCR reçoit une aliquote de la Master Mix à laquelle la matrice d'ADN, des amorces requises, et d'expérimenter les réactifs spécifiques sont ensuite ajoutés (voir les tableaux 1 et 7).
  2. Le followisite ng offre un calculateur pour la détermination du nombre de copies d'un ADN matrice ( http://www.uri.edu/research/gsc/resources/cndna.html ). Le nombre total de copies d'ADN double brin peut être calculée en utilisant l'équation suivante:
    Nombre de copies d'ADN = (quantité d 'ADN (ng) x 6.022x10 23) / (longueur de l'ADN x 1x10 9 ng / ml x 650 daltons)
    Calcul du nombre de copies d'ADN est utilisée pour déterminer combien de modèle est nécessaire par réaction.
  3. Les faux positifs peuvent se produire comme une conséquence du report d'une autre réaction de PCR qui serait visualisées sous forme de plusieurs produits non désirés sur un gel d'agarose après électrophorèse. Par conséquent, il est prudent d'utiliser la bonne technique, notamment un contrôle négatif (et le contrôle positif lorsque cela est possible).
  4. Alors que le bromure d'éthidium est la plus courante f tacheou des acides nucléiques, il existe plusieurs alternatives plus sûres et moins toxique. Le site suivant décrit plusieurs des solutions de rechange, y compris le bleu de méthylène, Cristal Violet, SYBR Safe, et Gel-Rouge ainsi que des descriptions de la façon d'utiliser et de détecter le produit final ( http://bitesizebio.com/articles/ethidium-bromide-the- solutions de rechange ou ).
  5. Alors que la plupart des machines modernes PCR utilisent des tubes de 0,2 ml, certains modèles peuvent nécessiter des réactions dans tubes de 0,5 ml. Consultez votre manuel thermique cyclistes afin de déterminer le tube de taille appropriée.

5. Température de fusion de calcul (T m)

  1. Connaissant la température de fusion (T m) des amorces est impératif pour une expérience réussie PCR. Bien qu'il existe plusieurs calculateurs T m disponible, il est important de noter que ces calculs sont une estimation de la réelle m T, étant donné d'un manque de renseignements précis sur une réaction particulière et les hypothèses faites dans les algorithmes pour les calculatrices m T eux-mêmes. Toutefois, les modèles thermodynamiques du plus proche voisin sont préférés sur le calcul plus classique: T m ≈ 4 (GC) + 2 (AT). Le premier vous donnera plus précis T m estimation car elle prend en compte l'énergie d'empilement de paires de base voisines. Ce dernier est utilisé plus fréquemment parce que les calculs sont simples et peuvent se faire rapidement à la main. Voir la section Dépannage pour plus d'informations sur la façon dont diverses conditions de PCR et des additifs sur la température de fusion.
    Pour calculer les valeurs T m par des modèles thermodynamiques du plus proche voisin, l'un des calculateurs suivants est recommandé:
    http://www6.appliedbiosystems.com/support/techtools/calc/
    edu / ~ zimmer / oligoTMcalc.html "target =" _blank "> ~ http://www.cnr.berkeley.edu/ zimmer / oligoTMcalc.html
    http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/
    http://www.finnzymes.com/tm_determination.html~~V
    http://mobyle.pasteur.fr/cgi-bin/portal.py? # formes :: fusion

6. Configuration conditions de cyclage thermique

  1. Thermocycleurs PCR rapidement chauffer et refroidir le mélange réactionnel, permettant à la chaleur induite de dénaturation de l'ADN double brin (séparation des brins), recuit d'amorces à des brins plus et moins de la matrice d'ADN, et l'allongement du produit de PCR. Temps de cycle est calculée sur la base de la taille de la matrice et la teneur en GC de l'ADN. La formul généraleune commence par une étape de dénaturation initiale à 94 ° C à 98 ° C en fonction de la température optimale pour une activité ADN polymérase et la teneur en GC de l'ADN matrice. Une réaction typique commence par une dénaturation d'une minute à 94 ° C. Les plus de 3 minutes peut inactiver l'ADN polymérase, en détruisant son activité enzymatique. Une méthode, connue sous le nom de démarrage à chaud PCR, s'étend considérablement le temps de dénaturation initiale de 3 minutes à 9 minutes. Démarrage à chaud avec PCR, l'ADN polymérase est ajoutée après l'étape de dénaturation initiale exagérée est terminé. Cette modification de protocole évite l'inactivation de l'enzyme susceptible d'ADN polymérase. Reportez-vous à la section Dépannage de ce protocole pour plus d'informations sur Démarrage à chaud PCR et autres méthodes alternatives.
  2. L'étape suivante consiste à configurer le thermocycleur pour lancer le premier de 25 à 35 tours d'un cycle de température en trois étapes (tableau 2). Tout en augmentant le nombre de cycles au-dessus 35 entraîne uneune plus grande quantité de produits de PCR, tours de trop nombreux se traduit souvent par l'enrichissement de produits secondaires indésirables. Les trois étapes de température dans un seul cycle d'accomplir trois tâches: la première étape dénature le gabarit (et dans des cycles ultérieurs, les amplicons ainsi), la deuxième étape de recuit permet optimale d'amorces, et la troisième étape permettant l'ADN polymérase de se lier à la matrice d'ADN et de synthèse du produit de PCR. La durée et la température de chaque étape dans un cycle peut être modifiée pour optimiser la production de l'amplicon désiré.
    Le temps pour l'étape de dénaturation est aussi courte que possible. Habituellement 10 à 60 secondes est suffisant pour la plupart des modèles d'ADN. Le temps de dénaturation et de la température peut varier en fonction de la teneur en GC de l'ADN matrice, ainsi que le taux de rampe, qui est le temps que prend le cycleur thermique pour changer d'une température à l'autre. La température de cette étape est généralement le même que celui utilisé pour la phase initiale de dénaturation(Étape n ° 1 ci-dessus; par exemple, 94 ° C).
    Un 30 deuxième étape de recuit qui suit dans le cycle à une température définie d'environ 5 ° C au-dessous du ressort m T des amorces (idéalement entre 52 ° C à 58 ° C).
    Le cycle se termine par une étape d'élongation. La température dépend de l'ADN polymérase choisie pour l'expérience. Par exemple, l'ADN polymérase Taq avec une température optimale d'allongement de 70 ° C à 80 ° C et nécessite 1 minute à allongé les 2 premiers kb, oblige ensuite une minute supplémentaire pour chacun 1 kb supplémentaires amplifiés. Pfu ADN polymérase est une autre enzyme thermostable qui a une température optimale d'allongement de 75 ° C. Pfu ADN polymérase est recommandé pour utilisation dans la PCR et les réactions d'extension d'amorce qui nécessitent une haute fidélité et nécessite 2 minutes pour tous les 1 ko être amplifiés. Voir les recommandations du fabricant pour des températures d'allongement et l'heure exactes allongement indiquées pour chaque ADN polymérase spécifique.
  3. Taq, permet l'addition d'un résidu adénine à l'extrémité 3 'de tous les produits de PCR. Cette modification est médiée par l'activité du terminal transférase de l'ADN polymérase Taq et est utile pour la suite des procédures de clonage moléculaire qui nécessitent un surplomb 3'-.
  4. Fin de la réaction est réalisée en refroidissant le mélange à 4 ° C et / ou par l'addition de l'EDTA à une concentration finale de 10 mM.

7. Considérations importantes lors du dépannage de PCR

Si des conditions standard de PCR ne donnent pas l'amplicon désiré, PCR optimisation est nécessaire pour atteindre de meilleurs résultats. La stringence d'une réaction peut être modulé de telle sorte que la spécificité est ajusté par des variables de modification (par exemple, le réactifconcentrations, les conditions de cyclisme) qui influent sur le résultat du profil amplicon. Par exemple, si la réaction n'est pas suffisamment rigoureuse, de nombreux parasites amplicons sera généré avec des longueurs variables. Si la réaction est trop stricte, aucun produit ne sera produite. Dépannage des réactions de PCR peut être un effort frustrant par moments. Toutefois, une analyse minutieuse et une bonne compréhension des réactifs utilisés dans une expérience de PCR peut réduire la quantité de temps et d'essais nécessaires pour obtenir les résultats souhaités. De toutes les considérations qui ont un impact PCR rigueur, le titrage de Mg 2 + et / ou de manipuler des températures de recuit probablement résoudre la plupart des problèmes. Toutefois, avant de changer quoi que ce soit, assurez-vous qu'un résultat erroné n'était pas due à une erreur humaine. Commencez par confirmer tous les réactifs ont été ajoutés à une réaction donnée et que les réactifs ne sont pas contaminés. Veuillez également prendre note du résultat erroné, et poser les questions suivantes: Est-dimères d'amorces visibles sur le gel après électrophorèserésistance (ceux-ci d'exécution en petites bandes <100 b près du fond de la ruelle)? Y at-il des produits non spécifiques (bandes qui migrent à une taille différente de celle du produit désiré)? Y at-il un manque de tout produit? Est l'ADN cible sur un plasmide ou dans un extrait d'ADN génomique? En outre, il est sage d'analyser la teneur en GC de l'amplicon désiré.

  1. Déterminez d'abord si l'un des réactifs de PCR sont catastrophiques pour votre réaction. Ceci peut être réalisé en préparant de nouveaux réactifs (par exemple, frais de stocks d'exploitation, les dilutions de nouvelles), puis systématiquement ajout d'un réactif nouveau à la fois à des mélanges de réaction. Ce processus permettra de déterminer qui était le coupable réactif pour la PCR expérience ratée. Dans le cas de l'ADN très ancien, qui s'accumule souvent inhibiteurs, il a été démontré que l'addition de sérum albumine bovine peut aider à atténuer le problème.
  2. Dimères d'amorces peuvent se former lorsque amorces préférentiellement auto recuit ou recuit à l'autre amorce dans la réaction. Si cela se produit, une petiteProduit de moins de 100 pb apparaît sur le gel d'agarose. Commencez par modifier le rapport de modèle à l'amorce, si la concentration d'amorce est en excès extrême de la concentration de modèle, puis les amorces seront plus susceptibles de s'hybrider à eux-mêmes ou les uns des autres au cours de la matrice d'ADN. Ajout du DMSO et ou en utilisant une méthode de démarrage à chaud cyclage thermique peut résoudre le problème. En fin de compte, il peut être nécessaire de concevoir de nouvelles amorces.
  3. Produits non spécifiques sont produites lorsque la rigueur PCR est trop faible résultant dans des bandes de PCR non spécifiques avec des longueurs variables. Cela produit un effet échelle sur un gel d'agarose. Il est alors conseillé de choisir des conditions de PCR qui augmentent la rigueur. Un frottis de différentes tailles peuvent également résulter de amorces conçues pour des séquences hautement répétitives lors de l'amplification d'ADN génomique. Cependant, les mêmes amorces peuvent amplifier une séquence cible sur un plasmide sans rencontrer le même problème.
  4. Le manque de produits de PCR est probablement due à des conditions de réactionqui sont trop strictes. Dimères d'amorces et les structures en boucle en épingle à cheveux qui forment avec les amorces ou dans la matrice d'ADN dénaturé peut également empêcher l'amplification des produits de PCR parce que ces molécules ne peuvent plus la paire de bases avec l'homologue d'ADN désiré.
  5. Si la teneur en GC n'a pas été analysé, il est temps de le faire. PCR des régions riches GC (teneur en GC> 60%) présentent quelques-uns des plus grands défis à la PCR. Cependant, il ya de nombreux additifs qui ont été utilisés pour aider à atténuer les défis.

8. De manipuler les réactifs PCR

Comprendre la fonction des réactifs utilisés sur la PCR conventionnelle est essentiel lors de la première décider la meilleure façon de modifier les conditions de réaction pour obtenir le produit désiré. Le succès tout simplement peut s'appuyer sur modification de la concentration de MgCl 2, KCl, dNTP, amorces, matrice d'ADN, ou l'ADN polymérase. Toutefois, la mauvaise concentration des réactifs tels peuvent conduire à des résultats faux, en diminuant la stringency de la réaction. En cas de dépannage PCR, un seul réactif doit être manipulé à la fois. Cependant, il peut être prudent de titrer le réactif manipulé.

  1. Sel de magnésium Mg 2 + (la concentration finale de réaction de 0,5 à 5,0 mM)
    ADN-polymérases thermostables requérir la présence de magnésium d'agir en tant que cofacteur pendant le processus réactionnel. Modification de la concentration en magnésium est l'un des réactifs les plus faciles à manipuler avec peut-être le plus grand impact sur la rigueur de la PCR. En général, le rendement du produit PCR va augmenter avec l'ajout de plus grandes concentrations de Mg 2 +. Toutefois, l'augmentation des concentrations de Mg 2 + va aussi diminuer la spécificité et la fidélité de l'ADN polymérase. La plupart des fabricants comprennent une solution de chlorure de magnésium (MgCl 2) ainsi que l'ADN polymérase et une solution tampon de PCR 10X. Les 10 X PCR solutions tampons peuvent contenir 15 mM MgCl 2, ce qui est suffisant pour un type PCRréactionnel, ou bien il peut être ajouté séparément à une concentration optimisée pour une réaction spécifique. Mg 2 + n'est pas réellement consommée dans la réaction, mais que la réaction peut avoir lieu sans qu'il ne soit présent. Quand il ya trop de Mg 2 +, il peut empêcher la dénaturation complète de la matrice d'ADN par la stabilisation du brin duplex. Trop de Mg 2 + peut également stabiliser fausse hybridation avec les amorces vers des sites de modèles erronés et la spécificité en résulte une diminution dans les produits de PCR indésirables. Quand il n'ya pas assez de Mg 2 +, la réaction ne procédera pas, résultant en un rien de produit de PCR.
  2. Sel de potassium K + (la concentration finale de réaction de 35 à 100 mM)
    Produits de PCR plus (10 à 40 ko) bénéficient de la réduction du sel de potassium (KCl) à partir de sa concentration réaction normale 50 mM, souvent en conjonction avec l'addition de DMSO et / ou de glycérol. Si l'amplicon recherché est en dessous de 1000 pb et de longues produits non spécifiques se forment, specificité peut être améliorée par une titration de KCl, ce qui augmente la concentration de 10 mm jusqu'à 100 mM. L'augmentation de la concentration en sel permet de molécules d'ADN plus courtes pour dénaturer préférentiellement à des molécules d'ADN plus longs.
  3. Désoxynucléotide 5'-triphosphates (concentration finale de réaction de 20 et 200 uM chacun)
    Désoxynucléotide 5'-triphosphates (dNTP) peuvent causer des problèmes pour la PCR, si elles ne sont pas à des concentrations appropriées équivalentes (c.-à-[A] = [T] = [C] = [G]) et / ou en raison de leur instabilité à partir répétée gel et de dégel. La concentration de dNTP habituelle est de 50 uM de chacun des quatre dNTP. Cependant, la PCR peut tolérer des concentrations entre 20 et 200 uM chacun. Des concentrations plus faibles de dNTP peut augmenter à la fois la spécificité et la fidélité de la réaction alors que les concentrations excessives dNTP peut effectivement inhiber la PCR. Cependant, pour de plus longues PCR des fragments, une plus grande concentration de dNTP peut être nécessaire. Un grand changement dans la concentration de dNTP peut nécessiter une corresformation de flaques changement dans la concentration de Mg 2 +.
  4. Thermiques ADN polymérases stables
    Enzymes de PCR et des tampons associés à ces enzymes ont parcouru un long chemin depuis l'ADN polymérase Taq initiale a d'abord été employé. Ainsi, le choix d'une enzyme appropriée peut être utile pour l'obtention de produits d'amplification souhaités. Par exemple l'utilisation de l'ADN polymérase Taq peut être préférable à l'ADN polymérase Pfu si processivité et / ou l'ajout d'un résidu adénine aux extrémités 3 'du produit de PCR est souhaitée. L'ajout d'un 3 'adénine est devenue une stratégie utile pour les produits de PCR clonage dans des vecteurs TA whit 3' surplombe la thymine. Toutefois, si la fidélité est plus important une enzyme telle que Pfu peut être un meilleur choix. Plusieurs fabricants ont un tableau des ADN polymérases spécifiques conçus pour répondre aux besoins spécialisés. Jetez un oeil à des conditions de réaction et les caractéristiques de l'amplicon désiré, puis correspondre l'expérience PCR avec l'ADN approprié polymerase. La plupart des fabricants ont des tables de l'aide que la sélection polymérase de l'ADN par des caractéristiques telles que la fidélité d'inscription, le rendement, la vitesse, la longueur des cibles optimales, et si elle est utile pour riche en GC ou d'amplification PCR démarrage à chaud.
  5. Matrice d'ADN
    Qualité de l'ADN et la pureté aura un effet considérable sur la probabilité d'une expérience réussie PCR. ADN et ARN concentrations peuvent être déterminées en utilisant leurs mesures de densité optique à 260 nm (DO 260). La masse de des acides nucléiques purifiés en solution est calculée à 50 pg / ml d'ADN double brin ou 40 pg / ml pour les ARN ou d'ADN simple brin à une DO 260 = 1,0. Contaminants extraction de l'ADN sont des inhibiteurs de communes dans la PCR et doit être soigneusement évité. Communes inhibiteurs d'extraction d'ADN de PCR sont les protéines, l'ARN, les solvants organiques, et des détergents. Utilisation de l'absorption maximale des acides nucléiques OD 260 par rapport à celle des protéines DO280 (DO 260/280), il est possible de détermie une estimation de la pureté de l'ADN extrait. Idéalement, le ratio de la DO 260/280 est compris entre 1,8 et 2,0. Basse OD 260/280 est l'indicatif de la protéine et / ou contamination par les solvants qui, selon toute probabilité, sera problématique pour la PCR.
    En plus de la qualité de l'ADN modèle, optimisation de la quantité d'ADN peuvent grandement bénéficier le résultat d'une expérience de PCR. Bien qu'il soit commode de déterminer la quantité de pi ng /, ce qui est souvent la sortie pour nanospectrophotometers modernes, l'unité pertinente pour une expérience réussie PCR est le nombre de molécules. C'est, combien de copies de matrice d'ADN contient une séquence complémentaire à des amorces de PCR? Molécules cibles optimales sont entre avril 10-juillet 10 molécules et peut être calculée comme cela a été décrit dans les notes ci-dessus.

9. Réactifs additifs

Réactifs additifs peuvent donner des résultats quand tout le reste échoue. Comprendre les réactifset ce qu'ils sont utilisés pour est essentiel dans la détermination des réactifs peut être plus efficace dans l'acquisition du produit désiré PCR. Ajouter des réactifs dans la réaction est compliquée par le fait que la manipulation d'un réactif peut influer sur la concentration utilisable d'un autre réactif. En plus des réactifs énumérés ci-dessous, propriété additifs disponibles dans le commerce sont disponibles à partir de nombreuses entreprises de biotechnologie.

10. Les additifs qui bénéficieraient Modèles riche en GC

  1. Diméthylsulfoxyde (concentration finale de DMSO réaction 1-10%)
    Dans des expériences de PCR dans laquelle l'ADN matrice est particulièrement riche en GC (teneur en GC> 60%), en ajoutant le DMSO peut favoriser la réaction de perturber par appariement de bases et en réduisant efficacement la T m. Certains calculateurs T m comprennent une entrée variable pour ajouter la concentration de DMSO souhaité dans l'expérience PCR. Toutefois, l'ajout de plus de 2% de DMSO peut exiger l'ajout polymérase ADN plus il a été démontrédémontré à inhiber l'ADN polymérase Taq.
  2. Formamide (concentration finale de réaction de 1,25 à 10%)
    Comme DMSO, le formamide également perturbe appariement de bases, tout en augmentant la stringence des hybridation d'amorce, ce qui entraîne moins de non-spécifique d'amorçage et l'efficacité d'amplification accrue. Le formamide a également été montré pour être un activateur pour les modèles riches en GC.
  3. 7-déaza-2'-désoxyguanosine-5'-triphosphate (concentration finale de réaction à courant continu 7 GTP, 3 DC 7 GTP: 1 dGTP 50 uM)
    Utilisation de 3 pièces, soit 37,5 pM, de la guanosine de base analogique en courant continu GTP 7 en combinaison avec 1 partie, ou 12,5 uM, dGTP va déstabiliser la formation de structures secondaires dans le produit. Comme l'ADN amplicon ou le modèle est dénaturé, il sera souvent former des structures secondaires telles que des boucles en épingle à cheveux. Incorporation de courant continu 7 GTP dans l'amplicon ADN interdire la formation de ces structures aberrantes.

Note:

7 GTP atténue le signal de la coloration au bromure d'éthidium qui est pourquoi il est utilisé dans un rapport de 3:1 avec le dGTP.

  1. La bétaïne (concentration finale de réaction de 0,5 M à 2,5 M)
    Bétaïne (N, N, N-triméthylglycine) est un analogue d'acide aminé zwitterionique qui réduit et peut même éliminer la dépendance en température d'ADN de fusion de la composition nucléotidique. Il est utilisé comme un additif à l'aide d'amplification par PCR de la GC cibles riches. La bétaïne est souvent employé en combinaison avec du DMSO et peut grandement améliorer les chances d'ADN cible d'amplification avec un contenu en GC élevée.

11. Additifs qui aident PCR en présence d'inhibiteurs

  1. Des détergents non ioniques fonctionner pour supprimer la formation de la structure secondaire et aider à stabiliser l'ADN polymérase. Des détergents non ioniques tels que le Triton X-100, Tween 20, ou NP-40 peut être utilisé à des concentrations de réaction de 0,1 à 1% afin d'augmenter la production amplicon. Toutefois, concentrtions supérieures à 1% peut être inhibitrice à la PCR. La présence de détergents non ioniques diminue la rigueur PCR, qui pourrait aboutir à la formation du produit factice. Toutefois, leur utilisation sera également neutraliser l'inhibiteur affecte de la SDD, un contaminant occasionnel de protocoles d'extraction d'ADN.
  2. Addition de protéines spécifiques tels que l'albumine de sérum bovin (BSA) utilisé à 400 du gène de protéine 32 ng / l et / ou T4 à 150 aide ng / pi PCR en présence d'inhibiteurs tels que FeCl 3, hémine, l'acide fulvique, l'acide humique, acides tanniques, ou des extraits de selles, d'eau douce et l'eau marine. Cependant, les inhibiteurs de PCR, y compris les sels biliaires, de la bilirubine, l'EDTA, du NaCl, SDS, ou le Triton X-100, ne sont pas atténués par addition soit BSA ou T4 gène 32 protéine.

12. Modifications des conditions vélo

  1. Optimisation de la température de recuit permettra d'améliorer toute réaction PCR et doit être considérée en combinaison avec d'autres additifs et / ou avec d'autres mo difications des conditions de cyclisme. Ainsi, afin de calculer la température optimale de recuit de l'équation suivante est utilisée:
    T a OPT = 0,3 T m Primer + 0,7 T m produit -14,9
    T m apprêt est calculée comme la Tm de la paire moins stable en utilisant l'équation:
    T m = abc ((AH ​​/ (AS + R x ln (c / 4))) + 16,6 -273,15 log [K +] où AH est la somme des plus proches voisins variations d'enthalpie pour hybrides; AS est la somme de l' plus proches voisins variations d'entropie, R est la constante des gaz (1,99 cal K-1 mol-1); C est la concentration d'amorce, et [K +] est la concentration de potassium.
    Cette dernière équation ne peut être calculé en utilisant l'un des calculateurs m T énumérés à l'adresse suivante:
    rs / fusion / sup_mat / servers_list.html "target =" _blank "> http://protein.bio.puc.cl/cardex/servers/melting/sup_mat/servers_list.html
    T m du produit est calculée comme suit:
    T = 0,41 m du produit (GC%) + 16,6 log [K +] - longueur 675/product
    Pour la plupart des réactions PCR de la concentration de potassium ([K +]) va être de 50 mm.
  2. Démarrage à chaud PCR est une modification polyvalent dans lequel le temps de dénaturation initiale est augmenté de façon spectaculaire (tableau 4). Cette modification peut être constituée avec ou sans d'autres modifications aux conditions de cyclisme. En outre, il est souvent utilisé en conjonction avec des additifs pour la formation amplicon capricieuse. En fait, à chaud début PCR est de plus en plus comme un aspect régulier des conditions générales de cyclisme. Démarrage à chaud a été démontrée pour augmenter le rendement amplicon, tout en augmentant la spécificité et la fidélité de la réaction.Le raisonnement derrière chaud début PCR est d'éliminer les dimères d'amorce et non spécifique d'amorçage qui peuvent être une conséquence de la mise en place de la réaction ci-dessous la m T. Ainsi, une réaction de début typique chaude chauffe l'échantillon à une température supérieure à la T m optimale, au moins à 60 ° C avant d'amplification est capable de se produire. En général, l'ADN polymérase est retenu à partir de la réaction au cours de la première, de forme allongée, le temps de dénaturation. Bien que d'autres composants de la réaction sont parfois omises au lieu de l'ADN polymérase, ici nous allons nous concentrer sur l'ADN polymérase. Il existe plusieurs méthodes qui permettent l'ADN polymérase de rester inactif ou physiquement séparés jusqu'à ce que la période initiale de dénaturation a terminé, y compris l'utilisation d'une barrière de cire solide, d'anticorps anti-ADN polymérase, et protéines accessoires. En variante, l'ADN polymérase peut simplement être ajouté à la réaction après le cycle de dénaturation initiale est terminée.
  3. Touchdown PCR (TD-PCR) estl'intention de prendre une partie de la conjecture de limitations T les calculs m en mettant entre parenthèses les températures calculées de recuit. Le concept est de concevoir deux phases de conditions de cyclisme (tableau 5). La première phase emploie successivement des températures plus basses de chaque cycle de recuit seconde (traditionnellement 1,0 ° C), à partir de 10 ° C au-dessus et en finissant à la Tm calculée ou légèrement en dessous. La deuxième phase utilise les types 3-étape conditions avec la température de recuit fixé à 5 ° C au-dessous de la T m calculé pendant 20 à 25 cycles. La fonction de la première phase devrait atténuer mispriming, conférant un avantage de 4 fois le produit correct. Ainsi, après 10 cycles, un avantage de 410 fois donnerait 4096 copies du produit correct sur toute l'amorçage fausse.
    • Réducteur PCR est similaire à TD-PCR avec des incréments de moins de la première phase d'amorçage. A titre d'exemple, la première phase abaisse la température de recuit tous lessecond cycle de 3 ° C, à 10 ° C au-dessus et en finissant à 2 ° C au-dessous de la Tm calculée. Comme TD-PCR, la deuxième phase utilise les types 3-étape conditions avec la température de recuit fixé à 5 ° C au-dessous de la Tm calculée pendant 20 à 25 cycles. Cela permettrait le bon produit d'un avantage de 256 fois par rapport aux produits d'amorçage de faux.
    • Ralentissement PCR est tout simplement une modification de la TD-PCR et a été couronnée de succès pour amplifier extrêmement riche en GC (ci-dessus 83%) des séquences (tableau 6). Le concept prend en compte un élément relativement nouveau associé à thermocycleurs modernes, ce qui permet le réglage de la vitesse de rampe ainsi que la vitesse de refroidissement. Le protocole utilise également à courant continu 7 GTP pour réduire la formation de structure 2 ° qui pourrait inhiber la réaction. La vitesse de rampe est abaissée à 2,5 ° C s -1 avec une vitesse de refroidissement de 1,5 ° C s -1 pendant les cycles de recuit. La première phase commence par une unenealing température de 70 ° C et réduit la température de recuit de 1 ° C toutes les 3 cycles jusqu'à ce qu'il atteigne 58 ° C. La deuxième phase se poursuit ensuite avec une température de recuit de 58 ° C pendant 15 cycles supplémentaires.
  4. La PCR nichée est un outil puissant utilisé pour éliminer les produits falsifiés. L'utilisation d'amorces imbriquées est particulièrement utile quand il ya plusieurs gènes paralogues dans un seul génome ou quand il est faible nombre de copies d'une séquence cible dans une population hétérogène de séquences orthologues. La procédure de base comporte deux jeux d'amorces qui amplifient une seule région de l'ADN. Les amorces externes chevauchent le segment d'intérêt et sont utilisés pour générer des produits de PCR qui sont souvent non spécifique de 20 à 30 cycles. Une petite aliquote, habituellement d'environ 5 pi de la première réactionnel de 50 ul, est ensuite utilisé comme matrice d'ADN pour un autre 20 à 30 cycles d'amplification en utilisant la deuxième série d'amorces qui s'hybrident à un parent emplacement interneà la première série.

D'autres protocoles de PCR sont plus spécialisées et aller au-delà de la portée du présent document. Les exemples incluent RACE-PCR, Multiplex-PCR, Vectorette-PCR, quantitative-PCR et RT-PCR.

13. Les résultats représentatifs

Représentant résultats de la PCR ont été générés en suivant les protocoles de base de PCR décrit ci-dessus. Les résultats intègrent plusieurs stratégies de dépannage pour démontrer l'effet de divers réactifs et les conditions de la réaction. Les gènes de la levure Saccharomyces cerevisiae en herbe et d'un mycobactériophage non caractérisés ont été amplifiés dans ces expériences. La norme 3-étape de PCR protocole décrit dans le tableau 2 a été utilisé pour toutes les trois expériences décrites ci-dessous.

Avant la mise en place de l'expérience PCR, l'ADN génomique de deux S. cerevisiae et le mycobactériophage ont été quantifiés et diluée à une concentration qui serait allow entre 10 4 et 10 7 molécules d'ADN par réaction. Les stocks de travail ont été préparés comme suit. Une préparation de levure de l'ADN génomique a donné 10 4 ng / ul. Une dilution à 10 ng / ul a été généré en ajoutant 48 pl dans 452 ul de TE pH 8,0 tampon. Depuis le S. génome cerevisiae est d'environ 12,5 Mo, 10 ng contiennent 7.41 X 10 5 molécules. La préparation de l'ADN génomique a donné mycobactériophage 313 ng / ul. Une dilution à 2 ng / pi a été généré en ajoutant 6,4 pi en 993,6 pi de pH 8,0 TE tampon. Cet ADN du phage est d'environ 67 Kb. Ainsi, 1 ng contient 2,73 X 10 7 molécules, ce qui est à la limite supérieure de l'ADN généralement utilisée pour une PCR. Les stocks de travail ont ensuite été utilisées pour générer les solutions de Master Mix décrites dans le Tableau 7. Des expériences variées des conditions de cycle tel que décrit ci-dessous.

Dans la figure 3a, l'ADN génomique de S. cerevisiae a été utilisé comme un modèle pour amplifierle gène GAL3, qui code une protéine impliquée dans le métabolisme du galactose. L'objectif de cette expérience était de déterminer la concentration optimale de Mg 2 + pour cet ensemble de réactifs. Pas de MgCl 2 était présent dans la mémoire tampon d'origine PCR et a dû être complétée dans les concentrations indiquées avec une gamme testée de 0,0 mm à 5,0 mm. Comme le montre la figure, un produit de PCR de la taille attendue (2098 pb) apparaît à partir d'un Mg 2 + concentration de 2,5 mM (piste 6) avec une concentration optimale à 4,0 mM (piste 9). La concentration recommandée fournies par le fabricant est de 1,5 mm, ce qui est du montant prévu dans les tampons de PCR typiques. Peut-être étonnamment, la concentration nécessaire nécessaire à la formation du produit dans cette expérience dépassé ce montant.

Une matrice d'ADN différent a été utilisé pour l'expérience présentée dans la figure 3b. L'ADN génomique à partir d'un mycobactériophage a été utilisé pour amplifier un segment d'ADN conservé 566 pb.Comme l'expérience précédente, l'optimal Mg 2 + concentration devait être déterminée. Comme le montre la figure 3b, l'amplification du produit désiré PCR nécessite au moins 2,0 mM de Mg 2 + (piste 5). Bien qu'il y ait une plus grande variabilité dans la quantité de produit formé à l'augmentation des concentrations de MgCl 2, le produit le plus de PCR a été observée à 4 mM Mg 2 + (piste 9), la même concentration observée pour la levure GAL3 gène.

Notez que dans les expériences présentées dans les figures 3A et 3B, une bande discrète a été obtenue en utilisant les conditions de cyclage pensé pour être optimale en fonction de la température de recuit d'amorces. Plus précisément, la température de dénaturation de 95 ° C avec une température de recuit de 61 ° C, et l'extension a été réalisée pendant 1 minute à 72 ° C pendant 30 cycles. La finale extension de 5 minutes a été fait alors à 72 ° C. Pour la troisième expérience présentée à la figure 3c figure 3c, ce qui était une bande discrète à la figure 3a, devient un frottis de produits non spécifiques dans ces conditions, le cyclisme sous-optimales. En outre, avec la rigueur globale de la réaction réduit, une faible quantité de Mg 2 + est requis pour former un amplicon.

Tous les trois expériences qui montrent que lorsque la concentration de Mg + 2 sont trop bas, il n'y a pas de production amplicon. Ces résultats démontrent également que lorsque les deux conditions de cyclismesont correctement conçus et les réactifs sont à des concentrations optimales, l'expérience de PCR produit un amplicon discrète correspondant à la taille attendue. Les résultats montrent l'importance de réaliser des expériences de PCR à une rigueur suffisante (par exemple, des bandes discrètes par rapport à un frottis). En outre, les expériences montrent que le changement d'un paramètre peut influer sur un autre paramètre, ce qui affecte le résultat de réaction.

Réactif Concentration des solutions d'achat d'actions Volume 13X **
Mix Master
Concentration finale
Stérile H 2 O QS à 50 pi QS à 650 pi
Tampon PCR 10X 5 pl 65 pl 1X
dNTP 10 mM 1 pl 13 pi 200 uM
MgCl 2 25 mM 3 pl 39 pl 1,5 mM
Primer avant 20 uM = 20 pmol / ul 1 pl 13 pi 20 pmol
Inverser Primer 20 uM = 20 pmol / ul 1 pl 13 pi 20 pmol
Matrice d'ADN Variable Variable Variable ~ 10 5 molécules
ADN polymérase Taq 5 unités / * pi 0,5 pl 6,5 pl 2,5 unités
50 pl / Réaction

Tableau 1. Réactifs de PCR dans l'ordre où elles devraient être ajoutés.

* Les unités peuvent varier entre les fabricants

** Ajouter tous les réactifs à l'exclusion de toute Master Mix dans le besoin de titrage ou qui peut être variable à la réaction. Le Master Mix représenté dans le tableau ci-dessus est calculé pour 11 réactions plus 2 réactions supplémentaires pour accueillir la perte pipette de transfert s'assurer qu'il ya assez d'aliquote de chaque tube de réaction.

Norme 3-étape de PCR vélo
Étape du cycle de Température Temps Nombre de cycles
Dénaturation initiale 94 ° C à 98 ° C 1 minute 1
Dénaturation
Recuit
Extension
94 ° C
5 ° C inférieure à T m
70 ° C à 80 ° C
10 à 60 secondes
30 secondes
Polymérase ADN dépendante et Amplicon
25-35
Extension final 70 & dpar exemple; C à 80 ° C 5 minutes 1
Tenez * 4 ° C 1

Tableau 2. Type 3-étape à vélo PCR.

* La plupart des cyclistes thermiques ont la capacité de faire une pause à 4 ° C indéfiniment à la fin des cycles.

70 ° C à 80 ° C
2-étape de PCR cyclisme
Étape du cycle de Température Temps Nombre de cycles
Dénaturation initiale 94 ° C à 98 ° C 1 minute 1
Dénaturation
Recuit / Extension
10 à 60 secondes
Polymérase ADN dépendante et Amplicon
25-35
Extension final 70 ° C à 80 ° C 5 minutes 1

Tableau 3. 2-étape cyclisme PCR.

Hot Start PCR vélo
Étape du cycle de Température Temps Cycles
Dénaturation initiale 60 ° C à 95 ° C 5 minutes puis ajouter l'ADN polymérase 1
Dénaturation
Recuit
Extension
94 ° C
5 ° C inférieure à T m
70 ° C à 80 ° C
10 à 60 secondes
30 secondes
Polymérase ADN dépendante et Amplicon
25-35
Extension final 70 ° C à 80 ° C 5 minutes 1

Tableau 4. Hot Start PCR vélo.

Touchdown PCR vélo
Étape du cycle de Température Temps Cycles
Dénaturation initiale 94 ° C à 98 ° C 1
Dénaturation
Recuit
Extension
94 ° C
X = 10 ° C au-dessus Tm
70 ° C à 80 ° C
10 à 60 secondes
30 secondes
Polymérase ADN dépendante et Amplicon
2
Dénaturation
Recuit


Extension
94 ° C
X-1 ° C de réduire de 1 ° C tous les deux cycles
70 ° C à 80 ° C
10 à 60 secondes
30 secondes
Amplicon et de la polymérase dépendante
28
Dénaturation
Recuit
Extension 94 ° C
5 ° C inférieure à T m
70 ° C à 80 ° C
10 à 60 secondes
30 secondes
Polymérase ADN dépendante et Amplicon
20-25
Extension final 70 ° C à 80 ° C 5 minutes 1

Tableau 5. Touchdown PCR vélo.

Ralentissement PCR vélo
Étape du cycle de Temdegré voulu Temps Cycles
Dénaturation initiale 94 ° C à 98 ° C 1 minute 1
Dénaturation
Recuit
Extension
94 ° C
X ° C = 10 ° C au-dessus Tm
70 ° C à 80 ° C
10 à 60 secondes
30 secondes
Amplicon et de la polymérase dépendante
2
Dénaturation
Recuit


Extension
94 ° C
X-1 ° C de réduire de 1 ° C tous les deux cycles
70 ° C à 80 ° C *
10 à 60 secondes
30 secondes
Unemplicon et polymérase dépendante
28
Dénaturation
Recuit
Extension
94 ° C
5 ° C inférieure à T m
70 ° C à 80 ° C
10 à 60 secondes
30 secondes
Amplicon et de la polymérase dépendante
20-25
Extension final 70 ° C à 80 ° C 5 minutes 1

Tableau 6. Ralentissement PCR vélo.

* Pour ralentissement PCR, la vitesse de rampe est abaissée à 2,5 ° C s -1 avec une vitesse de refroidissement de 1,5 ° C s -1 pendant les cycles de recuit.

Solution stock Volume ajouté à réactionnel de 50 ul 13 Mix Master X de levure 13 X Phage Master Mix Concentration finale
Stérile H 2 O qs à 50 pi = 31 pi ou 30,5 qs à 650 pi = 396,5 qs à 520 pl = pl 403
Tampon PCR 10X 5 pl 65 pl 65 pl 1X
10 mM 1 pl 13 pi 13 pi 200 uM
MgCl 2 Titrage Ajouté à chaque réaction Ajouté à chaque réaction Ajouté à chaque réaction Des variables, voir titrage
Primer avant 20 uM = 20 pmol / ul 1 pl 13 pi 13 pi 20 pmol
Inverser Primer 20 uM = 20 pmol / ul 1 pl 13 pi 13 pi 20 pmol
Matrice d'ADN 2 ng / ul phage ou 10 ng / ul levure 0,5 ou 1 Phage ul ul levure 6,5 pl 13 pi ~ 10 7 molécules de phage ou ~ 10 5 molécules de levure
Polymérase 0,5 unités / ** ul 0,5 pl 6,5 pl 6,5 pl 0,5 unités / Réaction
40 pl + 10 (titrage) ul / Réaction TITRAGE
[MgCl 2] 0,00 mm 0,5 mM 1,0 mM 1,5 mM 2,0 mM 2,5 mM 3,0 mM 3,5 mM 4,0 mM 4,5 mM 5,0 mM
MgCl 2 0,00 pi 1,00 pi 2,00 pi 3,0 pl 4,00 pi 5,00 pi 6,00 pi 7,00 pi 8,00 pi 9,00 pi 10,00 pi
H 2 O 10,00 pi 9,00 pi 8,00 pi 7,00 pi 6,00 pi 5,00 pi 4,00 pi 3,00 pi 2,00 pi 1,00 pi 0,00 pi

<strong> Tableau 7. Titrage de Mg 2 + utilisé dans la figure 3.

Figure 1
Figure 1. Problèmes communs qui se posent avec des amorces et des 3-étape d'amplification par PCR de l'ADN cible. (A) d'auto-recuit d'amorces entraînant la formation de la structure en épingle à cheveux boucle secondaire. Notez que les amorces ne sont pas toujours recuit aux extrémités et peut former des structures plus petites boucles. (B) hybridation d'amorce à l'autre, plutôt que la matrice d'ADN, créant dimères d'amorces. Une fois les amorces s'hybrident les uns aux autres, ils seront allongés aux extrémités d'amorces. (C) des cycles de PCR générer un amplicon spécifique. Norme 3-étape de PCR vélo comprennent la dénaturation de l'ADN matrice, hybridation avec les amorces, et l'extension de l'ADN cible (amplicon) par l'ADN polymérase.

Figure 2
Seau à glace la figure 2. Avec Reagents, les pipettes et supports nécessaires pour une PCR. (1.) P-200 de pipette, (2.) P-1000 de pipette, (3.) P-20 de pipette, (4.) P-10 de pipette, (5). Plaque à 96 puits, et 0,2 ml à paroi mince tubes PCR , (6.) Réactifs, y compris la Taq polymérase, tampon de PCR 10X, MgCl 2, de l'eau stérile, dNTP, amorces et l'ADN matrice, (7.) 1,8 ml tubes et la crémaillère.

Figure 3
Figure 3. Exemple de 2 Mg + titrages utilisés pour optimiser une expérience de PCR en utilisant une norme 3-étape du protocole PCR. (A) S. l'ADN génomique de levure cerevisiae a été utilisé comme un modèle pour amplifier un pb 2098 GAL3 gène. Dans les voies 1 à 6, où le Mg 2 + concentration est trop faible, soit il n'existe pas de produit formé (voies 1-5) ou très peu de produit formé (piste 6). Lanes 7 à 11 représentent des concentrations optimales de Mg 2 + pour cette expérience PCR comme indiqué par la présence du produit 2098 amplicon pb. (B) Un uncharacterized matrice d'ADN génomique a été mycobactériophage utilisées pour amplifier un amplicon de 566 pb. Voies 1 à 4, Mg 2 + concentration est trop faible, comme indiqué par l'absence de produit. Lanes 5 à 11 représentent des concentrations optimales de Mg 2 + pour cette PCR comme indiqué par la présence du produit 566 ko amplicon. (C). S. l'ADN génomique de levure cerevisiae a été utilisé comme un modèle pour amplifier un gène 2098 pb GAL3 comme indiqué dans le panneau a. Toutefois, la température de recuit a été ramené de 61 ° C à 58 ° C, ce qui entraîne quelques bandes PCR non spécifiques avec des longueurs variables produisant un effet bavures sur le gel d'agarose. Les pistes 1 à 4, où le Mg 2 + concentration est trop faible, il n'y a pas de produit formé. Lanes 5 à 8 représentent des concentrations optimales de Mg 2 + pour cette PCR comme on le voit par la présence d'un frottis et de la bande autour de la taille 2098 ko produit amplicon. Lanes 9 à 11 sont révélateurs des conditions excessivement strictes sans produit formé. (AC) est une Lanes 12 négatifs auve de contrôle qui ne contient aucune matrice d'ADN. Lane M (marqueur) a été chargé par l'ONÉ 1kb Ladder.

Figure 4
Figure 4. Tubes stériles utilisés pour la PCR. (1.) 1,8 ml tube (2.) 0,2 ml personne mince tube à paroi PCR, (3.) 0,2 ml de bandes minces parois des tubes PCR et casquettes.

Figure 5
Figure 5. Thermocycleur. Fermé l'image thermocycleur gauche. Image de droite contient 0,2 ml à paroi mince tubes PCR placées dans le bloc de chauffage d'un cycleur thermique ouvert.

Discussion

PCR est devenue un outil indispensable dans l'arsenal des sciences biologiques. PCR a changé le cours de la science qui permet aux biologistes de céder le pouvoir au cours des génomes, et de faire des gènes hybrides avec de nouvelles fonctions, permettant spécifique et précis des essais cliniques, en obtenant un aperçu sur les génomes et de la diversité, ainsi que les gènes tout simplement de clonage pour l'analyse biochimique plus loin. L'application PCR n'est limitée que par l'imagination du scientifique qui exerce son pouvoir. Il ya beaucoup de livres et de documents qui décrivent les nouvelles utilisations spécialisées de la PCR, et beaucoup d'autres seront développés au cours de la prochaine génération de la science biologique. Cependant, quelles que soient les approches prévues, le cadre fondamental est resté le même. PCR, dans toute sa grandeur, est une application in vitro afin de générer de grandes quantités d'un segment spécifique de l'ADN.

Conception d'une expérience de PCR nécessite une réflexion et de patience. Les résultats présentés dans la figure 3 illustrent l'un des principaux challenges lors de la conception d'une stratégie d'optimisation pour la PCR. C'est, comme un paramètre de la PCR est modifié, il peut avoir un impact autre. A titre d'exemple, si la première PCR a été réalisée à la température de recuit sous-optimale (58 ° C) avec une concentration de 2 mg optimale + de 2,0 mM, alors le résultat serait de produire un frottis comme on le voit dans la figure 3c. Une tentative pour résoudre le frottis peut impliquer la mise en place des conditions de PCR avec des réactions contenant 2,0 mM MgCl 2 et en ajustant la température de recuit à 61 ° C. Toutefois, comme on le voit dans la figure 3a, ce ne serait pas céder un quelconque produit. Par conséquent, il est conseillé de doser les réactifs, plutôt que l'ajout d'une concentration à une seule réaction, lors du dépannage des résultats erronés. En outre, les ajustements les plus courants qui sont nécessaires pour l'optimisation d'un expérience de PCR sont à changer le Mg 2 + concentration et de corriger les températures de recuit. Toutefois, si ces changements ne sont pas de minimiser ou d'abroger des résultats aberrants, titrage de additives et / ou de modifier les protocoles de la situation de cyclisme tels que décrits dans les tableaux 2-6 peuvent atténuer le problème. Si tout cela échoue, redessiner les amorces et essayez, essayez encore.

Disclosures

Je n'ai rien à communiquer.

Acknowledgments

Un merci spécial à Kris Reddi à l'UCLA pour la mise en place des réactifs et en versant des gels et à Erin Sanders à l'UCLA pour l'inspiration, d'orientation et de soutien et de la relecture du manuscrit. Je tiens également à remercier Giancarlo Costaguta et Gregory S. Payne pour la fourniture de l'ADN génomique de levure et des amorces pour amplifier le gène GAL3. Je voudrais également remercier Shah Bhairav ​​pour prendre des photos de l'équipement de laboratoire et des réactifs utilisés pour faire des figures 2 à 4. Le financement de ce projet a été fourni par HHMI (HHMI Grant n ° 52006944).

Materials

Name Company Catalog Number Comments
Taq Polymeras Sigma-Aldrich D4545-25UN
dNTPs Qiagen 201225
0.2 ml Thin Wall Tubes PCR tubes Bio-Rad 223-9469
0.2 ml Thin Wall Tube caps Bio-Rad 223-9472
EDTA disodium salt dihydrate Sigma-Aldrich E5134
Trizma-HCl Sigma-Aldrich T-3253
Custom Phage Primer Invitrogen 25441F_RL6_Contig2_68k TACTGCAACGCGATGTTGCG
Custom Phage Primer Invitrogen 26007R_RL6_ Contig2_68k TCACCATCAATCGTGGCGGT
Custom Yeast Primer Integrated DNA Technologies SacI-Gal3(-256) ACCTGGAGCTCCTATTT TAACATGTGGATTTCTTGAAAGAATGAAATCG
Custom Yeast Primer Integrated DNA Technologies Gal3(1848)-SacI CGGATGGAGCTCGCGT GAAGGTAATTTTTTTTTATGTCTCCG
Thermal Cycler Bio-Rad 170-9703 My Cycler
Agarose ISC BioExpress E-3120-500
Gel electrophoresis Hoeffer Scientific Instruments Model HE33
1 kb DNA Ladder New England Biolabs N3232S
Bio Rad Power Pack Bio-Rad 164-5050 PowerPac Basic
Gel Doc system Fotodyne Incorporated FOTO/Analyst Investigator FX Workstation

DOWNLOAD MATERIALS LIST

References

  1. Albert, J., Fenyo, E. M. Simple sensitive, and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers. J. Clin. Microbiol. 28, 1560-1564 (1990).
  2. Baskaran, N., et al. Uniform amplification of a mixture of deoxyribonucleic acids with varying GC content. Genome Res. 6, 633-638 (1996).
  3. Blanchard, M. M., Taillon-Miller, P., Nowotny, P., Nowotny, V. PCR buffer optimization with uniform temperature regimen to facilitate automation. PCR Methods Appl. 2, 234-240 (1993).
  4. Borer, P. N., Dengler, B., Tinoco, I. Jr, Uhlenbeck, O. C. Stability of ribonucleic acid double-stranded helices. J. Mol. Biol. 86, 843-853 (1974).
  5. Breslauer, K. J., Frank, R., Blocker, H., Marky, L. A. Predicting DNA duplex stability from the base sequence. Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750 (1986).
  6. Chou, Q., Russell, M., Birch, D. E., Raymond, J., Bloch, W. Prevention of pre-PCR mis-priming and primer dimerization improves low-copy-number amplifications. Nucleic Acids Res. 20, 1717-1723 (1992).
  7. Coleman, W. B., Tsongalis, G. J. Diagnostics for the clinical laboration. Humana Press. (2005).
  8. D'Aquila, R. T., et al. Maximizing sensitivity and specificity of PCR by pre-amplification heating. Nucleic Acids Res. 19, 3749 (1991).
  9. Dieffenbach, C. W., Lowe, T. M., Dveksler, G. S. General concepts for PCR primer design. PCR Methods Appl. 3, S30-S37 (1993).
  10. Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K., Mattick, J. S. 'Touchdown' PCR to circumvent spurious priming during gene amplification. Nucleic Acids Res. 19, 4008 (1991).
  11. Erlich, H. A., Gelfand, D., Sninsky, J. J. Recent advances in the polymerase chain reaction. Science. 252, 1643-1651 (1991).
  12. Frey, U. H., Bachmann, H. S., Peters, J., Siffert, W. PCR-amplification of GC-rich regions: 'slowdown PCR. Nat. Protoc. 3, 1312-1317 (2008).
  13. Haqqi, T. M., Sarkar, G., David, C. S., Sommer, S. S. Specific amplification with PCR of a refractory segment of genomic DNA. Nucleic Acids Res. 16, 11844 (1988).
  14. Henke, W., Herdel, K., Jung, K., Schnorr, D., Loening, S. A. Betaine improves the PCR amplification of GC-rich DNA sequences. Nucleic Acids Res. 25, 3957-3958 (1997).
  15. Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T. J. PCR Protocols: A guide to methods and applications. Academic Press, Inc. San Diego. (1990).
  16. King, N. Methods in Molecular Biology. 630, Humana Press. (2010).
  17. Kleppe, K., Ohtsuka, E., Kleppe, R., Molineux, I., Khorana, H. G. Studies on polynucleotides. XCVI. Repair replications of short synthetic DNA's as catalyzed by DNA polymerases. J. Mol. Biol. 56, 341-361 (1971).
  18. Korbie, D. J., Mattick, J. S. Touchdown PCR for increased specificity and sensitivity in PCR amplification. Nat. Protoc. 3, 1452-1456 (2008).
  19. Kramer, M. F., Coen, D. M. Enzymatic amplification of DNA by PCR: standard procedures and optimization. Curr. Protoc. Toxicol. Appendix 3, 1-14 (2001).
  20. Kramer, M. F., Coen, D. M. The polymerase chain reaction. Curr. Protoc. Protein Sci. Appendix 4, Appendix 4J (2002).
  21. Kreader, C. A. Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein. Appl. Environ. Microbiol. 62, 1102-1106 (1996).
  22. Kwok, S., et al. Identification of human immunodeficiency virus sequences by using in vitro enzymatic amplification and oligomer cleavage detection. J. Virol. 61, 1690-1694 (1987).
  23. McConlogue, L., Brow, M. A., Innis, M. A. Structure-independent DNA amplification by PCR using 7-deaza-2'-deoxyguanosine. Nucleic Acids Res. 16, 9869 (1988).
  24. Mullis, K. B. The unusual origin of the polymerase chain reaction. Sci. Am. 262, 56-65 (1990).
  25. Mullis, K. B. Target amplification for DNA analysis by the polymerase chain reaction. Ann. Biol. Clin. (Paris). 48, 579-582 (1990).
  26. Mullis, K. B. The polymerase chain reaction in an anemic mode: how to avoid cold oligodeoxyribonuclear fusion). PCR Methods Appl. 1, 1-4 (1991).
  27. Mullis, K. B., Faloona, F. A. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol. 155, 335-350 (1987).
  28. Paabo, S., Gifford, J. A., Wilson, A. C. Mitochondrial DNA sequences from a 7000-year old brain. Nucleic Acids Res. 16, 9775-9787 (1988).
  29. Rees, W. A., Yager, T. D., Korte, J., von Hippel, P. H. Betaine can eliminate the base pair composition dependence of DNA melting. Biochemistry. 32, 137-144 (1993).
  30. Roux, K. H., Hecker, K. H. One-step optimization using touchdown and stepdown PCR. Methods Mol. Biol. 67, 39-45 (1997).
  31. Rychlik, W., Spencer, W. J., Rhoads, R. E. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res. 18, 6409-6412 (1990).
  32. Saiki, R. K., et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 239, 487-491 (1988).
  33. Saiki, R. K., et al. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science. 230, 1350-1354 (1985).
  34. Sambrook, J. A. R., David, W. Molecular Cloning A Laboratory Manual. 2, 3, Cold Spring Harbor Laboratory Press. (2001).
  35. Sarkar, G., Kapelner, S., Sommer, S. S. Formamide can dramatically improve the specificity of PCR. Nucleic Acids Res. 18, 7465 (1990).
  36. Smit, V. T., et al. KRAS codon 12 mutations occur very frequently in pancreatic adenocarcinomas. Nucleic Acids Res. 16, 7773-7782 (1988).
  37. Wilson, I. G. Inhibition and facilitation of nucleic acid amplification. Appl. Environ. Microbiol. 63, 3741-3751 (1997).
  38. Wu, R. Methods in Enzymology. 218, Academic Press, Inc. San Diego. (1993).

Comments

1 Comment

  1. Thanks for the great overview of the all-important PCR procedure. I will no doubt reference it often in the future.

    I have a PCR troubleshooting question...what do to about streaking on the gel after a successful amplification? My bands are nice and bright and where they are supposed to be, but there is a heavily-streaked "path" starting at the wells and following until the end where my bands are. Is there something I can do about my PCR conditions, or the thermocycler settings? Any comments would be appreciated.

    Reply
    Posted by: Doug E.
    September 8, 2013 - 1:23 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics