الجيل المؤتلف الإنسان مفتش حيدة النسيلة من مخلد خلايا التصنيف B

* These authors contributed equally
JoVE Journal
Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Nogales-Gadea, G., Saxena, A., Hoffmann, C., Hounjet, J., Coenen, D., Molenaar, P., Losen, M., Martinez-Martinez, P. Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells. J. Vis. Exp. (100), e52830, doi:10.3791/52830 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

الهدف من هذه المقالة لوصف بالتفصيل منهجية لتوليد وتوصيف الأجسام المضادة وحيدة النسيلة مفتش الإنسان التي تم الحصول عليها من خلايا الدم وحيدات النوى المحيطية الإنسان (PBMCs).

نما الاهتمام لدراسة الأجسام المضادة البشرية في كثير من المجالات المختلفة للبحث. على وجه الخصوص، العديد من المجموعات البحثية المهتمة في علم الأمراض الناجمة عن أضداد ذاتية 1-3. لقد المستنسخة وتتميز المسببة للأمراض أضداد ذاتية 1. دراسة أضداد ذاتية يمكن أن تساعد على تحديد أهدافها ووضع استراتيجيات علاجية، على سبيل المثال، وذلك باستخدام الأجسام المضادة منافس 4. وعلاوة على ذلك، ودراسة الأجسام المضادة البشرية يمكن أيضا أن تكون ذات فائدة في مجالات أخرى من مجالات البحوث، أي لتقييم الاستجابة المناعية بعد التطعيم لتوصيف الشخصي الأجسام المضادة للأفراد التي تعرضت وأصبحت مقاومة لمسببات الأمراض المحددة 6 أو للدراسة التي الأجسام المضادة هي فيمرجع الطبيعي 7،12.

وقد تم تطوير العديد من التقنيات لتوليد المؤتلف الاجسام المضادة الإنسان 12/08؛ معظم هذه استخدام عرض فج وتخليد B-الخلية. استخدام عرض فج تم تطبيق على نطاق واسع لاكتشاف الأجسام المضادة الجديدة 13. ومع ذلك فإنه لديه العيب الرئيسي، ألا وهو أن أزواج الثقيلة والخفيفة سلسلة من الغلوبولين المناعي البشري تصبح نأت في هذه العملية. إنتاج الهجينة مع الخلايا B الإنسان أو التحول EBV يتغلب على هذا العائق.

نستخدم إصابة الخلايا B الغدة الصعترية مع EBV في تركيبة مع بولكلونل B تحفيز الخلايا عبر تول مثل مستقبلات 9 (TLR-9) 6،12.

في هذه الورقة، ونحن تصف بالتفصيل التكنولوجيا التي نستخدمها لتطوير الأجسام المضادة البشرية مفتش، مع لمحة كاملة من جميع الخطوات من PBMC العزلة لفي المختبر توليد الأجسام المضادة. هذابروتوكول يمكن استخدامها لتحليل أي نوع من التشكيل مفتش البشري. في مختبرنا، والخلايا B تنتج الأجسام المضادة مفتش تم فصلها بنجاح من بقية PBMCs بعد الفرز. خمسون خلايا B فرز 8 ومن ثم يمكن مطلي في لوحات متعددة جيدا وخلد من قبل EBV وTLR-9 التنشيط، للتوسع نسيلي خلايا B واحدة. كما الخلايا المغذية، وقد استخدمت الخلايا الليفية من أنسجة الرئة الجنينية البشرية، خط خلية wi38، مما يسهل التصور من الخلايا B خلد. من هذه الخلايا B، متواليات من قيوده الثقيلة والخفيفة من الغلوبولين المناعي يمكن الحصول عليها عن طريق PCR، والجينات الأجسام المضادة "استنساخ في الغلوبولين المناعي G ناقلات التعبير وأنتجت في المختبر. باستخدام هذه التقنية، والأجسام المضادة وحيدة مع بالضبط نفس تسلسل الأجسام المضادة الموجودة في الجهة المانحة يمكن دراستها.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

تم الحصول على الموافقة المسبقة من المشاركين في الدراسة. وتمت الموافقة على الدراسة من قبل لجنة الأخلاق المؤسسية.

1. عزل خلايا الدم المحيطي وحيدات النوى (PBMCs)

  1. الطرد المركزي 25 مل من الدم heparinized المشاركين في 900 x ج لمدة 15 دقيقة، في أقرب وقت ممكن بعد استخراج الدم. إذا كان هناك دم أقل، تقليص الكواشف وفقا لذلك. تنفيذ كافة الخطوات التالية في غطاء محرك السيارة.
  2. نقل الدم إلى أنبوب نظيفة. ويمكن استخدامه في خطوات لاحقة لتجميد PBMCs أو في حالة مرضى المناعة الذاتية، لاختبار أضداد ذاتية.
  3. تمييع الدم مع 10 مل من RPMI 1640 وسائل الإعلام و resuspend الخلايا عن طريق pipetting صعودا وهبوطا.
  4. إضافة 15 مل من محلول يحتوي على polysucrose والصوديوم دياتريزوات (1.077 جم / مل) إلى أنبوب جديد 50 مل.
  5. طبقة بلطف الدم على رأس من الحل في الخطوة 1.4 من خلال جلب فتحتي أنابيب toget قريبلها حتى السائلين تأتي ببطء شديد في الاتصال، ثم صب تعليق PBMC ببطء على الجزء العلوي من أنبوب 50 مل. هذه الخطوة مهمة لديك فصل جيد من PBMCs.
  6. الطرد المركزي أنبوب حصلت عليه في الخطوة 1.5 في 400 x ج بدون فرامل في RT لمدة 20 دقيقة.
  7. بعد الطرد المركزي، واستعادة مع الماصة الحلقة البيضاء الذي يظهر في الجزء الأوسط من الأنبوب الذي يحتوي على PBMCs.
  8. غسل الخلايا مع 25 مل من RPMI 1640 وسائل الإعلام.
  9. أجهزة الطرد المركزي 300 x ج في RT لمدة 10 دقيقة.
  10. تجاهل طاف وغسل الخلايا مع 10 مل من RPMI 1640. الطرد المركزي مرة أخرى كما في الخطوة 1.9.
  11. عد PBMCs مع غرفة نويباور كما ذكرت سابقا 14.
  12. معالجة PBMCs كما في القسم 2 أو تخزينها لاستخدامها لاحقا على النحو التالي: 10000000 PBMCs لتجميد في أنبوب Cryovial المخفف في 1 مل من 10٪ ثنائي ميثيل سلفوكسيد (DMSO) و 90٪ مصل حصلت عليه في الخطوة 1.2. تجميد تدريجيا وستو طويلةالغضب في النيتروجين السائل.

2. تلطيخ PBMCs لفرز CD22 + و IgG + من قبل خلية الخلوي

  1. لوحة من PBMCs في 25 سم 2 خلية قارورة الثقافة مع 6 مل من RPMI 1640 متوسطة (تستكمل مع L-الجلوتامين، 10 ملي العازلة HEPES، 50 U / البنسلين مل، 50 ميكروغرام / الستربتومايسين مل و 10٪ من مصل بقري جنيني) والسماح لهم استعادة O / N في الحاضنة عند 37 درجة مئوية في 5٪ CO 2.
  2. منع أنابيب FACS العقيمة مع معقم 4٪ الزلال الفوسفات مخزنة المالحة (PBS) حل O / N. غسل الأنابيب مرتين مع برنامج تلفزيوني وملئها 500 ميكرولتر من اكتمال RPMI 1640 متوسطة. استخدام هذه الأنابيب لاستعادة الخلايا بعد الفرز.
  3. جمع PBMCs في أنبوب وأجهزة الطرد المركزي في 400 x ج في RT لمدة 5 دقائق.
  4. resuspend الخلايا في المخزن وضع العلامات (راجع الخطوات 2.5 و 2.6) ونعدهم 14. المخزن المؤقت وضع العلامات معقم 2٪ مصل بقري جنيني و1 ملم حمض ethylenediaminetetraacetic (EDTA) في PBS.
  5. إعداد 3 خلية الفرز (FACS) الأنابيب مضان تنشيط مع 10 5 خلايا لكل و resuspend لهم في 100 ميكرولتر من العازلة وضع العلامات. وهذه الأنابيب مناصبهم لتحديد بوابات الفرز.
    1. في الأنبوب الأول إضافة 5 ميكرولتر من مكافحة CD22 PerCP الأجسام المضادة (الموصى بها في ورقة بيانات المصنع)، في الثاني أنبوب 20 ميكرولتر المضادة مفتش PE (الموصى بها في ورقة بيانات المصنع)، وليس في الأنبوب الثالث. احتضان على الجليد وفي الظلام خلال 30 دقيقة.
  6. و resuspend 5 ملايين الخلايا في 200 ميكرولتر من العازلة وضع العلامات في أنبوب FACS وإضافة 10 ميكرولتر من مكافحة CD22 PerCP و 40 ميكرولتر المضادة مفتش PE. احتضان الخلايا على الجليد والظلام خلال 30 دقيقة. إذا كان المطلوب الفرز لعدد أكبر من الخلايا، توسيع نطاق جميع الكواشف.
  7. خلايا الطرد المركزي في 400 x ج مع الفرامل خفيفة لمدة 5 دقائق على RT.
  8. صب بهدوء طاف.
  9. resuspend الخلايا في 500 μلتر من العازلة وضع العلامات. خلايا الطرد المركزي في 400 x ج مع الفرامل خفيفة لمدة 5 دقائق على RT. كرر الخطوات من 2.7 و 2.8
  10. صب بهدوء وطاف resuspend الخلايا في 300 ميكرولتر من RPMI وسائل الإعلام كاملة.
  11. تمر الخلايا من خلال 0.45 ميكرون التصفية. الخلايا جاهزة لفرز.

3. الفرز من خلايا B CD22 + و IgG +

  1. استخدام 3 أنابيب التحكم لتحديد الجدوى من الخلايا. في عنصر التحكم مع أي تلطيخ، استخدم المؤامرة إلى الأمام وحجم مبعثر لتحديد النابضة اللمفاويات. الضوابط مع CD22 PerCP ومكافحة مفتش PE تعمل على إنشاء البوابات، وبوابة الفرز. أداء التالية بيانات أبلغ عنها سابقا 15.
    ملاحظة: بوابة عبارة عن مجموعة من حدود قيمة (حدود) التي تعمل على عزل مجموعة معينة من الأحداث cytometric، في الخلايا حالتنا، من مجموعة كبيرة. في حالة وجود بوابة الفرز حدود القيمة يسمح للانتعاش الأحداث cytometric، والخلايا، والتي هي داخلحدود محددة: CD22 + و IgG +.
  2. كما أنبوب جمع في الفرز، واستخدام أنابيب سدت مع 500 ميكرولتر من اكتمال RPMI 1640 متوسطة، تم الحصول عليها من الخطوة 2.2.
  3. الشروع في فرز ضعف الإيجابي 15: CD22 + مفتش +. لاحظ العدد النهائي للخلايا في كل حالة. لوحة فرز الخلايا في أعلى الخلايا المغذية في أقرب وقت ممكن.

4. إشعاع من الخلايا المغذية

ملاحظة: إجراء إعداد الخلايا المغذية بين 1-3 أيام قبل الفرز. وهناك حاجة إلى 5000 wi38 على الأقل الخلايا لكل بئر في 96 جولة لوحة جيدا. تنفيذ الخطوات 4.1 و 4.2 و 4.4 في غطاء محرك السيارة.

  1. زراعة الخلايا wi38 عند 37 درجة مئوية و 5٪ CO 2 في كامل RPMI 1640 متوسطة (نفس لPBMCs) حتى يتم الوصول إلى العدد المطلوب من الخلايا.
  2. أشرق لهم في 50 غرايز بعد بروتوكول صفها قبل 16 عاما. أداء التشعيع مرة واحدة وقد تم trypsinized الخلايا wi38 ومعلق في جomplete RPMI المتوسطة، أو مع wi38 تعلق على قارورة الثقافة وtrypsinized بعد التشعيع. اتبع طريقة لtrypsinization أشارت الجهة الموردة للخلايا wi38. أشرق عدد الخلايا اللازمة لتغطية الآبار اللازمة لطلاء الخلايا مفتش + B (1٪ من إجمالي PBMC أحصت في الخطوة 1.11).
  3. لوحة 90 ميكرولتر تحتوي على 5000 معرضا للاشعاع wi38 الخلايا في كل بئر من 96 لوحة مستديرة أيضا. ترك الآبار في الصف الخارجي للصحن فارغ (لأنها تتبخر أسرع)، وفقط استخدام 60 بئرا في منتصف لوحة لخلايا الطلاء. ملء الآبار الخارجي التي يتم تأطير اللوحة مع 200 ميكرولتر من برنامج تلفزيوني.
  4. وضعها في حاضنة عند 37 درجة مئوية في CO 2 5٪، لحين الحاجة إليها.

5. طلاء التصنيف PBMCs، العدوى EBV وتزايد

  1. تمييع PBMCs فرزها، لوحة 50 الخلايا في 50 ميكرولتر من RPMI 1640 متوسطة الكامل لكل بئر في 96 جولة لوحة جيدا (خفة دم مطلي سابقاح wi38 الخلايا المشع). تنفيذ الخطوات في غطاء محرك السيارة مجهزة للعمل EBV.
    ملاحظة: تم تحسين إصابة 50 خلايا لكل بئر ويزيد من likehood لإنتاج الأجسام المضادة وحيدة النسيلة ومع ذلك، فمن المستحسن أن تحقق ذلك عن طريق PCR كما هو موضح قبل 1،6.
  2. إضافة 60 ميكرولتر من EBV طاف (التي تحتوي على 3-4 × 10 8 نسخ الفيروسية / مل) إلى كل بئر في لوحة 96 جولة جيدا 17. وينبغي اتخاذ الحذر أثناء العمل EBV.
  3. إضافة 1 ميكروغرام / مل من الدليل السياسي الشامل (ODN2006) لكل بئر.
  4. ترك الخلايا في حاضنة عند 37 درجة مئوية في 5٪ CO 2.
  5. بصريا استنساخ رصد متزايد تحت المجهر بعد أسبوع واحد.
    ملاحظة: يمكن رؤية بعض الأمثلة على نمو الخلايا B أدناه في قسم النتائج. لاحظ أن قد تختلف معدلات النمو من الحيوانات المستنسخة، والوقت الاضافي قد يكون من الضروري البدء في رؤية بعض كتلة الخلايا نموا في منتصف البئر.
  6. بعد 1 الحادي أسبوعينالصورة رصد استنساخ متزايد تحت المجهر الضوئي، والشروع في تبادل وسائل الإعلام الأول. الماصة ببطء 90 ميكرولتر من المتوسط ​​من الجزء العلوي من البئر وجمع في نظيفة لوحة 96-جيدا. (خلايا B تكمن في قاع البئر، حتى لا يكون هناك أي خطر على نضح منهم).
    1. إضافة إلى كل بئر 100 ميكرولتر من RPMI كاملة 1640 وسائل الإعلام تستكمل مع 1 ميكروغرام / مل من الدليل السياسي الشامل (ODN2006) و 50 U / مل من IL2. إذا استنساخ تنمو وتحليل هذا التبادل وسائل الإعلام الأول ELISA كما في الخطوة 6.
  7. مراقبة استنساخ النمو وتغيير وسائل الاعلام بعد الثالثة 3 و 4 الأسبوع العشرين من النمو مرة أخرى عن طريق أخذ 90 ميكرولتر من وسائل الإعلام، وإضافة 100 ميكرولتر من RPMI كاملة 1640 وسائل الإعلام تستكمل مع 1 ميكروغرام / مل من الدليل السياسي الشامل (ODN2006) و 50 U / مل من IL2. استخدام طاف جمعها لمراقبة إنتاج مفتش بواسطة ELISA كما في الخطوة 6.
    ملاحظة: بعد استنساخ شهر واحد المتنامي يجب أن يكون واضحا من خلال مراقبة مجاميع من الخلايا المستديرة ثار تكمن عادة في منتصف أسفل جولة جيدا.
  8. في هذه الخطوة، وتغيير وسائل الاعلام في بنفس الطريقة التي الأسابيع السابقة ولكن فقط مع كامل RPMI 1640 وسائل الإعلام. وهناك مؤشر جيد أن يعرف اللحظة المناسبة لتغيير وسائل الاعلام هو لون سائل الإعلام، إذا أصبح من خلايا صفراء في حاجة الى تبادل وسائل الإعلام.
  9. عندما لوحات 96-جيدا تحتوي على استنساخ كبيرة (حوالي 5 × 10 5 الخلايا)، نقلها إلى بئر شقة من 24 لوحة جيدا. إضافة 300 ميكرولتر من RPMI كاملة 1640 وسائل الإعلام إلى البئر الجديد. Resuspend واستنساخ المتزايد 96-جيدا، pipetting صعودا وهبوطا عدة مرات، ونقل الخلايا إلى البئر الجديد، وتوزيع متجانس. إضافة وسائط جديدة عند الحاجة.
    1. عندما الآبار من 24 لوحة جيدا مليئة الخلايا (حوالي 5 × 10 6 خلايا)، ونقل إلى بئر شقة لوحة 6 جيدا. إضافة 2 مل من RPMI كاملة 1640 وسائل الإعلام إلى الجديد بشكل جيد. resuspend الخلايا في 24 لوحة جيدا من قبل pipetting صعودا وهبوطا عدة مرات، وتوزيعها homogeneously في البئر الجديد.
  10. إضافة وسائط عند الحاجة. إذا لم يتم الحفاظ على الخلايا في الثقافة وبيليه الخلايا في 400 x ج لمدة 5 دقائق على RT. تخزين supernatants لاختبار ELISA. يغسل بيليه الخلايا مرة واحدة مع 1 × PBS، الطرد المركزي مرة أخرى في 400 x ج لمدة 5 دقائق، وتخزينها جافة في -80 درجة مئوية حتى استخراج الحمض النووي الريبي.
    1. عندما الخلايا في لوحة 6 جيدا تصبح متكدسة (حوالي 20 × 10 6 خلايا)، ونقل إلى لوحة الثقافة 60 ملم. إضافة 4 مل من RPMI كاملة 1640 وسائل الإعلام على لوحة جديدة. resuspend الخلايا في لوحة 6 جيدا ونقلها كما فعلت هي الخطوات 5.9 و 5.10.
  11. إضافة وسائط جديدة عند الحاجة. في هذه الخطوة، وتجميد الخلايا في 10-30٬000٬000 / مل في 90٪ مصل العجل الجنين و 10٪ DMSO. إذا أراد كميات أكبر من الخلايا، ومواصلة التوسع في استنساخ في لوحات أكبر السطح.

6. ELISA للمفتش الكشف عن الأجسام المضادة

  1. الاستغناء عن 50 ميكرولتر / جيد في لوحة ELISA سو الماعز F (أ ب) 2 مكافحة الإنسان الأجسام المضادة التيسير المخفف 1 200 العازلة في الطلاء. يحتوي عازلة طلاء 50 ملي نا 2 CO 3 درجة الحموضة 9.6.
  2. ختم لوحات مع ملصقا البلاستيكية، واحتضان 1 ساعة عند 37 ° C. بدلا من ذلك، في احتضان 4 درجات CO / N.
  3. غسل كل بئر 6 مرات مع 200 ميكرولتر من غسل العازلة. يحتوي عازلة غسل 0.05٪ توين 20 في 1 × برنامج تلفزيوني. لا تلمس أو خدش السطح جيدا حيث تمت بد من الأجسام المضادة.
  4. منع مع عازلة تمنع، 100 ميكرولتر / جيد. عازلة تمنع يحتوي على 4٪ من الحليب المجفف منزوع الدسم في برنامج تلفزيوني. ختم لوحة واحتضان 1 ساعة عند 37 ° C.
  5. لا يغسل. تجاهل عازلة تمنع وصفعة لوحة 3 مرات رأسا على عقب على منشفة ورقية لإزالة السائل المتبقي.
  6. احتضان supernatants والمعايير الحيوانات المستنسخة.
    1. لأول اختبار، وتمييع supernatants استنساخ حصلت عليه في الخطوة 5.6 أو 5.7 1/3 في RPMI. لمعايير تمييع مع RPMI المتوسطة حل مفتش الإنسان في الحصول على: 1000 نانوغرام /مل، 500 نانوغرام / مل، 250 نانوغرام / مل، 125 نانوغرام / مل، 62.5 نانوغرام / مل، 31.25 نانوغرام / مل، 15.6 نانوغرام / مل وفارغة. استخدام 50 ميكرولتر / جيد واحتضان عند 37 درجة مئوية لمدة 60 دقيقة. تحليل مزيد من التخفيفات من 'طاف استنساخ لاختبار تقارب الأجسام المضادة، مثل 1/10 أو 1/100.
  7. يغسل كما فعلت في الخطوة 6.3.
  8. استخدام 50 ميكرولتر / بئر الماعز F (أ ب) 2 مكافحة الإنسان الغلوثانيون مفتش التيسير مترافق المخفف 1: 20،000 العازلة في الحضانة. يحتوي عازلة حضانة 1٪ BSA و 0.02٪ توين 20 في برنامج تلفزيوني 1X. احتضان عند 37 درجة مئوية لمدة 60 دقيقة.
  9. يغسل كما فعلت في الخطوة 6.3.
  10. إضافة 100 ميكرولتر / حل الركيزة كذلك تحتوي على 0.1٪ 3،3 '، 5،5'-Tetramethylbenzidine (TMB). احتضان 10 دقيقة حتى مستقر أشكال اللون الأزرق في الآبار. احذر؛ لا تنتظر طويلا!
  11. وقف رد الفعل من خلال إضافة 50 ميكرولتر من 2 MH 2 SO 4. قياس امتصاص عند 450 نانومتر، في غضون 30 دقيقة بعد إيقاف التفاعل.
    ملاحظة: جميع الحيوانات المستنسخة الصورةوسوف ينظر upernatants مع 3 الانحرافات المعيارية على الفراغ إيجابية عن الأجسام المضادة البشرية مفتش. للحصول على تأكيد من الحيوانات المستنسخة إيجابية هذا ELISA يجب أن يتكرر ثلاث مرات على الأقل في supernatants مختلفة من نفس استنساخ. أيضا لتجاهل إمكانية التفاعل عبر غير محددة يوصى أن أؤكد أنه لا يوجد أي إشارة عندما يتم تحضين supernatants في غير المصقول ولكن سدت الآبار. في هذه الخطوة، لفحص الكشف للكشف عن خصوصية المستضدات من الأجسام المضادة من الفائدة يمكن أن يؤديها قبل الشروع في قسم 7.

7. عزل الحمض النووي الريبي وستراند الأولى كدنا] التجميعي للإنتاج مفتش النسخ

  1. حالما يتم تأكيد إنتاج مفتش بواسطة ELISA، واستخراج الحمض النووي الريبي من استنساخ.
  2. لاستخراج الحمض النووي الريبي من الخلايا نموا في الخطوات 5.7 أو 5.9، استخدم مرتفع خلايا III مباشرة عدة توليف [كدنا]، والذي يسمح الحصول على الحمض النووي من 10000 الخلايا لخلية واحدة.
  3. لاستخراج الحمض النووي الريبي من لاركميات الالماني من الخلايا، أو من بيليه المخزنة في الخطوة 5.11 استخدام نقية مجموعة عالية عزل الحمض النووي الريبي. أنظمة أخرى من استخراج الحمض النووي الريبي يمكن أيضا أن تكون مناسبة في هذه الخطوة. اتبع تعليمات الشركة المصنعة.
  4. لأرقام الهواتف المحمولة بين 1 × 10 6 و 1 × 10 4 استخدام نظام النسخ العكسي، وبعد تعليمات من الشركة المصنعة. يمكن أن تستخدم أيضا أنظمة أخرى لحبلا الأول التوليف [كدنا].

8. 1 و 2 ش الثانية PCR لتضخيم للالثقيلة وسلاسل ضوء مفتش المنتجة للاستنساخ B-الخلية

  1. مع كدنا] من الحيوانات المستنسخة خلية، حصلت عليه في الخطوة 5.6 و 5.7 و إيجابية في مفتش ELISA في الخطوة 6، نفذ PCR مع الاشعال المدرجة في الجدول 1.
  2. إعداد تقارير إنجاز المشروعات المستقلة لكل الثقيلة، وكابا وامدا سلسلة مفتش. جعل حل الأسهم مع الأمام وعكس الاشعال في تركيزات متساوية. إضافتها إلى رد فعل عند 0.4 ميكرومتر تركيز النهائي. </ لى>
  3. استخدم 1 ميكرولتر من التوليف [كدنا لأداء 1 ST PCR. هنا، نفذ 20 ميكرولتر ردود الفعل باستخدام إرشادات الشركة المصنعة تاكارا طق. بدلا من ذلك، استخدم بلمرة أخرى.
  4. ضع 1 ش PCR في ظل الظروف دورة التالية: 94 ° C لمدة 5 دقائق. (50 دورات: 94 درجة مئوية لمدة 30 ثانية؛ 58 درجة مئوية لمدة 30 ثانية و 72 درجة مئوية لمدة 45 ثانية؛ 72 درجة مئوية لمدة 7 دقائق، ندعه يبرد في 4 درجات C.Include فارغة في رد الفعل، للكشف عن التلوث المحتملة.
  5. إعداد 1X TBE (89 ملي تريس بورات و 2 ملي EDTA). في حجم 100 مل من 1X TBE إضافة 1 غرام من الاغاروز (1٪ هلام الاغاروز). تسخين الحل في الميكروويف لمدة حوالي 1 دقيقة، حتى يحصل على حل الاغاروز. ثم إضافة 4 ميكرولتر من 10 ملغ / مل إيثيديوم بروميد (أو ما يعادلها صبغة DNA) وتخلط.
    1. صب المحتوى في علبة وانتظر حتى يحصل على بلمرة. تشغيل 5 ميكرولتر من مزيج PCR في هلام لتصور العصابات. سلسلة جزء الثقيلالصورة ينبغي أن يكون حول 400-550 نقطة أساس، في حين أن سلسلة الخفيفة يجب أن يكون حول 300-400 نقطة أساس. إذا لم يتم الكشف عن العصابات، والمضي قدما بالمثل إلى 2 الثانية PCR.
  6. استخدم 1 ميكرولتر من أول PCR مزيج لأداء 2 الثانية PCR. استخدام نفس المواد الكيميائية التي في الخطوة 8.2 ولكن باستخدام مزيج مناسب من الاشعال (انظر الجدول 1). ل2 الثانية PCR استخدام الشروط التالية: 94 ° C لمدة 5 دقائق. (50 دورات: 94 درجة مئوية لمدة 30 ثانية؛ 56.5 درجة مئوية لمدة 30 ثانية و 72 درجة مئوية لمدة 55 ثانية). 72 درجة مئوية لمدة 7 دقائق. ندعه يبرد في 4 ° C. تشمل فارغة في رد الفعل، للكشف عن التلوث PCR الممكنة.
  7. إعداد agarose هلام كما هو موضح في 8.5. تشغيل هلام لتصور المنتج PCR كما في 8.5.1 استخدم التكبير التي تحتوي على شظايا حجم المناسبة لالاستنساخ في الخطوة رقم 9 وإنتاج الأجسام المضادة في الخطوة 10.
  8. تسلسل الحمض النووي، وذلك باستخدام 10 ميكرولتر رد فعل تحتوي على 100 ​​نانوغرام من الثانية PCR 2، 0.2 ميكرومتر التمهيدي أو مزيج التمهيدي (1)، ميكرولتر من فاصل و 1 ميكرولتر من المخزن المؤقت. إجراء رد فعل التسلسل في ظل هذه الظروف: (25 دورات: 96 درجة مئوية لمدة 10 ثانية و 50 درجة مئوية لمدة 5 ثانية؛ وإلى 60 درجة مئوية لمدة 4 دقائق)؛ 60 درجة مئوية لمدة 7 دقائق. ندعه يبرد في 4 ° C.
  9. تنقية ردود الفعل التسلسل مع الأعمدة G50 microspin التالية تعليمات الشركة الصانعة. تقييم لترتيب ربط في تحليل تسلسل تلقائي كما هو موضح قبل 18 عاما. Electropherograms يجب أن تكون نظيفة وتتوافق مع تسلسل المناعي واحد.
    ملاحظة: إذا عرض المنتجات PCR تسلسل المناعي غير واضحة أو مختلطة، يرجى النظر إلى استنساخ لهم باستخدام نظام TopoTA، للحصول على متواليات معزولة ثم انتقل إلى الخطوة 9.

9. الاستنساخ وتسلسلها من قيوده الثقيلة والخفيفة من الحيوانات المستنسخة المنتجة للمفتش

  1. إعداد 1 ميكروغرام من الحمض النووي من ناقلات pFUSE2ss-CLIg-هونج كونج، pFUSE2ss-CLIg-HL2 وpFUSEss-CHIg-HG1.
  2. هضم هذه النواقل مع الانزيمات تقييد المناسبة. استخدام ايكو RI وBSI WI لpFUSE2ss-CLIg-هونج كونج، ايكو RI و AVR الثاني للpFUSE2ss-CLIg-HL2، وايكو RI وNHE أنا لpFUSEss-CHIg-HG1. استخدام 3 وحدات لكل انزيم التقييد ل1 ميكروغرام من الحمض النووي للناقلات.
    1. الهضم مع إنزيم واحد وتنقية المنتج هضمها مع كيت تنقية PCR. الهضم مع الانزيم الثاني وتنقية مع مجموعة جل استخراج (وفقا لبروتوكول الشركة المصنعة). قطع جزء من الاهتمام من هلام agarose. تحضير هلام الاغاروز كما في الخطوة 8.5.
  3. هضم 2 الثانية PCR المنتجات من إنتاج مفتش استنساخ: ايكو RI وBSI WI لسلسلة كابا التضخيم، ايكو RI و AVR الثاني لسلسلة امدا التضخيم، وايكو RI وNHE أنا لسلسلة الثقيلة التضخيم. الهضم مع إنزيم واحد وتنقية المنتج هضمها مع PCR تنقية كيت. الهضم مع الانزيم الثاني وتنقية المنتج هضمها مع كيت تنقية PCR. استخدام نفس الوحدات من الانزيمات وكمية DNA كما في الخطوة 9.2.
  4. Ligate شظايا PCR داخل ناقلات مع توصيات T4 DNA يغاز 16 ° CO / N المصنعة التالية ل. نسبة المستخدمة يجب أن تكون 1: 2 (ناقلات: إدراج).
  5. استخدم 1 ميكرولتر من ربط لتحويل البكتيريا DH5α. اتبع شروط DH5α الشركة المصنعة للتحول. تنتشر البكتيريا في لوحات blasticidin أو zeocin، وهذا يتوقف على نوع من النواقل المستخدمة. احتضان لوحات O / N عند 37 درجة مئوية.
  6. تنمو المستعمرات واحد، واستخراج الحمض النووي مع مجموعة miniprep، بعد تعليمات الشركة الصانعة. استخدام للمستعمرة واحدة تنمو واستخراج الحمض النووي، توصيات الشركة الصانعة من عدة miniprep DNA. تحليلها عن طريق الهضم مع الانزيمات المستخدمة لإعداد موجهات وتدرج كما في الخطوات 9.2 و 9.3.
  7. تسلسل الحمض النووي، من خلال النقيبز 100 نانوغرام من ناقلات كما فعلت في الخطوات 8.8 و 8.9.

10. إنتاج الأجسام المضادة في الخلايا كلوة

  1. زراعة خلايا كلوة في Dulbecco لتعديل النسر المتوسطة (DMEM) تستكمل مع 10٪ مصل العجل الجنين، 1٪ L الجلوكوز، 1٪ البنسلين / ستربتافيدين (DMEM +) إلى confluency من 75٪ في 150 ملم لوحة ثقافة الخلية. أداء في غطاء الخطوات 10،1-10،7.
  2. قبل ترنسفكأيشن، تبادل المتوسطة والمتوسطة كما كان من قبل ولكن من دون مصل العجل الجنين.
  3. لكل الثقيلة، سلسلة ضوء ترنسفكأيشن، وإعداد مزيج ترنسفكأيشن مع 2.5 مل من DMEM (بدون المصل)، 9 ميكروغرام من ناقلات مع السلسلة الثقيلة، 6 ميكروغرام من ناقلات مع ضوء سلسلة، و 100 ميكرولتر من polyethylenimine (PEI ) الحل (من 1 ميكروغرام الأسهم / ميكرولتر). في احتضان RT لمدة 15 دقيقة.
  4. إضافة بلطف 2.5 مل من مزيج ترنسفكأيشن أعدت في الخطوة 10.3 لخلايا كلوة في اللوحة. موسيقى الروك لوحة لتوزيع متجانس.
  5. فيcubate الخلايا في الحاضنة عند 37 درجة مئوية مع CO 2 5٪ لمدة 24 ساعة.
  6. تغيير الثقافة المتوسطة والمتوسطة دون مصل العجل الجنين.
  7. جمع المتوسطة من لوحات في وقت لاحق 4 أيام.
    ملاحظة: الأجسام المضادة في وسائل الإعلام يمكن أن تستخدم لوصف التفاعل في التجارب المختبرية والحية.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

والنابضة الفرز بعد تلطيخ الخلايا إيجابية CD22 و IgG هو مبين في الشكل (1) في هذه الصورة مجال الخلايا إيجابية مزدوجة - يتم اختيار لفرز كل هذه الخلايا في أنبوب منفصل - خلايا B إنتاج الأجسام المضادة مفتش. في التحليل، ما يقرب من 1٪ من إجمالي PBMCs تتوافق مع هذه الفئة من السكان إيجابي مزدوج. فإن عدد الخلايا مرتبة الحصول عليها تعتمد على عدد الخلايا التي تم الحصول عليها في الباب 1.

وأظهرت نتائج مختلفة بعد 5 أسابيع من تخليد EBV والدليل السياسي الشامل (ODN2006) المحفزات في الشكل 2 الكشف عن استنساخ المتزايد من السهل؛ الخلايا المغذية Wi38 لها شكل الخلايا الليفية أكثر ممدود، واستنساخ الخلايا البائية تظهر خلايا جولة صغيرة جدا متزايد تتجمع في منتصف الجولة أسفل لوحة متعددة أيضا. في هذه المرحلة، فمن الواضح أن بعض الحيوانات المستنسخة تبدأ في النمو. ومع ذلك، يمكن للسرعة النمو تكون متغيرة، وبالطبع بعض contai الآبارخلد نينغ الخلايا قد لا يكون لها أي خلايا المتزايد على الإطلاق.

يتم اختبار طاف من الحيوانات المستنسخة المتزايد في ELISA لكشف مفتش كما هو مبين في الجدول رقم (2). وفي هذا ELISA يتم اختبار منحنى القياسية للمفتش، جنبا إلى جنب مع طاف من الحيوانات المستنسخة والفراغات. ويعتبر استنساخ إيجابي عندما تكون القيمة في ELISA هو 3 انحرافات معيارية عن القيمة فارغة. قيم استنساخ السلبية "تخضع ل3 الانحرافات المعيارية للفارغا. تأكيد، يجب أن تكون الحيوانات المستنسخة إيجابية إيجابي في ELISA ثلاث مرات على الأقل في supernatants مختلفة من نفس استنساخ وإذا كان ذلك ممكنا التحقق من طريقة فحص إضافي.

يظهر التسلسل الكامل من الأجسام المضادة مفتش البشري التي تم الحصول عليها تطبيق الخطوات المذكورة في هذه المخطوطة في الشكل (3). وقد تم الحصول على هذا التسلسل بعد استنساخ المناعي الزوج السلسلة الثقيلة وامدا من خلية B توسيع متطابق بسلالة. متغير لالثاني يمكن وصف المناطق مستمرة من السلسلة الثقيلة والخفيفة مع هذه التقنية. بعد الحصول على متواليات، والأجسام المضادة تسلسل يمكن استنساخ وأنتجت في المختبر في مزارع الخلايا كلوة.

الشكل 1
ويظهر الشكل 1. تحليل تدفق cytometric من CD22 + و IgG + الخلايا من الخلايا وحيدة النواة الدموية المحيطية الإنسان. (A) اختيار من سكان الخلايا الحية في P1. (B) إلى الأمام مؤامرة مبعثر. (C) حجم مؤامرة مبعثر. (D) محور Y يظهر خلايا مفصولة مكافحة CD22-PerCP وعلى محور X مفصولة مفتش-PE. يشير مربع P4 جزء الخلية التي تم فرزها (CD22 +، مفتش +) واستردادها للثقافة. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذه فايجوري.

الرقم 2
الشكل 2. صورة الممثل من الخلايا B تخليد الحيوانات المستنسخة في 96 جيدا لوحة بعد 5 أسابيع من الثقافة. (A) في هذه البئر لا تخليد لوحظ بعد 5 أسابيع، ولكن يمكن ملاحظة wi38 المشع الخلايا المغذية. (B) ولوحظ وجود استنساخ تنمو ببطء في هذه البئر، مع المجاميع جولة صغيرة في الوسط. (C) سريعة النمو استنساخ تظهر جولة مجاميع من الخلايا B خلد. يرجى النقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

الشكل (3)
الشكل 3. تسلسل الأجسام المضادة البشرية من الزوج الثقيلة والخفيفة سلسلة من منظور حقوق الإنسان خلد استنساخ الخلايا B، F50.2، مشيرا V CDR1، CDR2 وتسلسل CDR3. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

"> λ
1 ش PCR الاشعال
إلى الأمام (5'-3 ') عكس (3'-5 ')
مفتش 5 'L-VH 1 ACAGGTGCCCACTCCCAGGTGCAG 3 'Cγ CH1 GGAAGGTGTGCACGCCGCTGGTC
5 'L-VH 3 AAGGTGTCCAGTGTGARGTGCAG
5 'L-VH 4/6 CCCAGATGGGTCCTGTCCCAGGTGCAG
5 'L-VH 5 CAAGGAGTCTGTTCCGAGGTGCAG
κ 5 'L Vκ 1/2 ATGAGGSTCCCYGCTCAGCTGCTGG 3 'Cκ 543 GTTTCTCGTAGTCTGCTTTGCTCA
5 'L Vκ 3 CTCTTCCTCCTGCTACTCTGGCTCCCAG 3 'Cκ 494 GTGCTGTCCTTGCTGTCCTGCT
5 'L Vκ 4 ATTTCTCTGTTGCTCTGGATCTCTG
5 'بان Vκ ATGACCCAGWCTCCABYCWCCCTG
λ 5 'L Vλ 1 GGTCCTGGGCCCAGTCTGTGCTG 3 'Cλ CACCAGTGTGGCCTTGTTGGCTTG
5 'L Vλ 2 GGTCCTGGGCCCAGTCTGCCCTG
5 'L Vλ 3 GCTCTGTGACCTCCTATGAGCTG
5 'L Vλ 4/5 GGTCTCTCTCSCAGCYTGTGCTG
5 'L Vλ 6 GTTCTTGGGCCAATTTTATGCTG
5 'L Vλ 7 GGTCCAATTCYCAGGCTGTGGTG
5'L Vλ 8 GAGTGGATTCTCAGACTGTGGTG
2 الاشعال الثانية PCR
إلى الأمام (5'-3 ') عكس (3'-5 ')
IGH 5 'EcoRI VH1 CAACCGGAATTCGCAGGTGCAGCTGG
TGCAG
3 'NheI JH 1،2،4،5 CTGCTAGCTAGCTGAGGAGACGGT
GACCAG
5 'EcoRI VH1 إلى 5 CAACCGGAATTCAGAGGTGCAGCTG
GTGCAG
3 'NheI JH 3 CTGCTAGCTAGCTGAGAGACGGTGA
CCATTG
5 'EcoRI VH3 CAACCGGAATTCAGAGGTGCAGCTG
GTGGAG
3 'NheI JH 6 CTGCTAGCTAGCTGAGGAGACGGTG
ACCGTG
5 'EcoRI VH3 23 CAACCGGAATTCAGAGGTGCAGCT
GTTGGAG
5 'EcoRI VH4 CAACCGGAATTCACAGGTGCAGCT
GCAGGAG
5 'EcoRI VH 4 34 CAACCGGAATTCACAGGTGCAGCTAC
AGCAGTG
5 'EcoRI VH 1 18 CTTCCGGAATTCACAGGTTCAGCT
GGTGCAG
5 'EcoRI VH 1 24 CTTCCGGAATTCACAGGTCCAGCT
GGTACAG
5 'EcoRI VH3 33 CTTCCGGAATTCACAGGTGCAGCT
GGTGGAG
5 'EcoRIVH 3 9 GATCCGGAATTCAGAAGTGCAGCT
GGTGGAG
5 'EcoRI VH4 39 GATCCGGAATTCACAGCTGCAGCT
GCAGGAG
5 'EcoRI VH 6 1 GATCCGGAATTCACAGGTACAGCT
GCAGCAG
κ 5 'EcoRI Vκ 1 5 CAACCGGAATTCAGACATCCAGATGA
CCCAGTC
3 'BsiWI Jκ 1-4 GCCACCGTACGTTTGATYTCCACCTTGGTC
5 'EcoR1 Vκ 1 9 CTTCCGGAATTCAGACATCCAGTTGAC
CCAGTCT
3 'BsiWI Jκ 2 GCCACCGTACG TTTGATCTCCAG
CTTGGTC
5 'EcoR1 Vκ 1D 43 CTTGGCGAATTCAGCCATCCGGATGA
CCCAGTC
3 'BsiWI Jκ 3 GCCACCGTACGTTTGATATCCACT
TTGGTC
5 'EcoR1 Vκ 2 24 CTTCCGGAATTCAGATATTGTGATGA
CCCAGAC
5 'EcoR1 Vκ 2 28 CTTCCGGAATTCAGATATTGTGATG
ACTCAGTC
5 'EcoR1 Vκ 2 30 CTTCCGGAATTCAGATGTTGTGATGA
CTCAGTC
5 'EcoR1 Vκ 3 11 CTTCCGGAATTCAGAAATTGTGTTG
ACACAGTC
5 'EcoR1 Vκ 3 15 CTTCCGGAATTCAGAAATAGTGATG
ACGCAGTC
5 'EcoR1 Vκ 3 20 CTTCCGGAATTCAGAAATTGTGTTGA
CGCAGTCT
5 'EcoR1 Vκ 4 1 CTTCCGGAATTCAGACATCGTGATG
ACCCAGTC
5 'EcoR1 Vλ 1 CTTCCGGAATTCACAGTCTGTGCT
GACKCAG
3 'AvrII Jλ 1-3 CTGGTTACCTAGGAGGACGGTSACCT
TGGTCCC
5 'EcoR1 Vλ 2 CTTCCGGAATTCACAGTCTGCCC
TGACTCAG
3 'AvrII Jλ 4 CTGGTTACCTAGGAAAATGATCAGC
TGGGTTCC
5 'EcoR1 Vλ 3 CTTCCGGAATTCATCCTATGAGC
TGACWCAG
3 'AvrII Jλ 5 CTGGTTACCTAGGAGGACGGTCAGC
TCGGTCCC
5 'EcoR1 Vλ 4-5 CTTCCGGAATTCACAGCYTGTG
CTGACTCA
3 'AvrII Jλ 6 CTGGTTACCTAGGAGGACGGTCAGCT
GGGTGCC
5 'EcoR1 Vλ 6 CTTCCGGAATTCAAATTTTATGC
TGACTCAG
3 'AvrII Jλ 7 CTGGTTACCTAGGAGGACGGTCAC
TTGGTCCAT
5 'EcoR1 Vλ 7-8 CTTCCGGAATTCACAGRCTGTG
GTGACYCAG
"> الجدول 1. الاشعال المستخدمة.

EFT "> 0،080
1 2 3 4 5 6 7 8 9 10 11 12
A 0.076 0،077 2،003 0.080 0.138 0.102 0،188 0،338 0.040 2،041 0.051 0،081
B 2،011 0.085 0.074 0،069 0،081 0،122 0،372 2،133 0،119 0.097 0،072 0،072
C 0،068 0،179 0،091 0،073 0،077 0.097 0،606 1،882 0،081 2،071 0،094 0.075
د 0،063 0.070 0.065 0،071 0،082 2،071 0،339 2،089 0.076 0،086 0،066 0،069
E 1،921 0،077 0.065 0.085 0،095 1،968 1.910 0،122 0،072 0.070 0.065 0،066
F 0،113 0،068 0،066 0،082 0،088 0.090 0.460 0.070 0.079 0،952 0.098 0.065
G 2،041 2،108 1،472 0،665 0،331 0،194 0،123 0،094 0،072 0.070 0،072
H 2،146 2،132 1،634 0،665 0،341 0،178 0.132 0،094 0،082 0.080 0.074 0،068
معايير نانوغرام / ميكرولتر 1000 500 250 125 62.5 31.25 15.6 7.8 3.9 1.95 0.975 0

>

الجدول 2. نتائج ممثل مفتش فحص بواسطة ELISA. استنساخ supernatants هي في A1-A10، B1-B10، C1-C10، D1-D10، E1-E10، F1-F10. الفراغات هي في A11، B11، C11، D11، E11، F11، A12، B12، C12، D12، E12، تتكرر منحنى F12.Standard: G1-G12 وH1-H12. يظهر تركيز المقابلة من المناعية في كل مكررة ترد below.Positive أو مفتش استنساخ المنتجة في الرمادي الداكن. وتظهر الحيوانات المستنسخة إنتاج السلبية أو عدم مفتش في الرمادي الفاتح

Subscription Required. Please recommend JoVE to your librarian.

Discussion

في هذه المخطوطة، وتعرض كل الخطوات لتوليد الأجسام المضادة مفتش من PBMCs الإنسان في التفاصيل. ويشمل هذا البروتوكول بعض المزايا أكثر من التقنيات التي تم نشرها مسبقا. واحدة من المزايا هو أن الأجسام المضادة المنتجة يحافظ على السلاسل الثقيلة والخفيفة الموافق الزوج الأصلي في استنساخ الخلايا البائية. تحديد الأجسام المضادة مفتش يمكن القيام به في أي نوع من المانحين البشري، وليس هناك حاجة لتفاقم الاستجابة المناعية نتيجة لتطعيم 5. استخدام wi38 خط الخلية الليفية باعتبارها الخلية المغذية، يسمح للكشف أسرع من الحيوانات المستنسخة المتزايد، لأنها تختلف شكليا وسهل جدا للتمييز، مقارنة مع PBMCs تستخدم الخلايا المغذية في الأعمال التي سبق وصفها 1،6- 8. وعلاوة على ذلك استخدام wi38 باعتبارها الخلية المغذية تفضل تجميد مبالغ كبيرة من قسامات الخلية التي يمكن إذابة بسهولة ومثقف قبل كل تجربة.

واحدة من الحرجةخطوات كال في هذا البروتوكول هو مادة أولية: لPBMCs. إذا كان الدم كان ينتظر وقتا طويلا لالطرد المركزي، أو بعد استخراج PBMCs، لا يتم تخزينها في ظروف التجميد المناسبة؛ كما سيتم تخفيض هذا العدد من خلايا قابلة للحياة، جنبا إلى جنب مع عدد من مفتش خلية B إنتاج الحيوانات المستنسخة التي تم الحصول عليها. لهذا السبب، واستخراج مبكر والحفاظ جيدا على PBMCs ينصح لتحقيق نتيجة ناجحة. وسوف يكون عدد مفتش استنساخ إنتاج تقتصر على عدد من PBMCs في بداية التجربة. والأرقام أعلى من PBMCs تعطي أرقام أعلى من مفتش إنتاج الحيوانات المستنسخة وإنتاج الأجسام المضادة متنوعة. خطوة حاسمة أخرى هي استنساخ شظايا PCR من السلاسل الخفيفة والثقيلة من الأجسام المضادة. إذا كان الربط غير ناجح بعد عدة محاولات، لذا ينصح باستخدام أي خطوة إضافية من استنساخ 2 الثانية PCR المنتج في نظام TopoTA. هضم إدراج مع الانزيمات المناسبة يمكن أن يكون أسهلفي ناقلات TopoTA، لربط اللاحق في ناقلات التعبير pFUSEss.

يمكن نقل هذه التقنية إلى أي نوع من الأنسجة البشرية التي يتم إثراء خلايا B الإنسان 3. ويمكن أيضا أن تطبق على دراسة أنواع أخرى من المناعية، فقط عن طريق تغيير الأجسام المضادة المسمى استخدامها للفرز (الأجسام المضادة ضد الغلوبولين المناعي، فريق الخبراء الحكومي الدولي، ايغا أو الجمعية الإسلامية)، والتصميم التمهيدي لPCR، وناقلات معربا. يمكن للدراسات هذه المناعية تكون ذات فائدة لفهم، والاستجابات المناعية الأولية، إفراز الغشاء المخاطي الأجسام المضادة وملامح الحساسية وغيرها.

في الختام، التي وصفناها تقنية لإنتاج الأجسام المضادة مفتش المؤتلف وحيدة النسيلة الإنسان أن يترك سلاسل أزواج الثقيلة والخفيفة من الغلوبولين المناعي البشري سليمة. هذه التقنية مفيدة وسهلة لأداء بدءا من عينة الدم. الأجسام المضادة وحيدة النسيلة التي تم الحصول عليها من خلال هذه الطريقة يمكن أن تكون مفيدة في الدراسات حول المناعة البشريالردود. وعلاوة على ذلك، الاجسام المضادة تنتج مع هذا الأسلوب قد يكون نقطة انطلاق جيدة لتطوير العلاجات المناعية لظروف مرضية مختلفة.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

تعلن الكتاب أنه ليس لديهم المصالح المالية المتنافسة.

Acknowledgments

عقد البحوث ميغيل سيرفيت (ISCIII CD14 / 00032) إلى (GN-G). زمالة من المنظمة الهولندية للأبحاث "كلية الدراسات العليا في برنامج العلوم العصبية بالحركة" العلمية (022005019) إلى (CH).

المنح المقدمة من الأميرة بياتريس فون (مشروع WAR08-12) وجمعية الفرنسية مناهضة ليه الاعتلالات العضلية إلى (PM-M)؛ فضلا عن زمالة شفني من المنظمة الهولندية للبحوث العلمية (916.10.148) زمالة مؤسسة الدماغ هولندا (FS2008 (1) -28) والأميرة بياتريس فون (مشروع WAR08-12) (لML ).

نشكر Jozien اليشب لمساعدتها في B-خلية الترتيب بواسطة التدفق الخلوي.

Materials

Name Company Catalog Number Comments
Histopaque-1077  Sigma-Aldrich 10771 solution containing polysucrose and sodium diatrizoate
FACSAria II cell sorter  BD Biosciences 
96 U-bottom micro well plates  Costar 3799
Advanced Roswell Park Memorial Institute (RPMI) 1640 medium  Gibco, Life Technologies 12633-020
30% v/v EBV-containing supernatant of the B95-8 cell line   ATCC CRL-1612 3.4 x 108 copies/ml
CpG2006  Invivogen ODN 7909
Wi38 cells  Sigma-Aldrich 90020107
Interleukin-2 Roche  10799068001
ELISA plates Greiner Bio-One, Microlon 655092
AffiniPure F(ab')2 Fragment Goat Anti-Human IgG, Fcγ Fragment Specific (unconjugated) Jackson ImmunoResearch 109-006-008
4% non-fat dry milk (Blotting Grade Blocker)  Biorad 170-6404
Human IgG  Sigma I 2511 HUMAN IgG purified Immunoglobulin, 5.6 mg/ml
Goat F(ab)2 antihuman IgG Fcγ (conjugated with peroxidase (PO)) Jackson ImmunoResearch 109-036-008
ELISA reader (Perkin Elmer 2030)  Perkin Elmer  2030-0050
Peroxidase-conjugated AffiniPure Rabbit Anti-Human IgM, Fc5µ  Jackson ImmunoResearch 309-035-095
SuperScript III Cells Direct cDNA Synthesis System  Invitrogen  18080-200
Applied Biosystems (ABI) GeneAm PCR System 2700 Applied Biosystems
High Pure RNA Isolation Kit  Roche 11828665001
Reverse transcription system kit  Promega A3500
Recombinant Taq DNA Polymerase TAKARA R001A
Primers (2 μl) Sigma
Ultrapure Agarose  Invitrogen 16500-500
100 bp ladder Invitrogen 15628-019
Quantity One 4.5.2 (Gel Doc 2000) Biorad 170-8100
QIAquick PCR purification kit QIAGEN 28106
BigDye Terminator v3.1 cycle sequencing kit  Applied Biosystems 4337455
0.1 ml reaction plate (MicroAMP Optical 96-well) Applied Biosystems 4346906
Genetic analyser ABI300  Applied Biosystems 4346906
DH5α competent cells (E. coli) Invitrogen 18263-012
pFUSEss-CHIg-hG1 (4,493 bp) Invivogen pfusess-hchg1
pFUSEss-CHIg-hG4 (4,484 bp)  Invivogen pfusess-hchg4
pFUSE2ss-CLIg-hk (3,875 bp) Invivogen pfuse2ss-hclk
pFUSE2ss-CLIg-hl2 (3,883 bp)  Invivogen pfuse2ss-hcll2
SOC medium Invitrogen 15544-034
LB-based agar medium supplemented with Zeocin (Fast-Media Zeo Agar) Invivogen fas-zn-s
Terrific Broth (TB)-based liquid medium supplemented with Zeocin (Fast-Media Zeo TB) Invivogen fas-zn-l
DNA Miniprep kit  Omega Bio Technology D6942-02
Nanodrop (ND1000 Spectrophotometer) Nanodrop
LB-based agar medium supplemented with Blasticidin (Fast-Media Blast Agar) Invivogen fas-bl-s
Terrific Broth (TB)-based liquid medium supplemented with Blasticidin (Fast-Media Blast TB) Invivogen fas-bl-l
EcoRI New England Biolabs R0101S 20,000 U/ml, in 10x NEBuffer EcoRI
NheI New England Biolabs R0131S 10,000 U/ml, in 10x NEBuffer 2.1
2-Log DNA ladder New England Biolabs N3200S 0.1-10.0 kb, 1,000 μg/ml
XmaI New England Biolabs R0180S 10,000 U/ml, in 10x CutSmart Buffer 
BsiWI New England Biolabs R0553S 10,000 U/ml, in 10x NEBuffer 3.1
AvrII New England Biolabs R0174S 5,000 U/ml, in 10x CutSmart Buffer 
FastAP Thermosensitive Alkaline Phosphatase Thermo Scientific EF0651 1 U/µl, in 10x FastAP Buffer
DH5α competent cells  Invitrogen 18263-012
PE Mouse Anti-Human IgG BD Pharmingen 555787
anti-CD22, PerCP-Cy5.5, Clone: HIB22 Fisher scientific BDB563942
QIAprep Spin Miniprep Kit  QIAGEN 27106
BigDye Terminator v3.1 Applied Biosystems 4337455

DOWNLOAD MATERIALS LIST

References

  1. Vrolix, K., et al. Clonal heterogeneity of thymic B cells from early-onset myasthenia gravis patients with antibodies against the acetylcholine receptor. J Autoimmun. 52, 101-112 (2014).
  2. Yamashita, M., Katakura, Y., Shirahata, S. Recent advances in the generation of human monoclonal antibody. Cytotechnology. 55, (2-3), 55-60 (2007).
  3. Pereira, K. M., Dellavance, A., Andrade, L. E. The challenge of identification of autoantibodies specific to systemic autoimmune rheumatic diseases in high throughput operation: Proposal of reliable and feasible strategies. Clin Chim Acta. 437, 403-410 (2014).
  4. Losen, M., et al. Treatment of myasthenia gravis by preventing acetylcholine receptor modulation. Ann N Y Acad Sci. 1132, 174-179 (2008).
  5. Smith, K., et al. Rapid generation of fully human monoclonal antibodies specific to a vaccinating antigen. Nat Protoc. 4, (3), 372-384 (2009).
  6. Fraussen, J., et al. A novel method for making human monoclonal antibodies. J Autoimmun. 35, (2), 130-134 (2010).
  7. Traggiai, E., et al. An efficient method to make human monoclonal antibodies from memory B cells: potent neutralization of SARS coronavirus. Nat Med. 10, (8), 871-875 (2004).
  8. Fraussen, J., et al. Autoantigen induced clonal expansion in immortalized B cells from the peripheral blood of multiple sclerosis patients. J Neuroimmunol. 261, (1-2), 98-107 (2013).
  9. Yamashita, M., et al. Different individual immune responses elicited by in vitro immunization. Cytotechnology. 40, (1-3), 161-165 (2002).
  10. Hui-Yuen, J., Koganti, S., Bhaduri-McIntosh, S. Human B cell immortalization for monoclonal antibody production. Methods Mol Biol. 1131, 183-189 (2014).
  11. Tiller, T., et al. Efficient generation of monoclonal antibodies from single human B cells by single cell RT-PCR and expression vector cloning. J Immunol Methods. 329, (1-2), 112-124 (2008).
  12. Lanzavecchia, A., Corti, D., Sallusto, F. Human monoclonal antibodies by immortalization of memory B cells. Curr Opin Biotechnol. 18, (6), 523-528 (2007).
  13. Traggiai, E. Immortalization of human B cells: analysis of B cell repertoire and production of human monoclonal antibodies. Methods Mol Biol. 901, 161-170 (2012).
  14. Strober, W., et al. Monitoring cell growth. Curr Protoc Immunol / edited by. John E. Coligan ... [et al.]. Appendix 3, Appendix 3A (2001).
  15. Ibrahim, S. F., van den Engh, G. Flow cytometry and cell sorting. Adv Biochem Eng Biotechnol. 106, 19-39 (2007).
  16. Leith, J. T., Padfield, G., Faulkner, L. E., Quinn, P., Michelson, S. Effects of feeder cells on the X-ray sensitivity of human colon cancer cells. Radiother Oncol. 21, (1), 53-59 (1991).
  17. Hui-Yuen, J., McAllister, S., Koganti, S., Hill, E., Bhaduri-McIntosh, S. Establishment of Epstein-Barr virus growth-transformed lymphoblastoid cell lines. J Vis Exp. (57), 3321 (2011).
  18. Smith, L. M., et al. Fluorescence detection in automated DNA sequence analysis. Nature. 321, (6071), 674-679 (1986).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics