Erzeugung von rekombinanten humanen IgG monoklonalen Antikörpern aus Immortalisierte Sortiert B Cells

* These authors contributed equally
JoVE Journal
Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Nogales-Gadea, G., Saxena, A., Hoffmann, C., Hounjet, J., Coenen, D., Molenaar, P., Losen, M., Martinez-Martinez, P. Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells. J. Vis. Exp. (100), e52830, doi:10.3791/52830 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Das Ziel dieses Artikels ist, im Detail zu beschreiben eine Methode zur Erzeugung und Charakterisierung human IgG monoklonaler Antikörper aus humanen peripheren mononukleären Blutzellen (PBMCs) erhalten.

Das Interesse für die menschliche Antikörper zu untersuchen hat in vielen Bereichen der Forschung gewachsen. Insbesondere sind viele Forschungsgruppen Interesse in der Pathologie von Autoantikörpern verursacht 1-3. Wir kloniert und charakterisiert pathogene Autoantikörper 1. Die Studie von Autoantikörpern kann helfen, ihre Ziele zu identifizieren und therapeutische Strategien zu entwickeln, beispielsweise unter Verwendung von Antikörpern Wettbewerber 4. Außerdem kann die Untersuchung der menschlichen Antikörper auch von Interesse in anderen Forschungsgebieten, dh, um die Immunantwort nach der Impfung 5 zu bewerten, um die Antikörperprofil von Individuen, die belichtet und wurde resistent gegen bestimmte Krankheitserreger 6 bzw. zu untersuchen, wurden die kenn Antikörper sind indas natürliche Repertoire 7,12.

Verschiedene Techniken sind entwickelt worden, um rekombinante menschliche monoklonale Antikörper 8-12 zu erzeugen; die meisten von ihnen verwenden, Phagen-Display und B-Zell-Immortalisation. Die Verwendung von Phagen-Display wurde ausgiebig für die Entdeckung von neuen Antikörpern 13 angelegt. Es hat jedoch einen großen Nachteil, nämlich, daß die schweren und leichten Kettenpaaren des menschlichen Immunglobulins werden in dem Verfahren dissoziiert. Herstellung von Hybridomen mit menschlichen B-Zellen oder EBV-Transformation überwindet diesen Nachteil.

Wir verwenden Infektion von Thymus-B-Zellen mit EBV in Kombination mit polyklonalen B-Zell-Stimulation über Toll-like Rezeptor 9 (TLR-9) 6,12.

In diesem Papier beschreiben wir ausführlich die Technik, die wir für die Entwicklung von menschlichen Antikörpern IgG, mit einem kompletten Überblick über alle Schritte von PBMC Isolierung auf die In-vitro-Antikörpern. DieseProtokoll für die Analyse von jeder Form von menschlichem IgG-Profil verwendet werden. In unserem Labor, B-Zellen, die IgG-Antikörper wurden erfolgreich aus dem Rest der PBMCs nach der Sortierung getrennt. Fünfzig sortiert B-Zellen 8 kann dann in Multiwell-Platten plattiert und mit EBV immortalisiert und TLR-9-Aktivierung, die klonale Expansion von einzelnen B-Zellen sein. Als Feeder-Zellen, Fibroblasten aus menschlichen embryonalen Lungengewebe verwendet wurden, Zellinie WI38, die die Visualisierung der immortalisierten B-Zellen ermöglicht. Von diesen B-Zellen, können die Sequenzen der schweren und leichten Ketten des Immunglobulins durch PCR erhalten werden, und der Antikörper-Gene in Immunglobulin-G-Expressionsvektoren kloniert und in vitro produziert. Mit dieser Technik können einzelne Antikörper mit genau der gleichen Antikörpersequenz in dem Spender gefunden sucht werden.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Einwilligung wurde von den Teilnehmern der Studie erhalten. Die Studie wurde von der Ethikkommission genehmigt.

1. Isolierung von peripheren mononukleären Blutzellen (PBMCs)

  1. Zentrifuge 25 ml heparinisiertem Blut der Teilnehmer bei 900 · g für 15 Minuten, so bald wie möglich nach der Blutentnahme. Wenn es weniger Blut, verkleinern die Reagenzien entsprechend. Führen Sie alle weiteren Schritte in einer Haube.
  2. Das Serum in ein sauberes Röhrchen. Es kann in späteren Schritten zum Einfrieren PBMCs oder im Falle von Autoimmunpatienten verwendet werden, um Auto-Antikörper zu testen.
  3. Man verdünnt das Blut mit 10 ml RPMI 1640 Medien und Resuspendieren der Zellen, die durch Auf- und Abpipettieren.
  4. 15 ml einer Lösung, Polysaccharose und Natriumdiatrizoat (1,077 g / ml) in ein neues 50 ml Röhrchen.
  5. Gently Schicht das Blut auf der Oberseite der Lösung in Schritt 1.4, indem die beiden Öffnungen der Rohre nah togetsie, bis die beiden Flüssigkeiten kommen nur sehr langsam in Kontakt, und dann dekantiert die PBMC Suspension langsam auf dem 50-ml-Tube. Dieser Schritt ist wichtig, um eine gute Trennung der PBMCs aufweisen.
  6. Zentrifugieren Sie die in Schritt 1.5 bei 400 xg ohne Bremse bei RT für 20 min erhalten Rohr.
  7. Nach der Zentrifugation zu erholen mit der Pipette den weißen Ring, der im mittleren Teil des Rohres, der die PBMCs enthält erscheint.
  8. Mit 25 ml RPMI 1640-Medium, Waschen der Zellen.
  9. Zentrifugieren 300 xg bei Raumtemperatur für 10 min.
  10. Überstand verwerfen und waschen Sie die Zellen mit 10 ml RPMI 1640 Centrifuge wieder wie in Schritt 1.9.
  11. Zählen Sie die PBMCs mit einer Neubauer-Kammer 14, wie zuvor berichtet.
  12. Verarbeiten Sie die PBMCs, wie in Abschnitt 2 oder speichert sie für eine spätere Verwendung wie folgt: 10 Millionen PBMCs für das Einfrieren pro Kryoröhrchen Rohr in 1 ml 10% Dimethylsulfoxid (DMSO) und 90% Serum in Schritt 1.2 erhalten verdünnt. Frieren Sie schrittweise und für lange stoWut in flüssigem Stickstoff.

2. Die Färbung PBMCs für Sortierung CD22 + und IgG + von Cell Cytometry

  1. Plate Die PBMCs in eine 25 cm 2 Zellkulturflasche mit 6 ml vollständigem RPMI 1640-Medium (mit L-Glutamin, 10 mM HEPES-Puffer, 50 U / ml Penicillin, 50 ug / ml Streptomycin und 10% fötalem Rinderserum) und ließ sie erholen O / N im Brutschrank bei 37 ° C in 5% CO 2.
  2. Block sterile FACS-Röhrchen mit sterilem 4% Albumin phosphatgepufferter Kochsalzlösung (PBS) O / N. Die Röhrchen zweimal mit PBS waschen und füllen Sie sie mit 500 ul komplettem RPMI-1640-Medium. Verwenden Sie diese Rohre für die Wiederherstellung der Zellen nach dem Sortieren.
  3. Sammle die PBMCs in einem Rohr und Zentrifuge bei 400 × g bei Raumtemperatur für 5 min.
  4. Die Zellen in Markierungspuffer (siehe Schritte 2.5 und 2.6) und zählen sie 14. Der Markierungspuffer steril ist 2% fötalem Rinderserum und 1 mM Ethylendiamintetraessigsäure (EDTA) in PBS.
  5. Vorbereitung 3 Fluoreszenz-aktivierten Zellsortierung (FACS) Rohre mit 10 5 Zellen jeder resuspendieren sie in 100 ul Markierungspuffer. Diese Rohre werden für die Definition der Toren der Sortierung zu dienen.
    1. In der ersten Röhre hinzufügen 5 ul anti CD22 PerCP antibody (in Datenblatt des Herstellers empfohlen), in der zweiten Röhre 20 ul anti IgG PE (in Datenblatt des Herstellers empfohlen), und nichts in der dritten Röhre. Inkubieren auf Eis und in dunklen während 30 min.
  6. Resuspendieren 5 Millionen Zellen in 200 ul Markierungspuffer in einem FACS-Röhrchen und füge 10 ul anti CD22 PerCP und 40 ul Anti-IgG PE. Die Zellen auf Eis und dunklen inkubiere für 30 min. Wenn die Sortierung der eine höhere Anzahl von Zellen gewünscht ist, skalieren alle Reagenzien.
  7. Zentrifuge Zellen bei 400 · g mit einem niedrigen Brems für 5 min bei RT.
  8. Dekantieren Sie den Überstand leise.
  9. Die Zellen in 500 μl Markierungspuffer. Zentrifuge Zellen bei 400 · g mit einem niedrigen Brems für 5 min bei RT. Wiederholen Sie die Schritte 2.7 und 2.8
  10. Dekantieren Sie den Überstand und sanft resuspendieren Zellen in 300 ul RPMI Komplettmedium.
  11. Übergeben Sie die Zellen durch ein 0,45 um-Filter. Zellen sind bereit, zu sortieren.

3. Sortierung der B-Zellen CD22 + und IgG +

  1. Verwenden Sie 3 Kontrollröhrchen, um die Lebensfähigkeit der Zellen zu etablieren. In der Kontrolle ohne Färbung, verwenden Sie die nach vorne und Größe Streudiagramm, um die Lymphozyten-Gating definieren. Die Steuerung mit dem CD22 PerCP und Anti-IgG-PE dienen dazu, die Tore und die Weiche zu etablieren. Führen Sie folgende zuvor berichteten Daten 15.
    Hinweis: Ein Tor ist ein Satz von Wertgrenzen (Grenzen), die auf eine bestimmte Gruppe von cytometric Ereignisse zu isolieren, zu dienen, in unserem Fall Zellen, aus einer großen Reihe. In dem Fall einer Weiche die Wertgrenzen ermöglicht die Rückgewinnung der zytometrischen Ereignisse, Zellen, die im Inneren sinddie Grenzen definiert sind: CD22 + IgG +.
  2. Als ein Sammelrohr in der Sortier Verwenden der blockierten Röhrchen mit 500 ul vollständigem RPMI-1640-Medium aus Schritt 2.2 erhalten.
  3. Fahren Sie mit Doppel positive 15 Sortieren: CD22 + IgG +. Notieren Sie sich die endgültige Anzahl der Zellen in jedem Zustand. Platte sortierten Zellen auf der Oberseite der Futterzellen so schnell wie möglich.

4. Die Bestrahlung der Feeder-Zellen

Hinweis: Führen Sie die Vorbereitung der Feeder-Zellen zwischen 1 - 3 Tage vor dem Sortieren. Mindestens 5.000 WI38-Zellen pro Well in einer 96-Well-Platte Runde benötigt. Führen Sie die Schritte 4.1, 4.2 und 4.4 in einer Haube.

  1. Pflegen die WI38-Zellen bei 37 ° C und 5% CO 2 in vollständigem RPMI 1640-Medium (wie für PBMCs), bis die gewünschte Anzahl von Zellen erreicht werden.
  2. Bestrahlen sie bei 50 Grays, nach einer vor 16 beschriebenen Protokoll. Führen Sie, sobald die Bestrahlung WI38-Zellen wurden mit Trypsin behandelt und in c resuspendiertomplete RPMI-Medium oder mit WI38 zu der Kulturflasche angebracht und nach der Bestrahlung mit Trypsin behandelt. Folgen Sie dem Verfahren zur Trypsinierung vom Lieferanten WI38-Zellen angegeben. Bestrahlen die Anzahl von Zellen erforderlich, die Vertiefungen zum Plattieren IgG + B-Zellen (1% des Gesamt PBMC in Schritt 1.11 gezählt) benötigt abzudecken.
  3. Platte 90 ul, enthaltend 5.000 bestrahlt WI38-Zellen in jedem Well der 96-Well-Platte Runde. Lassen Sie die Vertiefungen in der Außenreihe der Platte leer (weil sie schneller verdunsten), und verwenden Sie nur die 60 Brunnen in der Mitte der Platte zum Beschichten Zellen. Füllen Sie die Außen Brunnen, die der Festlegung der Platte mit 200 ul PBS werden.
  4. Legen sie in einem Inkubator bei 37 ° C in 5% CO 2, bis sie benötigt.

5. Überzug Sortiert PBMCs, EBV-Infektion und Wachsen

  1. Verdünnen Sie die sortierten PBMCs, bis 50 Zellen in der 96 Runde Well-Platte (vorher vernickelt wit Platte in 50 ul RPMI 1640 Komplettmedium pro Vertiefungh WI38 bestrahlten Zellen). Führen Sie die Schritte in einer Haube für EBV Arbeit ausgestattet.
    Hinweis: die Infektion von 50 Zellen pro Vertiefung optimiert und erhöht die likehood, einen monoklonalen Antikörper zu produzieren 8 jedoch empfiehlt es sich, das durch PCR überprüft werden kann, bevor 1,6 beschrieben.
  2. In 60 ul EBV Überstand (3 enthält - 4 x 10 8 Viruskopien / ml) in jedes Loch in der 96 Runde Well-Platte 17. Vorsicht ist geboten bei EBV Arbeit genommen werden.
  3. 1 ug / ml CpG (ODN2006) pro Vertiefung.
  4. Lassen Sie die Zellen in einem Brutschrank bei 37 ° C in 5% CO 2.
  5. Visuell Monitor Klon wächst unter dem Mikroskop nach einer Woche.
    Anmerkung: Einige Beispiele von B-Zellwachstum kann unten im Abschnitt Ergebnisse gesehen werden. Beachten Sie, dass die Wachstumsraten der Klone kann variieren und zusätzliche Zeit erforderlich sein könnten, um zu sehen beginnen einige Zellmasse wächst in der Mitte des Brunnens.
  6. Nach der 1. 2 Wochens Monitor-Klon unter dem Lichtmikroskop wachsenden und fahren Sie mit dem ersten Medienaustausch. Langsam pipettiert 90 ul Medium aus dem oberen Teil des Bohrlochs und sammeln sich in einem sauberen 96-Lochplatte. (B-Zellen liegen im Boden der Vertiefung, so besteht keine Gefahr, sie zu saugen).
    1. In jeden Napf 100 ul vollständigem RPMI-1640-Medium mit 1 ug / ml CpG (ODN2006) und 50 U / ml IL2 ergänzt. Wenn Klone wachsen, analysieren diese ersten Medienaustausch durch ELISA wie in Schritt 6.
  7. Überwachen Klon wachsen und verändern Medien nach der 3. und der 4. Woche wieder wächst, indem 90 ul Medium und Zugabe von 100 & mgr; l von kompletten RPMI 1640 Medium mit 1 ug / ml von CpG (ODN2006) und 50 U / ml ergänzt IL2. Verwenden Sie den Überstand gesammelt, um die IgG-Produktion mittels ELISA wie in Schritt 6 zu überwachen.
    Hinweis: Nach einem Monat Klon wachsen sollte offensichtlich sein, durch die Beobachtung Aggregate von Rundzellen that liegen in der Regel in der Mitte des Rund gut.
  8. Bei diesem Schritt ändern Medien in der gleichen Weise, dass die vorangegangenen Wochen, sondern nur mit vollständigem RPMI-1640-Medium. Ein guter Indikator, zu wissen, der richtige Moment, um Medien zu ändern, ist das Medium Farbe, wenn es immer gelblich-Zellen benötigen ein Medienaustausch.
  9. Als 96-Lochplatten werden Big-Klone (ca. 5 x 10 5 Zellen) enthält, übertragen Sie sie auf eine flache Vertiefung einer 24-Well-Platte. Fügen Sie 300 ul kompletten RPMI 1640 Medien auf das neue gut. Resuspendieren 96 Vertiefungen wachsen Klon, durch Auf- und Abpipettieren mehrmals, und Transfer-Zellen auf das neue gut, Verteilung homogen. Fügen Sie neue Medien, wenn nötig.
    1. Wenn Wells der 24-Well-Platte voll von Zellen (ca. 5 x 10 6 Zellen), Transfer zu einer flachen Vertiefung einer 6-Well-Platte. 2 ml des vollständigen RPMI 1640-Medium, auf das neue gut. Die Zellen in der Platte mit 24 Vertiefungen durch Auf- und Abpipettieren mehrmals, und verteilen sie homogetig in der neuen gut.
  10. Artikel hinzufügen, wenn nötig. Wenn die Zellen nicht in Kultur gehalten werden, zu pelletieren Sie die Zellen bei 400 g für 5 min bei RT. Bewahren Sie die Überstände für ELISA-Tests. Waschen des Pellets von Zellen einmal mit 1 x PBS, erneut zentrifugieren bei 400 xg für 5 min und bei -80 ° C bis zur RNA-Extraktion bei trockener Lagerung.
    1. Wenn die Zellen in 6-Well-Platte konfluent werden (ungefähr 20 x 10 6 Zellen), Transfer auf eine 60 mm-Kulturplatte. 4 ml vollständigem RPMI 1640-Medium auf die neue Platte. Die Zellen in 6-Lochplatte und übertragen Sie so getan wird, ist die Schritte 5.9 und 5.10.
  11. Fügen Sie neue Medien, wenn nötig. Bei diesem Schritt, Gefriert Zellen bei 10 bis 30.000.000 / ml in 90% fötalem Kälberserum und 10% DMSO. Wenn größere Mengen an Zellen gesucht, weiterhin Expansion der Klone in größeren Oberflächenplatten.

6. ELISA für IgG Antikörpernachweis

  1. Geben Sie 50 ul / Vertiefung in einer ELISA-Platte of Ziegen-F (ab) 2-Anti-Human-Fc-Antikörper, verdünnt 1 200 in Beschichtungspuffer. Coating-Puffer enthält 50 mM Na 2 CO 3 pH 9,6.
  2. Verschließen Sie die Platten mit einem Kunststoffaufkleber, und Inkubation 1 h bei 37 ° C. Alternativ Inkubation bei 4 ° CO / N.
  3. Mit 200 ul Waschpuffer waschen Jede Vertiefung 6 mal. Waschpuffer enthält 0,05% Tween-20 in 1 × PBS. Berühren Sie nicht oder Kratzer auf der Oberfläche, wo auch der Antikörper gebunden hat.
  4. Block mit Blocking-Puffer, 100 ul / Vertiefung. Blockierungspuffer enthält 4% fettfreier Trockenmilch in PBS. Verschließen Sie die Platte und Inkubation 1 h bei 37 ° C.
  5. Nicht waschen. Entsorgen Blockierungspuffer und schlagen die Platte 3-mal auf den Kopf auf einem Papiertuch, um restliche Flüssigkeit zu entfernen.
  6. Inkubieren Klone Stände und Standards.
    1. Für einen ersten Test, verdünnte Klon Ständen in Schritt 5.6 oder 5.7 3.1 in RPMI erhalten. Für die Normen zu verdünnen mit RPMI-Medium Human-IgG-Lösung zu erhalten: 1.000 ng /ml, 500 ng / ml, 250 ng / ml, 125 ng / ml, 62,5 ng / ml, 31,25 ng / ml, 15,6 ng / ml und leer. Verwenden Sie 50 ul / Vertiefung und bei 37 ° C für 60 min. Analysieren weitere Verdünnungen des Klons "Überstand auf die Antikörperaffinität zu testen, wie beispielsweise 1/10 oder 1/100.
  7. Waschen wie unter Punkt 6.3 durchgeführt.
  8. Verwenden 50 ul / Vertiefung Ziegen-F (ab) 2-Anti-Human IgG Fc Peroxidase, verdünnt 1: 20.000 in Inkubationspuffer. Inkubationspuffer enthält 1% BSA und 0,02% Tween 20 in 1x PBS. Inkubieren bei 37 ° C für 60 min.
  9. Waschen wie unter Punkt 6.3 durchgeführt.
  10. Füge 100 ul / Vertiefung Substratlösung, die 0,1% 3,3 ', 5,5'-Tetramethylbenzidin (TMB). Inkubieren Sie 10 Minuten, bis eine stabile blaue Farbe Formen in die Vertiefungen geben. Achtung; warten Sie nicht zu lange!
  11. Stoppen Sie die Reaktion durch Zugabe von 50 & mgr; l 2 MH 2 SO 4. Messen Sie die Absorption bei 450 nm innerhalb von 30 min nach dem Stoppen der Reaktion.
    Hinweis: Alle Klone 'supernatants mit 3 Standardabweichungen über dem Rohling wird in Betracht gezogen werden für IgG menschliche Antikörper positiv. Zur Bestätigung der positiven Klone dieser ELISA sollte mindestens dreimal in verschiedenen Überstände des gleichen Klons wiederholt werden. Auch die Möglichkeit, unspezifische Kreuzreaktivität verwerfen wird empfohlen, um sicherzustellen, dass es kein Signal, wenn Überstände werden in unbeschichteten inkubiert aber blockiert Brunnen. In diesem Schritt wird ein Nachweistest zu Bildschirm für die antigene Spezifität der Antikörper von Interesse vor dem Kapitel 7 gehen durchgeführt werden.

7. RNA-Isolierung und First Strand cDNA Synthese der Producing IgG Clones

  1. Sobald die Produktion von IgG durch ELISA bestätigt, Extrahieren der RNA aus dem Klon.
  2. Zum Extrahieren von RNA aus Zellen, die in Schritten 5.7 oder 5.9, verwenden Sie die hochgestellte III Zellen direkten cDNA-Synthese-Kit, das ermöglicht den Erhalt von DNA aus 10.000 Zellen zu einer Zelle.
  3. Zum Extrahieren von RNA aus larger Mengen von Zellen oder aus dem Pellet in Schritt 5.11 gespeichert nutzen die hohe reine RNA Isolation Kit. Andere Systeme der RNA-Extraktion kann auch bei diesem Schritt geeignet sein. Folgen Sie den Anweisungen des Herstellers.
  4. Für Zellzahlen zwischen 1 x 10 6 und 1 x 10 4 Verwendung der reversen Transkription System, nach der Anweisung des Herstellers. Andere Systeme für die Erststrang-cDNA-Synthese kann auch verwendet werden.

8. 1 und 2. PCR zur ​​Amplifizierung der schweren und leichten Ketten des IgG-produzierende B-Zell-Klone

  1. Mit der cDNA der Zellklone, in der IgG-ELISA in Schritt 6 wird in Schritt 5.6 und 5.7 und positive erhalten, führen PCR mit den in Tabelle 1 angegebenen Primer.
  2. Unabhängige PCRs Set für jede IgG schwere, Kappa und Lambda-Kette. Machen Sie eine Stammlösung mit Vorwärts- und Rückwärtsprimer in gleichen Konzentrationen. Fügen Sie sie zu der Reaktion bei 0,4 & mgr; M Endkonzentration. </ Li>
  3. Verwenden Sie 1 ul der cDNA-Synthese auf der 1. PCR durchzuführen. Hier führen Sie 20 ul-Reaktionen unter Verwendung Takara Taq Herstellers. Alternativ können Sie auch andere Polymerasen.
  4. Platzieren Sie den 1. PCR unter folgenden Zyklusbedingungen: 94 ° C für 5 min; (50 Zyklen von 94 ° C für 30 sec, 58 ° C für 30 Sekunden und 72 ° C für 45 sec, 72 ° C für 7 min; lassen Sie es abkühlen auf 4 ° C.Include eine leere in der Reaktion, um mögliche Kontaminationen zu erkennen.
  5. Vorbereitung 1x TBE (89 mM Tris-Borat, 2 mM EDTA). In einem Volumen von 100 ml 1x TBE wird 1 g Agarose (1% Agarose-Gel). Die Lösung wird in der Mikrowelle für ca. 1 min, bis die Agarose aufgelöst wird. Dann fügen Sie 4 ul 10 mg / ml Ethidiumbromid (oder gleichwertig DNA-Farbstoff) und mischen.
    1. Gießen Sie den Inhalt in ein Fach und warten, bis wird polymerisiert. Führen Sie 5 ul der PCR-Mix in dem Gel, um die Bänder zu visualisieren. Fragment der schweren Kettes sollten rund 400 sein - 550 bp, während die leichte Kette sollte rund 300 sein - 400 bp. Wenn die Bänder nicht erkannt, gehen ebenfalls auf 2. PCR.
  6. Verwenden 1 ul des ersten PCR-Gemisches, um den 2. PCR durchzuführen. Verwenden Sie die gleichen Reagenzien, die in Schritt 8.2, sondern mit Hilfe der geeigneten Mischung von Primern (siehe Tabelle 1). Für die 2. PCR verwenden den folgenden Bedingungen: 94 ° C für 5 min; (50 Zyklen von: 94 ° C für 30 Sekunden; 56,5 ° C für 30 sec und 72 ° C für 55 sec); 72 ° C für 7 Minuten; abkühlen lassen bei 4 ° C. Fügen Sie eine leere in der Reaktion auf mögliche PCR Kontaminationen zu erkennen.
  7. Bereiten Sie ein Agarose-Gel, wie in 8.5 beschrieben. Führen Sie das Gel, um die PCR-Produkt zu visualisieren, wie in 8.5.1 Verwenden Sie die Verstärkungen, die die richtige Größe Fragmente für die Klonierung in Schritt 9 enthalten und produzieren Antikörper in Schritt 10.
  8. Sequenz der DNA, unter Verwendung von 10 ul Reaktionslösung, enthaltend 100 ng der 2. PCR, 0.2 & mgr; M der Primer oder Primer-Gemisches, 1 & mgr; l des Terminators und 1 ul des Puffers. Führen die Sequenzierungsreaktion unter diesen Bedingungen (25 Zyklen: 96 ° C für 10 sec; 50 ° C für 5 Sekunden und 60 ° C für 4 min); 60 ° C für 7 min; abkühlen lassen bei 4 ° C.
  9. Reinige den Sequenzierungsreaktionen mit Microspin G50 Säulen den Anweisungen des Herstellers. Auswertung der Sequenzen der Ligation in einer automatischen Sequenzanalysator wie zuvor beschrieben 18. Elektropherogramme sollte sauber sein und entsprechen einer einzelnen Immunglobulinsequenz.
    Hinweis: Wenn die PCR-Produkte zeigen, unklar oder Mischimmunglobulinsequenzen, beachten Sie bitte, sie zu klonen mit der TopoTA System, isolierte Sequenzen zu erhalten, und dann fahren Sie mit Schritt 9.

9. Klonierung und Sequenzierung der schweren und leichten Ketten des IgG produzierenden Klone

  1. Bereiten 1 ug DNA von Vektoren pFUSE2ss-CLIg-hk, pFUSE2ss-CLIg-HL2 und pFUSEss-Chig-HG1.
  2. Verdauen diese Vektoren mit den entsprechenden Restriktionsenzymen. Verwenden Eco RI und Bsi WI für pFUSE2ss-CLIg-hk, Eco RI und Avr II für pFUSE2ss-CLIg-HL2 und EcoRI und NheI für pFUSEss-Chig-HG1. Verwenden Sie 3 Einheiten jedes Restriktionsenzym für 1 ug DNA des Vektors.
    1. Digest mit einem Enzym und reinigen das verdaute Produkt mit einem PCR Purification Kit. Digest mit dem zweiten Enzym und Reinigen mit einem Gel Extraction Kit (nach dem Protokoll des Herstellers). Schneiden Sie das Fragment von Interesse aus dem Agarosegel. Vorbereitung Agarosegel, wie in Schritt 8.5.
  3. Verdauen die 2. PCR-Produkte der Herstellung von IgG Klon: Eco RI und Bsi WI für Kappa-Kette Verstärkung, Eco RI und Avr II für lambda-Kette Verstärkung und EcoRI und NheI für schwere Kette Verstärkung. Digest mit einem Enzym und reinigen das verdaute Produkt mit einem PCR Purification Kit. Digest mit dem zweiten Enzym und Reinigung der verdauten Produktes mit einem PCR Purification Kit. Verwenden Sie dieselben Einheiten von Enzymen und DNA-Menge wie in Schritt 9.2.
  4. Ligation der PCR-Fragmente innerhalb der Vektoren mit Empfehlungen T4 DNA-Ligase 16 ° CO / N folgenden Herstellers. Das verwendete sollte 1 Verhältnis: 2 (Vektor: Insert).
  5. Verwenden Sie 1 ul der Ligation an DH5a Bakterien zu transformieren. Folgen Sie DH5a Herstellerbedingungen der Transformation. Verteilt Bakterien in Blasticidin oder Zeocin Bleche je nach dem Typ des verwendeten Vektors abhängen. Die Platten O / N bei 37 ° C.
  6. Wachsen einzelne Kolonien, und extrahieren DNA mit einem Miniprep Kit nach Herstelleranweisungen. Verwenden Sie für die einzelnen Kolonie wachsen und DNA-Extraktion des Herstellers, Empfehlungen aus der DNA-Miniprep Kit. Analysieren durch Verdauung mit den zur Herstellung von Vektoren und Einsätze wie in den Schritten 9.2 und 9.3 verwendeten Enzyme.
  7. Sequenz der DNA, durch using 100 ng des Vektors wie in den Schritten 8.8 und 8.9 erfolgen.

10. Herstellung von Antikörpern in HEK-Zellen

  1. Wachsen HEK-Zellen in Dulbeccos modifiziertem Eagle Medium (DMEM) mit 10% fötalem Kälberserum, 1% L-Glucose, 1% Penicillin / Streptavidin (DMEM +) bis zu einer Konfluenz von 75% in einer 150 mm-Zellkulturplatte ergänzt. Führen Sie die Schritte in einer Haube von 10,1 bis 10,7.
  2. Vor der Transfektion austauschen Medium zu Medium wie zuvor, aber ohne fötales Kälberserum.
  3. Für jede schwere, leichte Kette-Transfektion, bereiten ein Transfektionsgemisch mit 2,5 ml DMEM (ohne Serum), 9 & mgr; g des Vektors mit der schweren Kette, 6 ug des Vektors mit der leichten Kette, und 100 ul Polyethylenimin (PEI ) Lösung (von 1 ug / ul Lager). Inkubieren bei Raumtemperatur für 15 min.
  4. Gently hinzufügen 2,5 ml der Transfektionsgemisch in Schritt 10.3 zu den HEK-Zellen in der Platte vorbereitet. Rock the Platte homogen zu verteilen.
  5. Incubate der Zellen in den Inkubator bei 37 ° C mit 5% CO 2 für 24 Std.
  6. Ändern Sie das Kulturmedium Medium ohne fötales Kälberserum.
  7. Sammeln des Mediums von den Platten 4 Tage später.
    Anmerkung: Die Antikörper in den Medien verwendet werden, um ihre Reaktivität in vitro und in vivo zu charakterisieren.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Die Sortierung Gating nach Färbung CD22 und IgG-positiven Zellen wird in Abbildung 1 gezeigt, in diesem Bild die Fläche der doppelt positiven Zellen. - B-Zellen, die IgG-Antikörper - ausgewählt ist, um all diese Zellen in ein separates Röhrchen sortieren. In der Analyse ca. 1% der Gesamt PBMCs entsprechen dieser doppelt positiven Bevölkerung. Die Anzahl der sortierten Zellen erhalten wird von der Anzahl von Zellen in Abschnitt 1 erhaltenen abhängen.

Die unterschiedlichen Ergebnisse nach 5 Wochen EBV Immortalisierung und CpG (ODN2006) Reize werden in Abbildung 2 dargestellt Die Detektion der wachsenden Klone ist einfach. WI38 Feederzellen haben eine längliche Form Fibroblasten, und die B-Zell-Klone werden als sehr kleine runde Zellen in der Mitte des Rund Multi-Well-Platte wachsen geclustert. In diesem Stadium ist es klar, daß einige Klone wachsen beginnen. Jedoch kann die Wachstumsgeschwindigkeit variabel sein und natürlich einige der Vertiefungen containing immortalisierten Zellen dürfen keine Zellen wachsen zu haben.

Der Überstand der wachsenden Klone in einem ELISA zum Nachweis von IgG, wie in Tabelle 2 gezeigt zusammen mit dem Überstand der Klone und der Rohlinge untersucht. In diesem ELISA wurde eine Standardkurve für IgG getestet. Ein positiver Klon wird berücksichtigt, wenn der Wert in dem ELISA 3 Standardabweichungen über dem Leerwert. Negative Klone "Werte sind unter den 3 Standardabweichungen des Rohlings. Zur Bestätigung sollte positiven Klonen im ELISA positiv mindestens dreimal in verschiedenen Überstände des gleichen Klons und, wenn möglich, durch einen weiteren Screening-Verfahren überprüft werden.

Die vollständige Sequenz eines menschlichen IgG-Antikörper erhalten Anwendung der in diesem Manuskript beschriebenen Schritte ist in Fig. 3 gezeigt ist Diese Sequenz nach Klonieren der schweren Immunglobulin-Kette und lambda-Paar aus einer klonal expandierten B-Zellen erhalten wurden. Variable and konstanten Regionen der schweren und leichten Kette können mit dieser Technik charakterisieren. Nach Erhalt der Sequenzen können Antikörper-Sequenzen kloniert und in vitro in HEK-Zellkulturen erzeugt werden.

Abbildung 1
Abbildung 1. Durchflusszytometrische Analyse der CD22 + und IgG + Zellen aus menschlichen peripheren einkernigen Blutzellen. (A) Auswahl der Bevölkerung von lebenden Zellen ist in P1 gezeigt. (B) nach vorne Streudiagramm. (C) Größe Streudiagramm. (D) Die Y-Achse zeigt Zellen durch Anti-CD22-PerCP und auf der von IgG-PE getrennt X-Achse getrennt sind. P4 Viereck zeigt die Zellfraktion, die sortiert wurde (CD22 + IgG +) und für Kultur gewonnen wird. Bitte klicken Sie hier, um eine größere Version dieses fi ansehenAbbildung.

Figur 2
Abbildung 2. Representative Bild von B-Zell-Klone, verewigt in einer 96-Well-Platte nach 5 Wochen der Kultur. Nach 5 Wochen wurde (A) In diesem auch ohne Immortalisierung beobachtet, aber WI38 bestrahlten Feeder-Zellen beobachtet werden. (B) eine langsam wachsende Klon wurde in dieser beobachtete auch, mit kleinen runden Zuschlagstoffen in der Mitte. (C) Schnell wachsende Klon zeigt runde Aggregate aus immortalisierten B-Zellen. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Figur 3
Abbildung 3. humane Antikörpersequenzen der schweren und leichten Kette Paar aus einem menschlichen immortalisierten B-Zell-Klon, F50,2, was anzeigt, V CDR1, CDR2 und CDR3-Sequenzen. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

"> Λ
1. PCR-Primer
Vorwärts (5'-3 ') Rückwärts (3'-5 ')
IgG 5 'L-VH 1 ACAGGTGCCCACTCCCAGGTGCAG 3 'C & ggr; CH1 GGAAGGTGTGCACGCCGCTGGTC
5 'L-VH 3 AAGGTGTCCAGTGTGARGTGCAG
5 'L-VH 4/6 CCCAGATGGGTCCTGTCCCAGGTGCAG
5 'L-VH 5 CAAGGAGTCTGTTCCGAGGTGCAG
κ 5 'L V & kgr; 1/2 ATGAGGSTCCCYGCTCAGCTGCTGG 3 'C & kgr; 543 GTTTCTCGTAGTCTGCTTTGCTCA
5 'L V & kgr; 3 CTCTTCCTCCTGCTACTCTGGCTCCCAG 3 'C & kgr; 494 GTGCTGTCCTTGCTGTCCTGCT
5 'L V & kgr; 4 ATTTCTCTGTTGCTCTGGATCTCTG
5 'Pan V & kgr; ATGACCCAGWCTCCABYCWCCCTG
λ 5 'L V & lgr; 1 GGTCCTGGGCCCAGTCTGTGCTG 3 'C & lgr; CACCAGTGTGGCCTTGTTGGCTTG
5 'L V & lgr; 2 GGTCCTGGGCCCAGTCTGCCCTG
5 'L V & lgr; 3 GCTCTGTGACCTCCTATGAGCTG
5 'L V & lgr; 4/5 GGTCTCTCTCSCAGCYTGTGCTG
5 'L V & lgr; 6 GTTCTTGGGCCAATTTTATGCTG
5 'L V & lgr; 7 GGTCCAATTCYCAGGCTGTGGTG
5'L V & lgr; 8 GAGTGGATTCTCAGACTGTGGTG
2. PCR-Primer
Vorwärts (5'-3 ') Rückwärts (3'-5 ')
IgH 5 'EcoRI VH1 CAACCGGAATTCGCAGGTGCAGCTGG
TGCAG
3 'NheI JH 1,2,4,5 CTGCTAGCTAGCTGAGGAGACGGT
GACCAG
5 'EcoRI VH1 bis 5 CAACCGGAATTCAGAGGTGCAGCTG
GTGCAG
3 'NheI JH 3 CTGCTAGCTAGCTGAGAGACGGTGA
CCATTG
5 'EcoRI VH3 CAACCGGAATTCAGAGGTGCAGCTG
GTGGAG
3 'NheI JH 6 CTGCTAGCTAGCTGAGGAGACGGTG
ACCGTG
5 'EcoRI VH3 23 CAACCGGAATTCAGAGGTGCAGCT
GTTGGAG
5 'EcoRI VH4 CAACCGGAATTCACAGGTGCAGCT
GCAGGAG
5 'EcoRI VH 4 34 CAACCGGAATTCACAGGTGCAGCTAC
AGCAGTG
5 'EcoRI VH 1 18 CTTCCGGAATTCACAGGTTCAGCT
GGTGCAG
5 'EcoRI VH 1 24 CTTCCGGAATTCACAGGTCCAGCT
GGTACAG
5 'EcoRI VH3 33 CTTCCGGAATTCACAGGTGCAGCT
GGTGGAG
5 'EcoRIVH 3 9 GATCCGGAATTCAGAAGTGCAGCT
GGTGGAG
5 'EcoRI VH4 39 GATCCGGAATTCACAGCTGCAGCT
GCAGGAG
5 'EcoRI VH 6 1 GATCCGGAATTCACAGGTACAGCT
GCAGCAG
κ 5 'EcoRI V & kgr; 1 5 CAACCGGAATTCAGACATCCAGATGA
CCCAGTC
3'-BsiWI Jκ 1-4 GCCACCGTACGTTTGATYTCCACCTTGGTC
5 'EcoR1 V & kgr; 1 9 CTTCCGGAATTCAGACATCCAGTTGAC
CCAGTCT
3 'BsiWI Jκ 2 GCCACCGTACG TTTGATCTCCAG
CTTGGTC
5 'EcoR1 V & kgr; 1D 43 CTTGGCGAATTCAGCCATCCGGATGA
CCCAGTC
3 'BsiWI Jκ 3 GCCACCGTACGTTTGATATCCACT
TTGGTC
5 'EcoR1 V & kgr; 2 24 CTTCCGGAATTCAGATATTGTGATGA
CCCAGAC
5 'EcoR1 V & kgr; 2 28 CTTCCGGAATTCAGATATTGTGATG
ACTCAGTC
5 'EcoR1 V & kgr; 2 30 CTTCCGGAATTCAGATGTTGTGATGA
CTCAGTC
5 'EcoR1 V & kgr; 3 11 CTTCCGGAATTCAGAAATTGTGTTG
ACACAGTC
5 'EcoR1 V & kgr; 3 15 CTTCCGGAATTCAGAAATAGTGATG
ACGCAGTC
5 'EcoR1 V & kgr; 3 20 CTTCCGGAATTCAGAAATTGTGTTGA
CGCAGTCT
5 'EcoR1 V & kgr; 4 1 CTTCCGGAATTCAGACATCGTGATG
ACCCAGTC
5 'EcoR1 V & lgr; 1 CTTCCGGAATTCACAGTCTGTGCT
GACKCAG
3'AvrII Jλ 1-3 CTGGTTACCTAGGAGGACGGTSACCT
TGGTCCC
5 'EcoR1 V & lgr; 2 CTTCCGGAATTCACAGTCTGCCC
TGACTCAG
3 'AvrII Jλ 4 CTGGTTACCTAGGAAAATGATCAGC
TGGGTTCC
5 'EcoR1 V & lgr; 3 CTTCCGGAATTCATCCTATGAGC
TGACWCAG
3 'AvrII Jλ 5 CTGGTTACCTAGGAGGACGGTCAGC
TCGGTCCC
5'EcoR1 V & lambda; 4-5 CTTCCGGAATTCACAGCYTGTG
CTGACTCA
3 'AvrII Jλ 6 CTGGTTACCTAGGAGGACGGTCAGCT
GGGTGCC
5 'EcoR1 V & lgr; 6 CTTCCGGAATTCAAATTTTATGC
TGACTCAG
3 'AvrII Jλ 7 CTGGTTACCTAGGAGGACGGTCAC
TTGGTCCAT
5'EcoR1 V & lambda; 7-8 CTTCCGGAATTCACAGRCTGTG
GTGACYCAG
"> Tabelle 1. Primer verwendet.

eft "> 0.080
1 2 3 4 5 6 7 8 9 10 11 12
EIN 0,076 0,077 2,003 0,080 0,138 0,102 0,188 0,338 0,040 2,041 0,051 0,081
B 2,011 0,085 0,074 0,069 0,081 0,122 0,372 2,133 0,119 0,097 0,072 0,072
C 0,068 0,179 0,091 0,073 0,077 0,097 0,606 1,882 0,081 2,071 0,094 0,075
D 0,063 0,070 0,065 0,071 0,082 2,071 0,339 2,089 0,076 0,086 0,066 0,069
E 1,921 0,077 0,065 0,085 0,095 1.968 1,910 0,122 0,072 0,070 0,065 0,066
F 0,113 0,068 0,066 0,082 0,088 0,090 0,460 0,070 0,079 0,952 0,098 0,065
G 2,041 2,108 1,472 0,665 0,331 0,194 0,123 0,094 0,072 0,070 0,072
H 2,146 2,132 1,634 0,665 0,341 0,178 0,132 0,094 0,082 0,080 0,074 0,068
Standards ng / & mgr; 1000 500 250 125 62,5 31,25 15,6 7.8 3.9 1.95 0,975 0

Tabelle 2. Repräsentative Ergebnisse der IgG-Screening mittels ELISA. Klon-Überstände werden in A1-A10, B1-B10, C1-C10, D1-D10, E1-E10, F1-F10. Rohlinge sind in A11, B11, C11, D11, E11, F11, A12, B12, C12, D12, E12, F12.Standard Kurve wird dupliziert: G1-G12 und H1-H12. Die entsprechende Konzentration von Immunglobulinen in jeder Dubletten gezeigt below.Positive oder IgG produzierende Klone werden in dunkelgrau dargestellt. Negative oder nicht-IgG produzierende Klone werden in hellgrau dargestellt

Subscription Required. Please recommend JoVE to your librarian.

Discussion

In diesem Manuskript, werden alle Schritte für die Erzeugung von IgG-Antikörpern aus humanen PBMCs im Einzelnen dargestellt. Dieses Protokoll umfasst einige Vorteile gegenüber zuvor veröffentlichten Verfahren. Einer der Vorteile ist, dass die produzierten Antikörpers behält die schweren und leichten Ketten der Vorlage entsprechende Paar in der B-Zell-Klon. Die Identifizierung von IgG-Antikörpern kann in jeder Art von menschlichen Spender durchgeführt werden und es besteht keine Notwendigkeit für Exazerbation der Immunantwort durch die Impfung 5. Die Verwendung des Fibroblastenzellinie WI38 als feeder-Zelle, ermöglicht eine schnelle Erkennung der wachsenden Klone, da sie morphologisch unterschiedliche und sehr leicht zu unterscheiden sind, im Vergleich zu den als Feederzellen verwendet, in den zuvor beschriebenen Arbeiten PBMCs 1,6- 8. Darüber hinaus ist die Verwendung von WI38 als Feeder-Zell begünstigt das Einfrieren von großen Mengen an Zellteilmengen, die leicht aufgetaut werden können und kultiviert vor jedem Experiment.

Einer der critchemischen Schritte in diesem Protokoll ist das Ausgangsmaterial: der PBMCs. Wenn das Blut zu lange gewartet für Zentrifugation oder nach der Extraktion der PBMCs, werden sie nicht in die entsprechenden Gefrierbedingungen gespeichert ist; Als solche ist die Anzahl von lebensfähigen Zellen reduziert wird, zusammen mit der Nummer des B-Zell-IgG produzierende Klone erhalten. Aus diesem Grund wird eine frühe Extraktion und eine gute Erhaltung der PBMCs sind für ein erfolgreiches Ergebnis empfohlen. Die Zahl der IgG-produzierende Klone werden auf die Anzahl von PBMCs zu Beginn des Versuchs begrenzt. Höhere Zahlen von PBMCs geben höhere Zahlen von IgG-produzierenden Klonen und einer vielfältigen Antikörperproduktion. Ein weiterer wichtiger Schritt ist die Klonierung der PCR-Fragmente der leichten und schweren Ketten des Antikörpers. Wenn die Ligation nicht erfolgreich ist, nachdem mehrere Versuche ist ein zusätzlicher Schritt der Klonierung der 2. PCR-Produkt in einer TopoTA System empfohlen. Die Verdauung des Einsatzes mit den geeigneten Enzymen kann leichterim TopoTA Vektor, für eine nachfolgende Ligation in den pFUSEss Expressionsvektoren.

Diese Technik kann auf jede Art von menschlichem Gewebe, in dem humanen B-Zellen angereichert sind 3 übertragen werden. Es kann auch auf die Untersuchung von anderen Arten von Immunglobulinen nur durch den Wechsel der markierten Antikörper für die Sortierung (Antikörper gegen IgM, IgE, IgA oder IgD), die Primer-Design für die PCR und die exprimierenden Vektoren angewandt wird. Die Untersuchungen dieser Immunglobuline können von Interesse, zu verstehen, anfängliche Immunreaktionen, Schleimhaut-Antikörper-Sekretion und Allergie-Profile, unter anderem sein.

Zusammenfassend haben wir eine Technik, um humane rekombinante monoklonale IgG-Antikörper, die die schweren und leichten Ketten Paare des menschlichen Immunglobulins intakten Blättern erzeugen beschrieben. Das Verfahren ist nützlich und leicht durchzuführen, ausgehend von einer Blutprobe. Die monoklonalen Antikörper durch dieses Verfahren erhalten werden, sind potentiell nützlich in Studien an menschlichen ImmunAntworten. Ferner könnte monoklonalen Antikörper mit diesem Verfahren hergestellten ein guter Ausgangspunkt für die Entwicklung von Immuno-Therapeutika für verschiedene pathologische Zustände sein.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren erklären, dass sie keine konkurrierenden finanziellen Interessen.

Acknowledgments

Forschungsvertrag Miguel Servet (ISCIII CD14 / 00032) bis (GN-G.). Stipendium der niederländischen Organisation für wissenschaftliche Forschung "Graduate School of Translational Neuroscience Program" (022005019) an (CH).

Zuschüsse aus dem Prinses Beatrix Fonds (Projekt WAR08-12) und der Association Française contre les Myopathien zu (PM-M.); sowie durch eine Veni Fellowship der Niederlande Organisation für wissenschaftliche Forschung (916.10.148) ein Stipendium des Gehirns Foundation der Niederlande (FS2008 (1) -28) und dem Prinses Beatrix Fonds (Projekt WAR08-12) (ML ).

Wir danken Jozien Jaspers für ihre Hilfe in der B-Zellsortierung mittels Durchflusszytometrie.

Materials

Name Company Catalog Number Comments
Histopaque-1077  Sigma-Aldrich 10771 solution containing polysucrose and sodium diatrizoate
FACSAria II cell sorter  BD Biosciences 
96 U-bottom micro well plates  Costar 3799
Advanced Roswell Park Memorial Institute (RPMI) 1640 medium  Gibco, Life Technologies 12633-020
30% v/v EBV-containing supernatant of the B95-8 cell line   ATCC CRL-1612 3.4 x 108 copies/ml
CpG2006  Invivogen ODN 7909
Wi38 cells  Sigma-Aldrich 90020107
Interleukin-2 Roche  10799068001
ELISA plates Greiner Bio-One, Microlon 655092
AffiniPure F(ab')2 Fragment Goat Anti-Human IgG, Fcγ Fragment Specific (unconjugated) Jackson ImmunoResearch 109-006-008
4% non-fat dry milk (Blotting Grade Blocker)  Biorad 170-6404
Human IgG  Sigma I 2511 HUMAN IgG purified Immunoglobulin, 5.6 mg/ml
Goat F(ab)2 antihuman IgG Fcγ (conjugated with peroxidase (PO)) Jackson ImmunoResearch 109-036-008
ELISA reader (Perkin Elmer 2030)  Perkin Elmer  2030-0050
Peroxidase-conjugated AffiniPure Rabbit Anti-Human IgM, Fc5µ  Jackson ImmunoResearch 309-035-095
SuperScript III Cells Direct cDNA Synthesis System  Invitrogen  18080-200
Applied Biosystems (ABI) GeneAm PCR System 2700 Applied Biosystems
High Pure RNA Isolation Kit  Roche 11828665001
Reverse transcription system kit  Promega A3500
Recombinant Taq DNA Polymerase TAKARA R001A
Primers (2 μl) Sigma
Ultrapure Agarose  Invitrogen 16500-500
100 bp ladder Invitrogen 15628-019
Quantity One 4.5.2 (Gel Doc 2000) Biorad 170-8100
QIAquick PCR purification kit QIAGEN 28106
BigDye Terminator v3.1 cycle sequencing kit  Applied Biosystems 4337455
0.1 ml reaction plate (MicroAMP Optical 96-well) Applied Biosystems 4346906
Genetic analyser ABI300  Applied Biosystems 4346906
DH5α competent cells (E. coli) Invitrogen 18263-012
pFUSEss-CHIg-hG1 (4,493 bp) Invivogen pfusess-hchg1
pFUSEss-CHIg-hG4 (4,484 bp)  Invivogen pfusess-hchg4
pFUSE2ss-CLIg-hk (3,875 bp) Invivogen pfuse2ss-hclk
pFUSE2ss-CLIg-hl2 (3,883 bp)  Invivogen pfuse2ss-hcll2
SOC medium Invitrogen 15544-034
LB-based agar medium supplemented with Zeocin (Fast-Media Zeo Agar) Invivogen fas-zn-s
Terrific Broth (TB)-based liquid medium supplemented with Zeocin (Fast-Media Zeo TB) Invivogen fas-zn-l
DNA Miniprep kit  Omega Bio Technology D6942-02
Nanodrop (ND1000 Spectrophotometer) Nanodrop
LB-based agar medium supplemented with Blasticidin (Fast-Media Blast Agar) Invivogen fas-bl-s
Terrific Broth (TB)-based liquid medium supplemented with Blasticidin (Fast-Media Blast TB) Invivogen fas-bl-l
EcoRI New England Biolabs R0101S 20,000 U/ml, in 10x NEBuffer EcoRI
NheI New England Biolabs R0131S 10,000 U/ml, in 10x NEBuffer 2.1
2-Log DNA ladder New England Biolabs N3200S 0.1-10.0 kb, 1,000 μg/ml
XmaI New England Biolabs R0180S 10,000 U/ml, in 10x CutSmart Buffer 
BsiWI New England Biolabs R0553S 10,000 U/ml, in 10x NEBuffer 3.1
AvrII New England Biolabs R0174S 5,000 U/ml, in 10x CutSmart Buffer 
FastAP Thermosensitive Alkaline Phosphatase Thermo Scientific EF0651 1 U/µl, in 10x FastAP Buffer
DH5α competent cells  Invitrogen 18263-012
PE Mouse Anti-Human IgG BD Pharmingen 555787
anti-CD22, PerCP-Cy5.5, Clone: HIB22 Fisher scientific BDB563942
QIAprep Spin Miniprep Kit  QIAGEN 27106
BigDye Terminator v3.1 Applied Biosystems 4337455

DOWNLOAD MATERIALS LIST

References

  1. Vrolix, K., et al. Clonal heterogeneity of thymic B cells from early-onset myasthenia gravis patients with antibodies against the acetylcholine receptor. J Autoimmun. 52, 101-112 (2014).
  2. Yamashita, M., Katakura, Y., Shirahata, S. Recent advances in the generation of human monoclonal antibody. Cytotechnology. 55, (2-3), 55-60 (2007).
  3. Pereira, K. M., Dellavance, A., Andrade, L. E. The challenge of identification of autoantibodies specific to systemic autoimmune rheumatic diseases in high throughput operation: Proposal of reliable and feasible strategies. Clin Chim Acta. 437, 403-410 (2014).
  4. Losen, M., et al. Treatment of myasthenia gravis by preventing acetylcholine receptor modulation. Ann N Y Acad Sci. 1132, 174-179 (2008).
  5. Smith, K., et al. Rapid generation of fully human monoclonal antibodies specific to a vaccinating antigen. Nat Protoc. 4, (3), 372-384 (2009).
  6. Fraussen, J., et al. A novel method for making human monoclonal antibodies. J Autoimmun. 35, (2), 130-134 (2010).
  7. Traggiai, E., et al. An efficient method to make human monoclonal antibodies from memory B cells: potent neutralization of SARS coronavirus. Nat Med. 10, (8), 871-875 (2004).
  8. Fraussen, J., et al. Autoantigen induced clonal expansion in immortalized B cells from the peripheral blood of multiple sclerosis patients. J Neuroimmunol. 261, (1-2), 98-107 (2013).
  9. Yamashita, M., et al. Different individual immune responses elicited by in vitro immunization. Cytotechnology. 40, (1-3), 161-165 (2002).
  10. Hui-Yuen, J., Koganti, S., Bhaduri-McIntosh, S. Human B cell immortalization for monoclonal antibody production. Methods Mol Biol. 1131, 183-189 (2014).
  11. Tiller, T., et al. Efficient generation of monoclonal antibodies from single human B cells by single cell RT-PCR and expression vector cloning. J Immunol Methods. 329, (1-2), 112-124 (2008).
  12. Lanzavecchia, A., Corti, D., Sallusto, F. Human monoclonal antibodies by immortalization of memory B cells. Curr Opin Biotechnol. 18, (6), 523-528 (2007).
  13. Traggiai, E. Immortalization of human B cells: analysis of B cell repertoire and production of human monoclonal antibodies. Methods Mol Biol. 901, 161-170 (2012).
  14. Strober, W., et al. Monitoring cell growth. Curr Protoc Immunol / edited by. John E. Coligan ... [et al.]. Appendix 3, Appendix 3A (2001).
  15. Ibrahim, S. F., van den Engh, G. Flow cytometry and cell sorting. Adv Biochem Eng Biotechnol. 106, 19-39 (2007).
  16. Leith, J. T., Padfield, G., Faulkner, L. E., Quinn, P., Michelson, S. Effects of feeder cells on the X-ray sensitivity of human colon cancer cells. Radiother Oncol. 21, (1), 53-59 (1991).
  17. Hui-Yuen, J., McAllister, S., Koganti, S., Hill, E., Bhaduri-McIntosh, S. Establishment of Epstein-Barr virus growth-transformed lymphoblastoid cell lines. J Vis Exp. (57), 3321 (2011).
  18. Smith, L. M., et al. Fluorescence detection in automated DNA sequence analysis. Nature. 321, (6071), 674-679 (1986).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics