Fremstilling af rekombinant humant IgG monoklonale antistoffer fra Immortaliserede Sorteret B-celler

* These authors contributed equally
JoVE Journal
Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Nogales-Gadea, G., Saxena, A., Hoffmann, C., Hounjet, J., Coenen, D., Molenaar, P., Losen, M., Martinez-Martinez, P. Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells. J. Vis. Exp. (100), e52830, doi:10.3791/52830 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Målet med denne artikel er at beskrive i detaljer en metode til at generere og karakterisere humane IgG monoklonale antistoffer opnået fra humane perifere mononukleære celler (PBMC'er).

Interessen for at studere humane antistoffer er vokset i mange forskellige forskningsområder. Især mange forskergrupper er interesseret i patologi forårsaget af auto-antistoffer 1-3. Vi har klonet og karakteriseret patogene autoantistoffer 1. Studiet af auto-antistoffer kan hjælpe med at identificere deres mål og udvikle terapeutiske strategier, fx ved hjælp af konkurrerende antistoffer 4. Desuden kan studiet af humane antistoffer også være af interesse i andre forskningsområder, dvs., at evaluere immunresponset efter vaccination 5, at karakterisere antistofprofil af individer, der blev udsat og blev resistente over for specifikke patogener 6 eller at undersøge, hvilke antistoffer er iden naturlige repertoire 7,12.

Adskillige teknikker er blevet udviklet til at generere rekombinante humane monoklonale antistoffer 8-12; de fleste af disse anvender fag-display og B-celle-immortalisering. Anvendelsen af fag-display er blevet grundigt anvendt for opdagelsen af nye antistoffer 13. Det har imidlertid en stor ulempe, nemlig at de tunge og lette kæde par af det humane immunoglobulin blive dissocieret i processen. Produktion af hybridomer med humane B-celler eller EBV transformation overvinder denne ulempe.

Vi bruger infektion af thymiske B celler med EBV i kombination med polyklonal B-celle-stimulering via Toll-like receptor 9 (TLR-9) 6,12.

I dette papir, vi beskriver i detaljer den teknologi, som vi bruger til udvikling af IgG humane antistoffer, med en komplet oversigt over alle de trin fra PBMC isolation til in vitro-antistof generation. Detteprotokol kan anvendes til analyse af enhver type human IgG profil. I vores laboratorium har B-celler, der producerer IgG-antistoffer med held blevet adskilt fra resten af ​​PBMC'er efter sortering. Halvtreds Weaver B-celler 8 kan derefter udplades i multi-brønds plader og udødeliggjort af EBV og TLR-9-aktivering, for klonal ekspansion af enkelte B-celler. Som fødeceller, har fibroblaster fra human embryonisk lungevæv blevet anvendt, cellelinje WI38, hvilket letter visualiseringen af ​​de immortaliserede B-celler. Fra disse B-celler, kan sekvenserne af de tunge og lette kæder af immunoglobulin opnås ved PCR, og de ​​antistoffer «gener klonet i immunoglobulin G ekspressionsvektorer og produceret in vitro. Med denne teknik kan enkelte antistoffer med nøjagtig det samme antistof sekvens fundet i donor undersøges.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Informeret samtykke blev opnået fra deltagerne i undersøgelsen. Undersøgelsen blev godkendt af institutionelle etiske komité.

1. Isolering af perifere mononukleære blodceller (PBMC'er)

  1. Centrifuge 25 ml af deltagernes hepariniseret blod ved 900 xg i 15 min, så hurtigt som muligt efter, at blodet ekstraktion. Hvis der er mindre blod, skalere ned reagenserne i overensstemmelse hermed. Udfør alle de næste skridt i en hætte.
  2. Overfør serummet til et rent rør. Det kan bruges i senere trin til frysning PBMC'er eller i tilfælde af autoimmune patienter, for at teste auto-antistoffer.
  3. Fortynd blodet med 10 ml RPMI 1640-medier og cellerne resuspenderes ved pipettering op og ned.
  4. Der tilsættes 15 ml af en opløsning indeholdende polysucrose og natrium diatrizoat (1,077 g / ml) til en ny 50 ml rør.
  5. Forsigtigt lag blodet på toppen af ​​opløsningen i trin 1.4 ved at bringe de to åbninger af rør tæt togethende, indtil de to væsker kommer meget langsomt i kontakt, og derefter dekanteres PBMC suspension langsomt oven på 50 ml rør. Dette trin er vigtigt at have en god separation af PBMC'er.
  6. Centrifugeres røret opnået i trin 1.5 ved 400 xg uden bremse ved stuetemperatur i 20 min.
  7. Efter centrifugering komme med pipette den hvide ring, der vises i den midterste del af røret, som indeholder PBMC'er.
  8. Vask cellerne med 25 ml RPMI 1640-medier.
  9. Centrifuger 300 xg ved stuetemperatur i 10 min.
  10. Supernatanten fjernes, og cellerne vaskes med 10 ml RPMI 1640. Centrifuge igen som i trin 1.9.
  11. Tæl PBMC'er med Neubauer kammer som tidligere rapporteret 14.
  12. Behandle PBMC'er som i afsnit 2 eller gemme dem til senere brug som følger: 10 millioner PBMC'er til frysning pr kryoglas rør fortyndet i 1 ml 10% dimethylsulfoxid (DMSO) og 90% serum opnået i trin 1.2. Frys progressivt og for lange stovrede i flydende nitrogen.

2. Farvning PBMC'er til sortering CD22 + og IgG + af Cell Cytometry

  1. Plate PBMC'erne i en 25 cm2 cellekultur kolbe med 6 ml komplet RPMI 1640-medium (suppleret med L-glutamin, 10 mM HEPES-buffer, 50 U / ml penicillin, 50 ug / ml streptomycin og 10% føtalt bovint serum) og lad dem genvinde O / N i inkubatoren ved 37 ° C ved 5% CO2.
  2. Blokere sterile FACS rør med steril 4% albumin phosphatbufret saltvand (PBS) opløsning O / N. Vask rørene to gange med PBS og fylde dem med 500 pi komplet RPMI 1640 medium. Brug disse rør til udvinding af cellerne efter sortering.
  3. Indsamle PBMC'er i et rør og centrifugeres ved 400 xg ved stuetemperatur i 5 min.
  4. Resuspender cellerne i mærkning buffer (se trin 2.5 og 2.6), og tælle dem 14. Mærkningen puffer er sterilt 2% føtalt bovint serum og 1 mM ethylendiamintetraeddikesyre (EDTA) i PBS.
  5. Forbered 3 fluorescens-aktiveret cellesortering (FACS) rør med 10 5 celler hver og resuspender dem i 100 pi mærkning puffer. Disse rør vil tjene til at definere porte sorteringen.
    1. I det første rør tilsættes 5 pi anti CD22 PerCP antistof (anbefalet i fabrikantens datablad), i det andet rør 20 pi anti-IgG PE (anbefalet i fabrikantens datablad), og intet i det tredje rør. Inkuber på is og i mørke i løbet af 30 minutter.
  6. Resuspender 5 millioner celler i 200 pi mærkning buffer i en FACS rør og tilføje 10 pi anti CD22 PerCP og 40 pi anti IgG PE. Inkubere cellerne på is og mørke i løbet af 30 minutter. Hvis der ønskes sorteringen af ​​et højere antal celler, opskalere alle reagenserne.
  7. Centrifuger cellerne ved 400 xg med en lav bremse i 5 minutter ved stuetemperatur.
  8. Dekanteres sagte supernatanten.
  9. Cellerne resuspenderes i 500 μl mærkning puffer. Centrifuger cellerne ved 400 xg med en lav bremse i 5 minutter ved stuetemperatur. Gentag trin 2.7 og 2.8
  10. Dekantere sagte supernatanten og resuspender cellerne i 300 pi RPMI komplette medier.
  11. Passere cellerne gennem et 0,45 um filter. Celler er klar til at sortere.

3. Sortering af B-celler CD22 + og IgG +

  1. Bruge 3 kontrolrør at fastslå levedygtigheden af ​​cellerne. I kontrol uden farvning, skal du bruge frem og størrelse scatter plot til at definere lymfocyt gating. Kontrollerne med CD22 PerCP og anti-IgG PE tjener til at fastsætte de porte, og sortering gate. Udfør følgende tidligere indberettede data 15.
    Bemærk: En port er et sæt grænseværdier (afgrænsning), der tjener til at isolere en bestemt gruppe af cytometriske begivenheder, i vores tilfælde celler fra et stort sæt. I tilfælde af en sortering gate værdigrænserne tillader genvinding af cytometriske begivenheder, celler, der er inde igrænserne definerede: CD22 + og IgG +.
  2. Som en samling rør i sortering, skal du bruge blokerede rør med 500 pi komplet RPMI 1640 medium, opnået fra trin 2.2.
  3. Fortsæt til sortere dobbelt positiv 15: CD22 + IgG +. Bemærk det endelige antal af celler i hver betingelse. Plade sorteret celler oven på fødeceller så hurtigt som muligt.

4. Bestråling af fødeceller

Bemærk: Udfør forberedelsen af ​​feeder celler mellem 1 - 3 dage før sorteringen. Der er behov for mindst 5.000 WI38 brønd i en 96 rund brønd plade. Udfør trin 4.1, 4.2 og 4.4 i en hætte.

  1. Dyrke WI38 celler ved 37 ° C og 5% CO2 i komplet RPMI 1640 medium (samme som for PBMC'er), indtil der er nået den ønskede antal celle.
  2. Bestråle dem på 50 Grays, efter en protokol beskrevet inden den 16.. Udføre bestråling når WI38 celler er blevet trypsiniseret og resuspenderet i complete RPMI-medium, eller med WI38 knyttet til kulturen kolben og trypsiniseret efter bestrålingen. Følge den metode til trypsinisering angivet af leverandøren af ​​WI38 celler. Bestråle antallet af celler, der er nødvendige til at dække brøndene nødvendige for plettering IgG + B-celler (1% af den samlede PBMC tælles i trin 1.11).
  3. Plade 90 pi indeholdende 5.000 bestrålede WI38 celler i hver brønd af 96 runde brønde. Efterlad brøndene i den udvendige række af pladen tom (fordi de fordamper hurtigere), og kun bruge de 60 brønde i midten af ​​pladen for udpladning celler. Fyld de ydre brønde, der indrammer pladen med 200 pi PBS.
  4. Placere dem i en inkubator ved 37 ° C ved 5% CO2, indtil brug.

5. Plating Sorteret PBMC'er, EBV infektion og voksende

  1. Fortynd de sorterede PBMC'er, til plade 50 celler i 50 pi RPMI 1640 komplet medium per brønd i 96 brønd rund plade (tidligere belagt with WI38 bestrålede celler). Udfør trin i en hætte udstyret til EBV arbejde.
    Bemærk: infektion af 50 celler per brønd er optimeret og øger likehood at producere et monoklonalt antistof 8, dog anbefales det at kontrollere dette ved PCR som beskrevet før 1,6.
  2. Tilføje 60 pi EBV supernatant (indeholdende 3 - 4 i x 10 8 virale kopier / ml) til hver brønd i 96 brønd rund plade 17. Der bør udvises forsigtighed ved EBV arbejde.
  3. Tilsæt 1 pg / ml CpG (ODN2006) pr.
  4. Lad cellerne i en inkubator ved 37 ° C ved 5% CO2.
  5. Visuelt monitor klon dyrkning under mikroskopet efter en uge.
    Bemærk: Nogle eksempler på B-celle vækst kan ses nedenfor i resultatafsnittet. Bemærk, at satserne for klonerne vækst kan variere, og kan være nødvendigt ekstra tid til at begynde at se nogle cellemasse vokser i midten af ​​brønden.
  6. Efter den 1. to ugers monitor klon dyrkning under lysmikroskop og gå videre til det første medie udveksling. Langsomt pipette 90 pi medium fra den øverste del af brønden og samles i en ren plade med 96 brønde. (B-celler ligger i bunden af ​​brønden, så der er ingen risiko for at aspirere dem).
    1. Tilsættes til hver brønd 100 pi komplet RPMI 1640 medium suppleret med 1 ug / ml CpG (ODN2006) og 50 U / ml IL2. Hvis kloner vokser, analysere denne første medie udveksling af ELISA som i trin 6.
  7. Overvåg klon vokser og ændre medier efter 3. og den 4. uge vokse igen ved at tage 90 pi medier og tilsætning af 100 pi komplet RPMI 1640 medium suppleret med 1 ug / ml CpG (ODN2006) og 50 U / ml IL2. Bruge den opsamlede supernatant at overvåge IgG-produktion ved ELISA som i trin 6.
    Bemærk: Efter en måned klon vokser burde være indlysende ved at observere aggregater af runde celler that normalt ligge i midten af ​​den runde bund godt.
  8. I dette trin ændrer medier på samme måde, som de tidligere uger, men kun med komplet RPMI 1640-medier. En god indikator for at kende det rigtige tidspunkt at skifte medier er medierne farve, hvis den bliver gullig celler har brug for et medie udveksling.
  9. Når 96-brønds plader indeholdende store kloner (ca. 5 x 10 5 celler), overføre dem til en flad brønd i en plade med 24 brønde. Der tilsættes 300 pi komplet RPMI 1640-medier til det nye brønd. Resuspender 96 brønde voksende klon, ved pipettering op og ned flere gange, og overfør celler til den nye brønd, distribuere homogent. Tilføj nye medier efter behov.
    1. Når brønde i 24-brønds plade er fulde af celler (ca. 5 x 10 6 celler), overførsel til en flad brønd i en 6-brønds plade. Tilsæt 2 ml komplet RPMI 1640-medier til det nye brønd. Resuspender cellerne i 24-brønds plade ved at pipettere op og ned flere gange, og distribuere dem homogedigt i den nye brønd.
  10. Tilføj medier, når det er nødvendigt. Hvis celler ikke skal opretholdes i kultur, pelletere cellerne ved 400 x g i 5 minutter ved stuetemperatur. Opbevar supernatanter til ELISA test. Vask pellet af celler en gang med 1 x PBS, centrifugeres igen ved 400 x g i 5 minutter og opbevaret tørt ved -80 ° C indtil RNA-ekstraktion.
    1. Når cellerne i 6-brønds plade bliver konfluente (ca. 20 x 10 6 celler) og overføres til en 60 mm dyrkningsplade. Tilsæt 4 ml komplet RPMI 1640-medier til den nye plade. Udeluk cellerne i 6-brønds plade og overføre dem som gjort, er trin 5.9 og 5.10.
  11. Tilføj nye medier efter behov. I dette trin fryse cellerne ved 10 til 30.000.000 / ml i 90% føtalt kalveserum og 10% DMSO. Hvis ønskes større mængder af celler, fortsat ekspansion af klonerne i større overfladeplader.

6. ELISA for IgG antistof Detection

  1. Dispensere 50 pl / brønd i en ELISA-plade of ged F (ab) 2 anti-humant Fc-antistof fortyndet 1 200 i coating-buffer. Coating buffer indeholder 50 mM Na 2 CO 3 pH 9,6.
  2. Forsegl pladerne med en plastik mærkat, og inkuber 1 time ved 37 ° C. Alternativt inkuberes ved 4 ° CO / N.
  3. Vask hver brønd 6 gange med 200 pi vaskebuffer. Vaskebuffer indeholder 0,05% Tween-20 i 1 x PBS. Rør ikke ved, eller ridse godt overflade, hvor antistoffet har bundet.
  4. Blok med blokerende buffer, 100 pl / brønd. Blokerende buffer indeholder 4% ikke-fedtholdig tørmælk i PBS. Forsegle pladen og inkuber 1 time ved 37 ° C.
  5. Kan ikke vaskes. Kassér blokerende buffer, og smække pladen 3 gange op og ned på et stykke køkkenrulle for at fjerne resterende væske.
  6. Inkuber kloner 'supernatanter og standarder.
    1. For en første test, fortyndes klon supernatanter opnået i trin 5.6 eller 5.7 1/3 i RPMI. For standarderne fortyndes med RPMI medium human IgG-opløsning for at få: 1,000 ng /ml, 500 ng / ml, 250 ng / ml, 125 ng / ml, 62,5 ng / ml, 31,25 ng / ml, 15,6 ng / ml og blank. Bruge 50 pl / brønd og inkuberes ved 37 ° C i 60 minutter. Analyser yderligere fortyndinger af klonen 'supernatanten for at teste antistoffet affinitet, såsom 1/10 eller 1/100.
  7. Vask som udført i trin 6.3.
  8. Bruge 50 pl / brønd af ged F (ab) 2 anti-humant IgG-Fc peroxidasekonjugeret fortyndet 1: 20.000 i inkubationsbuffer. Inkubationspuffer indeholder 1% BSA og 0,02% Tween 20 i 1 x PBS. Der inkuberes ved 37 ° C i 60 minutter.
  9. Vask som udført i trin 6.3.
  10. Tilsættes 100 ul / brønd substratopløsning indeholdende 0,1% 3,3 ', 5,5'-tetramethylbenzidin (TMB). Inkuber 10 min, indtil en stabil blå farve former i brøndene. Vær forsigtig; vent ikke for længe!
  11. Reaktionen standses ved tilsætning af 50 pi 2 MH 2 SO 4. Måle absorptionen ved 450 nm, inden for 30 min efter standsning af reaktionen.
    Bemærk: Alle klonerne 'supernatants med 3 standardafvigelser over emnet vil blive betragtet som positive for IgG humane antistoffer. Om bekræftelse af de positive kloner denne ELISA bør gentages mindst tre gange i forskellige supernatanter af den samme klon. Også at skille muligheden for uspecifik krydsreaktivitet anbefales at sikre, at der ikke er noget signal, når supernatanter inkuberes i ubestrøget men blokerede brønde. På dette trin, at en afsløring assay screene for den antigene specificitet af antistofferne af interesse kan udføres før at fortsætte til afsnit 7.

7. RNA Isolation og First Strand cDNA syntese af de producerende IgG Clones

  1. Så snart produktionen af ​​IgG bekræftes ved ELISA, ekstrahere RNA af klonen.
  2. Til udvinding RNA fra celler, der vokser i trin 5.7 eller 5.9, skal du bruge hævet III celler direkte cDNA-syntese kit, som gør det muligt at opnå DNA fra 10.000 celler til en celle.
  3. Til ekstraktion af RNA fra larger mængder af celler, eller fra pelleten gemt i trin 5.11 bruge høje rene RNA-isolering kit. Andre systemer til RNA-ekstraktion kan også være egnet i dette trin. Følg anvisningerne fra producenten.
  4. For celle tal mellem 1 x 10 6 og 1 x 10 4 brug revers transkription-systemet, efter instruktion af producenten. Andre systemer til første streng cDNA syntese, kan også anvendes.

8. 1 og 2. PCR for Amplifikation af de tunge og lette kæder af IgG-producerende B-cellekloner

  1. Med cDNA af cellekloner, opnået i trin 5.6 og 5.7 og positive i IgG ELISA i trin 6, udføre PCR med primerne anført i tabel 1.
  2. Oprette uafhængige PCR'er for hver IgG tung, kappa og lambda-kæde. Lav en stamopløsning med forward og reverse primere i lige koncentrationer. Tilføj dem til reaktionen ved 0,4 uM endelig koncentration. </ Li>
  3. Brug 1 pi af cDNA-syntese til at udføre 1 ST PCR. Her udføre 20 reaktioner pi under anvendelse Takara Taq producentens instruktioner. Alternativt kan du bruge andre polymeraser.
  4. Placer 1. PCR under følgende cyklus betingelser: 94 ° C i 5 min; (50 cykler af: 94 ° C i 30 sek; 58 ° C i 30 sekunder og 72 ° C i 45 sekunder; 72 ° C i 7 min, lad den afkøle ved 4 ° C.Include en blank i reaktionen, at opdage mulige forureninger.
  5. Forbered 1x TBE (89 mM Tris-borat og 2 mM EDTA). I et volumen på 100 ml 1x TBE tilsættes 1 g agarose (1% agarosegel). Opvarm opløsningen i mikrobølgeovnen i ca 1 min, indtil agarosen bliver opløst. Derefter tilsættes 4 pi 10 mg / ml ethidiumbromid (eller tilsvarende DNA-farvestof) og blandes.
    1. Hæld indholdet i en bakke og vente, indtil bliver polymeriseret. Køre 5 pi af PCR-blanding i gelen for at visualisere båndene. Tungkædefragments bør være omkring 400-550 bp, mens let kæde bør være omkring 300-400 bp. Hvis der ikke registreres bands, goere det samme til 2. PCR.
  6. Brug 1 pi af den første PCR-blanding til at udføre 2. PCR. Anvende de samme reagenser som i trin 8.2, men under anvendelse af den passende blanding af primere (se tabel 1). For de 2 nd PCR bruger følgende betingelser: 94 ° C i 5 minutter; (50 cykler af: 94 ° C i 30 sek; 56,5 ° C i 30 sek og 72 ° C i 55 sek); 72 ° C i 7 min; lad det køle ned ved 4 ° C. Medtag en blank i reaktionen, for at opdage mulige PCR forureninger.
  7. Forbered en agarosegel som beskrevet i 8.5. Køre gelen at visualisere PCR produktet som i 8.5.1 Brug amplifikationer, der indeholder den rigtige størrelse fragmenter til kloning i trin 9 og producerer antistofferne i trin 10.
  8. Sekvens DNA'et, ved anvendelse af 10 pi reaktion indeholdende: 100 ng af 2. PCR, 0.2 pM af primeren eller primer mix, 1 pi terminatoren og 1 pi af buffer. Udfør sekventeringsreaktionen under disse betingelser: (25 cykler af: 96 ° C i 10 sek; 50 ° C i 5 sekunder, og til 60 ° C i 4 min); 60 ° C i 7 min; lad det køle ned ved 4 ° C.
  9. Rense sekventeringsreaktioner med MicroSpin G50 kolonner efter producentens anvisninger. Evaluere sekvenserne af ligering i en automatisk sekvens analysator som beskrevet før 18. Elektroferogrammer skal være ren og svare til en enkelt immunoglobulin-sekvens.
    Bemærk: Hvis PCR-produkterne viser uklare eller blandede immunoglobulinsekvenser, kan du overveje at klone dem ved hjælp af TopoTA system, for at opnå isolerede sekvenser og derefter fortsætte til trin 9.

9. Kloning og sekventering af tunge og lette kæder af de producerende IgG-kloner

  1. Forbered 1 ug DNA af vektorer pFUSE2ss-CLIg-hk, pFUSE2ss-CLIg-HL2 og pFUSEss-CHIg-hG1.
  2. Fordøje disse vektorer med de passende restriktionsenzymer. Brug Eco RI og BSI WI for pFUSE2ss-CLIg-hk, Eco RI og Avr II for pFUSE2ss-CLIg-HL2, og Eco RI og Nhe I for pFUSEss-CHIg-hG1. Bruge 3 enheder af hvert restriktionsenzym for 1 ug DNA af vektor.
    1. Fordøje med ét enzym og oprense det fordøjede produkt med en PCR Purification Kit. Fordøje med det andet enzym og oprenses med en Gel Extraction Kit (ifølge producentens protokol). Skær fragmentet af interesse fra agarosegelen. Forbered agarosegel som i trin 8.5.
  3. Fordøje 2 nd PCR-produkter af den producerende IgG klon: Eco RI og BSI WI for kappa kæde forstærkning, Eco RI og Avr II for lambda kæde forstærkning, og Eco RI og Nhel for tung kæde forstærkning. Fordøje med ét enzym og oprense det fordøjede produkt med en PCR Purification Kit. Fordøje med det andet enzym og oprense det fordøjede produkt med en PCR Purification Kit. Brug samme enheder af enzymer og DNA beløb som i trin 9.2.
  4. Ligere PCR-fragmenterne indersiden af ​​vektorer med T4 DNA-ligase 16 ° CO / N følgende producentens anbefalinger. Forholdet anvendes, bør være 1: 2 (vektor: insert).
  5. Brug 1 pi af ligering til at transformere DH5a bakterier. Følg DH5a producentens betingelser for transformation. Spredes bakterierne i blasticidin eller Zeocin plader, afhængigt af typen af ​​vektor, der anvendes. Inkubér pladerne O / N ved 37 ° C.
  6. Grow enkelte kolonier, og udtrække DNA med en miniprep kit, efter fabrikantens anvisninger. Brug for enkelt koloni vokse og DNA ekstraktion producentens, anbefalinger fra DNA miniprep kit. Analysere dem ved fordøjelse med de enzymer, der anvendes til fremstilling af vektorer og indsatser som i trin 9.2 og 9.3.
  7. Sekvens DNA'et ved using 100 ng af vektoren som det gøres i trin 8.8 og 8.9.

10. Fremstilling af antistoffer i HEK-celler

  1. Grow HEK-celler i Dulbeccos modificerede Eagle medium (DMEM) suppleret med 10% føtalt kalveserum, 1% L-glucose, 1% penicillin / streptavidin (DMEM +) til en konfluens på 75% i en 150 mm cellekultur plade. Udføre i en hætte trin 10,1-10,7.
  2. Før transfektion ombytte mediet til medium som før, men uden føtalt kalveserum.
  3. For hver tung, let kæde transfektion fremstilles en transfektion blandes med 2,5 ml af DMEM (uden serum), 9 ug af vektoren med den tunge kæde, 6 ug af vektoren med den lette kæde, og 100 pi polyethylenimin (PEI ) opløsning (fra et 1 pg / pl stock). Inkuber ved stuetemperatur i 15 minutter.
  4. Forsigtigt tilsættes 2,5 ml af transfektion mix fremstillet i trin 10.3 til HEK-celler i pladen. Rock pladen til at distribuere homogent.
  5. Icubate cellerne i inkubatoren ved 37 ° C med 5% CO2 i 24 timer.
  6. Ændre dyrkningsmediet til medium uden føtalt kalveserum.
  7. Saml mediet fra pladerne 4 dage senere.
    Bemærk: Antistofferne i medierne, kan anvendes til at karakterisere deres reaktivitet in vitro og in vivo.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Sorteringen gating efter farvning CD22 og IgG positive celler er vist i figur 1 I dette billede området af de dobbelte positive celler -. B-celler, der producerer IgG-antistoffer - er valgt til at sortere alle disse celler i et separat rør. I analysen ca. 1% af de samlede PBMC'er svare til dette dobbelte positive population. Antallet af sorterede celler opnåede vil afhænge af antallet af celler opnået i afsnit 1.

De forskellige resultater efter 5 ugers EBV immortalisering og CpG (ODN2006) stimuli er vist i figur 2 Påvisningen af de voksende kloner er let.; WI38 feeder celler har en mere aflang fibroblast form, og B cellekloner vist som meget små runde celler, der vokser i klynger i midten af ​​den runde bund multi-brønds plade. På dette stadium er det klart, at nogle kloner begynder at vokse. Imidlertid kan den stigende hastighed være variabel og selvfølgelig nogle af brøndene containing immortaliserede celler kan ikke have nogen celler, der vokser på alle.

Supernatanten af de voksende kloner testes i en ELISA til påvisning af IgG som vist i tabel 2. I denne ELISA en standardkurve for IgG testes, sammen med supernatanten af klonerne og emnerne. En positiv klon anses, når værdien i ELISA er 3 standardafvigelser over blindværdien. Negative kloner værdier er under de 3 standardafvigelser af emnet. En bekræftelse, bør positive kloner være positive i ELISA mindst tre gange i forskellige supernatanter af samme klon og om muligt verificeret af en yderligere screeningsfremgangsmåde.

Den komplette sekvens af et humant IgG-antistof opnået anvendelsen af de beskrevne trin i dette manuskript er vist i figur 3. Denne sekvens er blevet opnået efter kloning af immunglobulin tung og lambda-kæde par fra en klonalt ekspanderet B-celle. Variabel ennd konstante regioner af den tunge og lette kæde kan karakteriseres med denne teknik. Efter opnåelse af sekvenserne kan antistoffer sekvenser klones og produceret in vitro i HEK cellekulturer.

Figur 1
Figur 1. Flow-cytometrisk analyse af CD22 + og IgG + celler fra humane perifere mononukleære blodceller. (A) Valg af populationen af levende celler er vist i P1. (B) Forward scatter plot. (C) Størrelse punktdiagram. (D) Y-aksen viser celler adskilt af anti-CD22-PerCP og på X-aksen adskilt af IgG-PE. P4 firkant angiver cellen fraktion, der er blevet sorteret (CD22 +, IgG +) og genvindes til kultur. Klik her for at se en større version af denne figur.

Figur 2
Figur 2. Repræsentativ billede af B-celle udødeliggjort kloner i en 96 brønds-plade efter 5 ugers dyrkning. (A) I denne Brønd nr immortalisering blev observeret efter 5 uger, men WI38- bestrålede fødeceller kan observeres. (B) A langsomt voksende klon blev observeret i dette godt, med små runde aggregater i midten. (C) Fast voksende klon viser rundt aggregater af udødeliggjort B-celler. Klik her for at se en større version af dette tal.

Figur 3
Figur 3. Humane antistof-sekvenser af tung og let kæde par fra en human immortaliseret B-celle-klon, F5.2, Hvilket indikerer V CDR1, CDR2 og CDR3-sekvenser. Klik her for at se en større version af dette tal.

"> Λ
1 m PCR primere
Forward (5'-3 ') Revers (3'-5 ')
IgG 5'L-VH 1 ACAGGTGCCCACTCCCAGGTGCAG 3 'Cy CH1 GGAAGGTGTGCACGCCGCTGGTC
5'L-VH 3 AAGGTGTCCAGTGTGARGTGCAG
5'L-VH 4/6 CCCAGATGGGTCCTGTCCCAGGTGCAG
5'L-VH 5 CAAGGAGTCTGTTCCGAGGTGCAG
κ 5'L VK 1/2 ATGAGGSTCCCYGCTCAGCTGCTGG 3 'CK 543 GTTTCTCGTAGTCTGCTTTGCTCA
5'L VK 3 CTCTTCCTCCTGCTACTCTGGCTCCCAG 3 'CK 494 GTGCTGTCCTTGCTGTCCTGCT
5 L VK 4 ATTTCTCTGTTGCTCTGGATCTCTG
5 'Pan VK ATGACCCAGWCTCCABYCWCCCTG
λ 5'L VA 1 GGTCCTGGGCCCAGTCTGTGCTG 3 'Cλ CACCAGTGTGGCCTTGTTGGCTTG
5'L VA 2 GGTCCTGGGCCCAGTCTGCCCTG
5'L VA 3 GCTCTGTGACCTCCTATGAGCTG
5'L VA 4/5 GGTCTCTCTCSCAGCYTGTGCTG
5'L VA 6 GTTCTTGGGCCAATTTTATGCTG
5'L VA 7 GGTCCAATTCYCAGGCTGTGGTG
5L VA 8 GAGTGGATTCTCAGACTGTGGTG
2 nd PCR-primere
Forward (5'-3 ') Revers (3'-5 ')
IgH 5 'EcoRI VH1 CAACCGGAATTCGCAGGTGCAGCTGG
TGCAG
3 'Nhel JH 1,2,4,5 CTGCTAGCTAGCTGAGGAGACGGT
GACCAG
5 'EcoRI VH1 til 5 CAACCGGAATTCAGAGGTGCAGCTG
GTGCAG
3 'Nhel JH 3 CTGCTAGCTAGCTGAGAGACGGTGA
CCATTG
5 'EcoRI VH3 CAACCGGAATTCAGAGGTGCAGCTG
GTGGAG
3 'Nhel JH 6 CTGCTAGCTAGCTGAGGAGACGGTG
ACCGTG
5 'EcoRI VH3 23 CAACCGGAATTCAGAGGTGCAGCT
GTTGGAG
5 'EcoRI VH4 CAACCGGAATTCACAGGTGCAGCT
GCAGGAG
5 'EcoRI VH 4 34 CAACCGGAATTCACAGGTGCAGCTAC
AGCAGTG
5 'EcoRI VH 1 18 CTTCCGGAATTCACAGGTTCAGCT
GGTGCAG
5 'EcoRI VH 1 24 CTTCCGGAATTCACAGGTCCAGCT
GGTACAG
5 'EcoRI VH3 33 CTTCCGGAATTCACAGGTGCAGCT
GGTGGAG
5'EcoRIVH 3 9 GATCCGGAATTCAGAAGTGCAGCT
GGTGGAG
5 'EcoRI VH4 39 GATCCGGAATTCACAGCTGCAGCT
GCAGGAG
5 'EcoRI VH 6 1 GATCCGGAATTCACAGGTACAGCT
GCAGCAG
κ 5 'EcoRI VK 1 5 CAACCGGAATTCAGACATCCAGATGA
CCCAGTC
3 'BsiWI JK 1 til 4 GCCACCGTACGTTTGATYTCCACCTTGGTC
5'EcoR1 VK 1 9 CTTCCGGAATTCAGACATCCAGTTGAC
CCAGTCT
3 'BsiWI JK 2 GCCACCGTACG TTTGATCTCCAG
CTTGGTC
5'EcoR1 VK 1D 43 CTTGGCGAATTCAGCCATCCGGATGA
CCCAGTC
3 'BsiWI JK 3 GCCACCGTACGTTTGATATCCACT
TTGGTC
5'EcoR1 VK 2 24 CTTCCGGAATTCAGATATTGTGATGA
CCCAGAC
5'EcoR1 VK 2 28 CTTCCGGAATTCAGATATTGTGATG
ACTCAGTC
5'EcoR1 VK 2 30 CTTCCGGAATTCAGATGTTGTGATGA
CTCAGTC
5'EcoR1 VK 3 11 CTTCCGGAATTCAGAAATTGTGTTG
ACACAGTC
5'EcoR1 VK 3 15 CTTCCGGAATTCAGAAATAGTGATG
ACGCAGTC
5'EcoR1 VK 3 20 CTTCCGGAATTCAGAAATTGTGTTGA
CGCAGTCT
5'EcoR1 VK 4 1 CTTCCGGAATTCAGACATCGTGATG
ACCCAGTC
5'EcoR1 VA 1 CTTCCGGAATTCACAGTCTGTGCT
GACKCAG
3 'AvrII Jλ 1 til 3 CTGGTTACCTAGGAGGACGGTSACCT
TGGTCCC
5'EcoR1 VA 2 CTTCCGGAATTCACAGTCTGCCC
TGACTCAG
3 'Avrll Jλ 4 CTGGTTACCTAGGAAAATGATCAGC
TGGGTTCC
5'EcoR1 VA 3 CTTCCGGAATTCATCCTATGAGC
TGACWCAG
3 'Avrll Jλ 5 CTGGTTACCTAGGAGGACGGTCAGC
TCGGTCCC
5'EcoR1 VA 4 til 5 CTTCCGGAATTCACAGCYTGTG
CTGACTCA
3 'Avrll Jλ 6 CTGGTTACCTAGGAGGACGGTCAGCT
GGGTGCC
5'EcoR1 VA 6 CTTCCGGAATTCAAATTTTATGC
TGACTCAG
3 'Avrll Jλ 7 CTGGTTACCTAGGAGGACGGTCAC
TTGGTCCAT
5'EcoR1 VA 7 til 8 CTTCCGGAATTCACAGRCTGTG
GTGACYCAG
"> Tabel 1. Primere anvendt.

eft "> 0,080
1 2 3 4 5 6 7 8 9 10 11 12
En 0,076 0,077 2,003 0.080 0,138 0,102 0,188 0,338 0,040 2,041 0,051 0,081
B 2,011 0,085 0,074 0,069 0,081 0,122 0,372 2,133 0,119 0,097 0,072 0,072
C 0,068 0,179 0,091 0,073 0,077 0,097 0,606 1,882 0,081 2,071 0,094 0,075
D 0,063 0,070 0,065 0,071 0,082 2,071 0,339 2,089 0,076 0,086 0,066 0,069
E 1,921 0,077 0,065 0,085 0,095 1.968 1.910 0,122 0,072 0,070 0,065 0,066
F 0,113 0,068 0,066 0,082 0,088 0.090 0.460 0,070 0,079 0,952 0,098 0,065
G 2,041 2.108 1,472 0,665 0,331 0,194 0,123 0,094 0,072 0,070 0,072
H 2,146 2.132 1,634 0,665 0,341 0,178 0,132 0,094 0,082 0.080 0,074 0,068
Standarder ng / ul 1000 500 250 125 62,5 31,25 15.6 7.8 3.9 1,95 0,975 0

Tabel 2. Repræsentative resultater af IgG-screening ved ELISA. Klone supernatanter i A1-A10, B1-B10, C1-C10, D1-D10, E1-E10, F1-F10. Blanks er i A11, B11, C11, D11, E11, F11, A12, B12, C12, D12, E12, F12.Standard kurve duplikeres: G1-G12 og H1-H12. Den tilsvarende koncentration af immunoglobuliner i hvert duplikat vises below.Positive eller IgG producerende kloner er vist i mørkegrå. Negative eller ikke-IgG producerende kloner er vist i lysegrå

Subscription Required. Please recommend JoVE to your librarian.

Discussion

I dette manuskript, er alle trinene for genereringen af ​​IgG-antistoffer fra humane PBMC'er præsenteres i detaljer. Denne protokol omfatter nogle fordele i forhold til tidligere publicerede teknikker. En af fordelene er, at antistoffet produceret holder de tunge og lette kæder, der svarer til den oprindelige pair i B-celle-klonen. Identifikationen af IgG antistoffer kan udføres i enhver type human donor, og der er ikke behov for forværring af immunresponset skyldes vaccination 5. Anvendelsen af fibroblast cellelinje WI38 som feeder celle, tillader en mere hurtig påvisning af de voksende kloner, da de er morfologisk forskellige og meget let at differentiere i forhold til PBMC'erne der anvendes som feeder celle i tidligere beskrevne værker 1,6- 8. Desuden anvendelsen af ​​WI38 som feeder celle begunstiger frysning af store mængder celle portioner, der let kan optøet og dyrket før hvert forsøg.

En af critiCal skridt i denne protokol er udgangsmaterialet: Den PBMC'er. Hvis blod har ventet for længe på centrifugering eller efter udvinding af PBMC'er, de ikke er lagret i de passende frost; som sådan antallet af levedygtige celler vil blive reduceret, sammen med antallet af B-celle-IgG producerende kloner opnået. Derfor, en tidlig ekstraktion og en god bevarelse af PBMC'er anbefales til et vellykket resultat. Antallet af IgG-producerende kloner er begrænset til antallet af PBMC'er ved begyndelsen af ​​eksperimentet. Højere antal PBMC'er vil give højere antal IgG producerende kloner og en diversificeret antistofproduktion. Anden kritisk trin er kloningen af ​​PCR-fragmenter af de lette og tunge kæder af antistoffet. Hvis ligering ikke lykkes efter flere forsøg, er et ekstra trin for kloning af 2. PCR-produkt i en TopoTA system, anbefales. Fordøjelsen af ​​insertet med passende enzymer kan være letterei TopoTA vektor, en efterfølgende ligering i pFUSEss ekspressionsvektorer.

Denne teknik kan overføres til en hvilken som helst type af humant væv, hvori humane B-celler er beriget 3. Det kan også anvendes til studiet af andre typer af immunoglobuliner, blot ved at ændre de mærkede antistoffer anvendes til sortering (antistoffer mod IgM, IgE, IgA eller IgD), primeren designet til PCR, og de udtrykkende vektorer. Undersøgelserne af disse immunoglobuliner kan være af interesse for at forstå, indledende immunreaktioner, slimhinder antistofsekretion og allergi profiler, blandt andre.

Som konklusion har vi beskrevet en teknik til fremstilling af humane rekombinante monoklonale IgG-antistoffer, der efterlader de tunge og lette kæder par af det humane immunoglobulin intakt. Teknikken er nyttig og let at udføre startende fra en blodprøve. De monoklonale antistoffer opnået gennem denne metode er potentielt nyttige i undersøgelser af human immunreaktioner. Desuden kan monoklonale antistoffer produceret med denne metode være et godt udgangspunkt for udvikling af immuno-terapeutiske midler for forskellige patologiske tilstande.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne erklærer, at de ikke har nogen konkurrerende finansielle interesser.

Acknowledgments

Forskning kontrakt Miguel Servet (ISCIII CD14 / 00.032) til (GN-G.). Fellowship fra Holland Organisation for Videnskabelig Forskning "Graduate School of Translationel Neurovidenskab Program" (022005019) til (CH).

Tilskud fra Prinses Beatrix Fonds (Project WAR08-12) og Foreningen Française contre les Myopati til (PM-M.); såvel som af en Veni Fellowship nederlandsk organisation for Videnskabelig Forskning (916.10.148) et fællesskab af Brain Foundation Nederlandene (FS2008 (1) -28) og Prinses Beatrix Fonds (Project WAR08-12) (til ML ).

Vi takker Jozien Jaspers for hendes hjælp i B-celle sortering ved flowcytometri.

Materials

Name Company Catalog Number Comments
Histopaque-1077  Sigma-Aldrich 10771 solution containing polysucrose and sodium diatrizoate
FACSAria II cell sorter  BD Biosciences 
96 U-bottom micro well plates  Costar 3799
Advanced Roswell Park Memorial Institute (RPMI) 1640 medium  Gibco, Life Technologies 12633-020
30% v/v EBV-containing supernatant of the B95-8 cell line   ATCC CRL-1612 3.4 x 108 copies/ml
CpG2006  Invivogen ODN 7909
Wi38 cells  Sigma-Aldrich 90020107
Interleukin-2 Roche  10799068001
ELISA plates Greiner Bio-One, Microlon 655092
AffiniPure F(ab')2 Fragment Goat Anti-Human IgG, Fcγ Fragment Specific (unconjugated) Jackson ImmunoResearch 109-006-008
4% non-fat dry milk (Blotting Grade Blocker)  Biorad 170-6404
Human IgG  Sigma I 2511 HUMAN IgG purified Immunoglobulin, 5.6 mg/ml
Goat F(ab)2 antihuman IgG Fcγ (conjugated with peroxidase (PO)) Jackson ImmunoResearch 109-036-008
ELISA reader (Perkin Elmer 2030)  Perkin Elmer  2030-0050
Peroxidase-conjugated AffiniPure Rabbit Anti-Human IgM, Fc5µ  Jackson ImmunoResearch 309-035-095
SuperScript III Cells Direct cDNA Synthesis System  Invitrogen  18080-200
Applied Biosystems (ABI) GeneAm PCR System 2700 Applied Biosystems
High Pure RNA Isolation Kit  Roche 11828665001
Reverse transcription system kit  Promega A3500
Recombinant Taq DNA Polymerase TAKARA R001A
Primers (2 μl) Sigma
Ultrapure Agarose  Invitrogen 16500-500
100 bp ladder Invitrogen 15628-019
Quantity One 4.5.2 (Gel Doc 2000) Biorad 170-8100
QIAquick PCR purification kit QIAGEN 28106
BigDye Terminator v3.1 cycle sequencing kit  Applied Biosystems 4337455
0.1 ml reaction plate (MicroAMP Optical 96-well) Applied Biosystems 4346906
Genetic analyser ABI300  Applied Biosystems 4346906
DH5α competent cells (E. coli) Invitrogen 18263-012
pFUSEss-CHIg-hG1 (4,493 bp) Invivogen pfusess-hchg1
pFUSEss-CHIg-hG4 (4,484 bp)  Invivogen pfusess-hchg4
pFUSE2ss-CLIg-hk (3,875 bp) Invivogen pfuse2ss-hclk
pFUSE2ss-CLIg-hl2 (3,883 bp)  Invivogen pfuse2ss-hcll2
SOC medium Invitrogen 15544-034
LB-based agar medium supplemented with Zeocin (Fast-Media Zeo Agar) Invivogen fas-zn-s
Terrific Broth (TB)-based liquid medium supplemented with Zeocin (Fast-Media Zeo TB) Invivogen fas-zn-l
DNA Miniprep kit  Omega Bio Technology D6942-02
Nanodrop (ND1000 Spectrophotometer) Nanodrop
LB-based agar medium supplemented with Blasticidin (Fast-Media Blast Agar) Invivogen fas-bl-s
Terrific Broth (TB)-based liquid medium supplemented with Blasticidin (Fast-Media Blast TB) Invivogen fas-bl-l
EcoRI New England Biolabs R0101S 20,000 U/ml, in 10x NEBuffer EcoRI
NheI New England Biolabs R0131S 10,000 U/ml, in 10x NEBuffer 2.1
2-Log DNA ladder New England Biolabs N3200S 0.1-10.0 kb, 1,000 μg/ml
XmaI New England Biolabs R0180S 10,000 U/ml, in 10x CutSmart Buffer 
BsiWI New England Biolabs R0553S 10,000 U/ml, in 10x NEBuffer 3.1
AvrII New England Biolabs R0174S 5,000 U/ml, in 10x CutSmart Buffer 
FastAP Thermosensitive Alkaline Phosphatase Thermo Scientific EF0651 1 U/µl, in 10x FastAP Buffer
DH5α competent cells  Invitrogen 18263-012
PE Mouse Anti-Human IgG BD Pharmingen 555787
anti-CD22, PerCP-Cy5.5, Clone: HIB22 Fisher scientific BDB563942
QIAprep Spin Miniprep Kit  QIAGEN 27106
BigDye Terminator v3.1 Applied Biosystems 4337455

DOWNLOAD MATERIALS LIST

References

  1. Vrolix, K., et al. Clonal heterogeneity of thymic B cells from early-onset myasthenia gravis patients with antibodies against the acetylcholine receptor. J Autoimmun. 52, 101-112 (2014).
  2. Yamashita, M., Katakura, Y., Shirahata, S. Recent advances in the generation of human monoclonal antibody. Cytotechnology. 55, (2-3), 55-60 (2007).
  3. Pereira, K. M., Dellavance, A., Andrade, L. E. The challenge of identification of autoantibodies specific to systemic autoimmune rheumatic diseases in high throughput operation: Proposal of reliable and feasible strategies. Clin Chim Acta. 437, 403-410 (2014).
  4. Losen, M., et al. Treatment of myasthenia gravis by preventing acetylcholine receptor modulation. Ann N Y Acad Sci. 1132, 174-179 (2008).
  5. Smith, K., et al. Rapid generation of fully human monoclonal antibodies specific to a vaccinating antigen. Nat Protoc. 4, (3), 372-384 (2009).
  6. Fraussen, J., et al. A novel method for making human monoclonal antibodies. J Autoimmun. 35, (2), 130-134 (2010).
  7. Traggiai, E., et al. An efficient method to make human monoclonal antibodies from memory B cells: potent neutralization of SARS coronavirus. Nat Med. 10, (8), 871-875 (2004).
  8. Fraussen, J., et al. Autoantigen induced clonal expansion in immortalized B cells from the peripheral blood of multiple sclerosis patients. J Neuroimmunol. 261, (1-2), 98-107 (2013).
  9. Yamashita, M., et al. Different individual immune responses elicited by in vitro immunization. Cytotechnology. 40, (1-3), 161-165 (2002).
  10. Hui-Yuen, J., Koganti, S., Bhaduri-McIntosh, S. Human B cell immortalization for monoclonal antibody production. Methods Mol Biol. 1131, 183-189 (2014).
  11. Tiller, T., et al. Efficient generation of monoclonal antibodies from single human B cells by single cell RT-PCR and expression vector cloning. J Immunol Methods. 329, (1-2), 112-124 (2008).
  12. Lanzavecchia, A., Corti, D., Sallusto, F. Human monoclonal antibodies by immortalization of memory B cells. Curr Opin Biotechnol. 18, (6), 523-528 (2007).
  13. Traggiai, E. Immortalization of human B cells: analysis of B cell repertoire and production of human monoclonal antibodies. Methods Mol Biol. 901, 161-170 (2012).
  14. Strober, W., et al. Monitoring cell growth. Curr Protoc Immunol / edited by. John E. Coligan ... [et al.]. Appendix 3, Appendix 3A (2001).
  15. Ibrahim, S. F., van den Engh, G. Flow cytometry and cell sorting. Adv Biochem Eng Biotechnol. 106, 19-39 (2007).
  16. Leith, J. T., Padfield, G., Faulkner, L. E., Quinn, P., Michelson, S. Effects of feeder cells on the X-ray sensitivity of human colon cancer cells. Radiother Oncol. 21, (1), 53-59 (1991).
  17. Hui-Yuen, J., McAllister, S., Koganti, S., Hill, E., Bhaduri-McIntosh, S. Establishment of Epstein-Barr virus growth-transformed lymphoblastoid cell lines. J Vis Exp. (57), 3321 (2011).
  18. Smith, L. M., et al. Fluorescence detection in automated DNA sequence analysis. Nature. 321, (6071), 674-679 (1986).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics