Génération de Recombinant Human IgG anticorps monoclonaux à partir de cellules immortalisées Classé B

* These authors contributed equally
JoVE Journal
Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Nogales-Gadea, G., Saxena, A., Hoffmann, C., Hounjet, J., Coenen, D., Molenaar, P., Losen, M., Martinez-Martinez, P. Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells. J. Vis. Exp. (100), e52830, doi:10.3791/52830 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Le but de cet article est de décrire en détail une méthodologie pour générer et caractériser des anticorps monoclonaux IgG humaines obtenues à partir de cellules mononucléées du sang périphérique (CMSP) humaines.

L'intérêt d'étudier des anticorps humains a augmenté dans de nombreux domaines de recherche. En particulier, de nombreux groupes de recherche sont intéressés à la pathologie causée par des auto-anticorps 1-3. Nous avons cloné et caractérisé pathogènes auto-anticorps 1. L'étude d'auto-anticorps peut aider à identifier leurs objectifs et d'élaborer des stratégies thérapeutiques, par exemple, en utilisant des anticorps concurrents 4. En outre, l'étude d'anticorps humains peut aussi être d'intérêt dans d'autres domaines de la recherche, à savoir, pour évaluer la réponse immunitaire après la vaccination 5, pour caractériser le profil d'anticorps d'individus qui ont été exposés et qui sont devenus résistants aux pathogènes spécifiques 6 ou pour étudier ce qui anticorps sont enle répertoire naturel 7,12.

Plusieurs techniques ont été développées pour produire des anticorps monoclonaux humains recombinants 12/08; la plupart d'entre eux utilisent phage display et l'immortalisation des cellules B. L'utilisation de la présentation par des phages a été largement appliquée pour la découverte de nouveaux anticorps 13. Cependant, il présente un inconvénient majeur, à savoir que les paires de chaînes lourdes et légères de l'immunoglobuline humaine devenue dissociés dans le processus. Production d'hybridomes à cellules B humaines ou de transformation EBV remédie à cet inconvénient.

Nous utilisons l'infection des cellules thymiques B par l'EBV en combinaison avec une stimulation cellulaire polyclonale B par l'intermédiaire des récepteurs Toll-like 9 (TLR-9) 6,12.

Dans cet article, nous décrivons en détail la technologie que nous utilisons pour le développement d'anticorps humains IgG, avec un aperçu complet de toutes les étapes de l'isolement de la CMSP vitro génération d'anticorps. Cetteprotocole peut être utilisé pour l'analyse de tout type de profil IgG humaine. Dans notre laboratoire, les cellules B produisant des anticorps IgG ont été séparés avec succès à partir du reste de PBMC après triage. Cinquante cellules B trié 8 peuvent ensuite être étalées dans des plaques multi-puits et immortalisées par EBV et TLR-9 activation, de l'expansion clonale de cellules B individuelles. Comme cellules nourricières, les fibroblastes provenant de tissu de poumon embryonnaire humain ont été utilisées, WI38 de lignées cellulaires, ce qui facilite la visualisation des cellules B immortalisées. A partir de ces cellules B, les séquences des chaînes lourdes et légères de l'immunoglobuline peuvent être obtenues par PCR, et les gènes d'anticorps clones dans immunoglobuline G vecteurs d'expression et produites in vitro. Grâce à cette technique, les anticorps simples avec exactement la même séquence anticorps trouvés chez le donneur peuvent être étudiés.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Le consentement éclairé a été obtenu par les participants de l'étude. L'étude a été approuvée par le comité d'éthique institutionnelle.

1. Isolement des cellules mononucléaires du sang périphérique (CMSP)

  1. Centrifugeuse 25 ml de sang héparine de participants à 900 g pendant 15 min, dès que possible après l'extraction de sang. Si il ya moins de sang, réduire les réactifs en conséquence. Effectuer toutes les prochaines étapes dans une hotte.
  2. Transférer le sérum dans un tube propre. Il peut être utilisé dans les étapes ultérieures pour la congélation des PBMC ou dans le cas de patients auto-immuns, pour tester des auto-anticorps.
  3. On dilue le sang avec 10 ml de milieu RPMI 1640 et remettre en suspension les cellules par pipetage de haut en bas.
  4. Ajouter 15 ml d'une solution contenant du polysucrose et de diatrizoate de sodium (1,077 g / ml) dans un nouveau tube de 50 ml.
  5. Couche doucement le sang sur le haut de la solution dans l'étape 1.4 en amenant les deux ouvertures de la tubes proximité togetelle jusqu'à ce que les deux liquides viennent très lentement en contact, et puis décanter la suspension de PBMC lentement au-dessus du tube de 50 ml. Cette étape est essentielle pour avoir une bonne séparation des PBMC.
  6. Centrifuger le tube obtenu à l'étape 1.5 à 400 g sans frein à température ambiante pendant 20 min.
  7. Après la centrifugation, de récupérer avec la pipette l'anneau blanc qui apparaît dans la partie médiane du tube, qui contient les CMSP.
  8. Laver les cellules avec 25 ml de milieu RPMI 1640.
  9. Centrifuger à 300 xg à température ambiante pendant 10 min.
  10. Jeter le surnageant et laver les cellules avec 10 ml de RPMI 1640. Centrifugeuse à nouveau comme dans l'étape 1.9.
  11. Comptez les CMSP avec une chambre Neubauer comme indiqué précédemment 14.
  12. Traiter la CMSP de l'article 2 ou de les stocker pour une utilisation ultérieure comme suit: 10 millions de CMSP pour la congélation par tube Cryovial dilué dans 1 ml de 10% de diméthylsulfoxyde (DMSO) et 90% de sérum obtenus dans l'étape 1.2. Congeler progressivement et pour longtemps storage dans l'azote liquide.

2. coloration CMSP pour le tri CD22 + et IgG + par cytométrie en flux

  1. Plaque les PBMC dans un 25 cm2 ballon de culture de cellules avec 6 ml de milieu complet RPMI 1640 (supplémenté avec de la L-glutamine, du tampon HEPES 10 mM, 50 U / ml de pénicilline, 50 ug / ml de streptomycine et 10% de sérum bovin foetal) et laissez-les récupérer O / N dans l'incubateur à 37 ° C à 5% de CO 2.
  2. Bloquer tubes FACS stériles stériles 4% de phosphate d'albumine une solution saline tamponnée (PBS) O / N. Laver les tubes deux fois avec PBS et les remplir avec 500 pi de milieu RPMI 1640 complet. Utilisez ces tubes pour la récupération des cellules après le tri.
  3. Recueillir les PBMC dans un tube et centrifuger à 400 g à température ambiante pendant 5 min.
  4. Reprendre les cellules dans un tampon d'étiquetage (voir les étapes 2.5 et 2.6) et les compter 14. Le tampon de marquage est du sérum stérile à 2% de veau foetal et 1 mM d'acide éthylènediaminetétraacétique (EDTA) dans PBS.
  5. Préparer trois tri cellulaire (FACS) des tubes de fluorescence-activated avec 10 5 cellules et remettre en suspension chacun dans 100 ul de tampon de marquage. Ces tubes serviront à définir les portes du tri.
    1. Dans le premier tube ajouter 5 ul d'anticorps CD22 PerCP anti- (recommandé dans la fiche technique du fabricant), dans le deuxième tube 20 ul d'IgG anti-PE (recommandé dans la fiche technique du fabricant), et rien dans le troisième tube. Incuber sur de la glace et dans l'obscurité pendant 30 min.
  6. Remettre en suspension 5 millions de cellules dans 200 ul de tampon de marquage dans un tube FACS et ajouter 10 ul d'anticorps anti CD22 PerCP et 40 ul d'IgG anti-PE. Incuber les cellules sur de la glace et sombre pendant 30 min. Si le tri d'un nombre plus élevé de cellules est désiré, plus grande échelle l'ensemble des réactifs.
  7. Centrifuger les cellules à 400 g avec une faible frein pendant 5 min à température ambiante.
  8. Décanter doucement le surnageant.
  9. Reprendre les cellules dans 500 μl de tampon de l'étiquetage. Centrifuger les cellules à 400 g avec une faible frein pendant 5 min à température ambiante. Répétez les étapes 2.7 et 2.8
  10. Décanter doucement le surnageant et remettre en suspension les cellules dans 300 pi de milieu RPMI complet.
  11. Faire passer les cellules à travers un filtre de 0,45 um. Les cellules sont prêts à trier.

3. tri des cellules B CD22 + et IgG +

  1. Utilisez trois tubes de commande pour établir la viabilité des cellules. Dans le contrôle, sans taches, utilisez la parcelle de l'avant et la taille scatter pour définir le déclenchement des lymphocytes. Les contrôles avec le CD22 PerCP et anti-IgG PE servent à établir les portes, et la porte de tri. Effectuer suivante données présentées antérieurement 15.
    Remarque: Une porte est un ensemble de valeurs limites (frontières) qui servent à isoler un groupe d'événements spécifiques cytométrie, dans nos cellules de cas, à partir d'un grand ensemble. Dans le cas d'une grille de tri des limites de valeur permet la récupération des événements cytométrie, des cellules, qui sont à l'intérieur deles limites définies: CD22 + et IgG +.
  2. Comme un tube de collecte dans le tri, utiliser les tubes bloqués avec 500 pi de milieu RPMI 1640 complet, obtenus à partir de l'étape 2.2.
  3. Passez à trier positive double 15: CD22 + IgG +. Notez le nombre final de cellules dans chaque état. Plate cellules triées sur le dessus de cellules nourricières dès que possible.

4. L'irradiation des cellules nourricières

Remarque: Effectuez la préparation des cellules nourricières entre 1 - 3 jours avant le tri. Au moins 5.000 cellules WI38 sont nécessaires par puits dans une plaque de puits tour 96. Effectuer les étapes 4.1, 4.2 et 4.4 dans une hotte.

  1. Cultiver les cellules WI38 à 37 ° C et 5% de CO2 dans du milieu RPMI 1640 complet (le même que pour les PBMC) jusqu'à ce que le nombre désiré de cellules sont atteintes.
  2. Irradier à 50 Grays, suivant un protocole décrit avant le 16. Effectuer irradiation fois que les cellules WI38 ont été trypsinisées et remises en suspension dans cemplissez le milieu RPMI, ou avec WI38 attaché au flacon de culture et trypsinées après l'irradiation. Suivez la méthode de traitement à la trypsine indiqué par le fournisseur de cellules WI38. Irradier le nombre de cellules nécessaires pour couvrir les puits nécessaires pour le placage des cellules IgG + B (1% du total des PBMC en compte à l'étape 1.11).
  3. Plate 90 pi contenant 5000 irradiés WI38 cellules dans chaque puits de la plaque de bien ronde 96. Laissez les puits dans la rangée extérieure de la plaque vide (parce qu'ils évaporer plus rapidement), et utiliser uniquement les 60 puits dans le milieu de la plaque pour le placage des cellules. Remplir les puits extérieurs qui sont encadrant la plaque avec 200 ul de PBS.
  4. Les placer dans un incubateur à 37 ° C à 5% de CO 2, jusqu'à ce que nécessaire.

5. Placage Classé CMSP, EBV Infection and Growing

  1. Diluer les CMSP triés, à la plaque 50 cellules dans 50 pi de milieu RPMI 1640 complet par puits dans la plaque de 96 puits ronde (wit précédemment plaquéh WI38 des cellules irradiées). Effectuer les étapes dans une hotte équipée pour les travaux de EBV.
    Remarque: l'infection de 50 cellules par puits est optimisée et augmente la vraisemblance de produire un anticorps monoclonal 8, cependant, il est recommandé de vérifier par PCR comme décrit ci-1,6.
  2. Ajouter 60 pi de surnageant (EBV contenant 3-4 x 10 8 copies virales / ml) à chaque puits de la plaque à 96 puits ronde 17. Il faut être prudent lors de travaux de EBV.
  3. Ajouter 1 pg / ml de CpG (ODN2006) par puits.
  4. Laisser les cellules dans un incubateur à 37 ° C sous 5% de CO 2.
  5. Visuellement moniteur clone de plus en plus sous le microscope après une semaine.
    Remarque: Certains exemples de la croissance des cellules B peut être vu ci-dessous dans la section des résultats. Notez que les taux des clones de croissance peuvent varier, et le temps supplémentaire pourrait être nécessaire pour commencer à voir une certaine masse de cellules de plus en plus dans le milieu du puits.
  6. Après les deux semaines du 1 ers moniteur clone de plus en plus sous le microscope optique et de procéder à la première bourse de médias. Lentement pipette 90 ul de milieu de la partie supérieure du puits et de recueillir dans une plaque de 96 puits propre. (Cellules B se trouvent dans le fond du puits, il n'y a donc aucun risque de les aspirer).
    1. Ajouter dans chaque puits 100 ul de RPMI 1640 complet milieu supplémenté avec 1 ug / ml de CpG (ODN2006) et 50 U / ml d'IL2. Si clones sont de plus en plus, d'analyser ce premier échange de médias par ELISA comme à l'étape 6.
  7. Surveiller clone croissante et changer médias après le 3 ème et le 4 ème semaine de la croissance de nouveau en prenant 90 pi de milieu et en ajoutant 100 pi de RPMI 1640 complet des milieux supplémentés avec 1 ug / ml de CpG (ODN2006) et 50 U / ml de IL2. Utilisez le surnageant recueilli pour surveiller la production d'IgG par ELISA comme à l'étape 6.
    Remarque: Après un clone mois de croissance devrait être évident en observant agrégats de cellules rondes that réside habituellement dans le milieu du fond rond bien.
  8. À cette étape, changer de support de la même manière que les semaines précédentes, mais seulement avec complets RPMI 1640. Un bon indicateur de connaître le bon moment pour changer de support est la couleur des médias, si elle est de plus en cellules jaunâtres besoin d'un échange de médias.
  9. Lorsque des plaques à 96 puits sont à base de grands clones (environ 5 x 10 5 cellules), de les transférer à un bien à plat d'une plaque de 24 puits. Ajouter 300 pi de RPMI 1640 complet médias pour le nouveau puits. Reprendre le clone 96 puits de plus en plus, par aspiration et à plusieurs reprises, et les cellules de transfert vers le nouveau puits, la distribution homogène. Ajouter les nouveaux médias en cas de besoin.
    1. Lorsque les puits de la plaque de 24 puits sont pleins de cellules (environ 5 x 10 6 cellules), transférer à un bien à plat d'une plaque à 6 puits. Ajouter 2 ml de RPMI 1640 complet médias pour le nouveau puits. Reprendre les cellules dans la plaque de 24 puits par pipetage de haut en bas plusieurs fois, et les distribuer homotanément dans le nouveau puits.
  10. Ajouter des médias en cas de besoin. Si les cellules ne doivent pas être maintenues en culture, un culot les cellules à 400 xg pendant 5 min à température ambiante. Rangez les surnageants pour les tests ELISA. Laver le culot de cellules une fois avec 1 x PBS, centrifuger à nouveau à 400 g pendant 5 min, et stockées à sec à -80 ° C jusqu'à l'extraction d'ARN.
    1. Lorsque les cellules dans la plaque à 6 puits deviennent confluentes (environ 20 x 10 6 cellules), pour transférer une plaque de culture de 60 mm. Ajouter 4 ml de RPMI 1640 complet médias à la nouvelle plaque. Remettre les cellules en plaque de 6 puits et les transférer comme fait est étapes 5.9 et 5.10.
  11. Ajouter les nouveaux médias en cas de besoin. À cette étape, de geler les cellules au 10-30000000 / ml dans 90% de sérum de veau foetal et 10% de DMSO. Si de grandes quantités de cellules sont voulaient, poursuivre l'expansion des clones dans les grandes plaques de surface.

6. ELISA pour IgG anticorps de détection

  1. Distribuer 50 pl / puits dans une plaque ELISA of chèvre F (ab) 2 d'anticorps anti-Fc humain dilué à 1 200 dans du tampon de revêtement. un tampon de revêtement contenant 50 mM de Na 2 CO 3 pH 9,6.
  2. Sceller les plaques avec un autocollant en plastique, et incuber 1 heure à 37 ° C. Alternativement, incuber à 4 ° CO / N.
  3. Laver chaque puits six fois avec 200 pl de tampon de lavage. tampon de lavage contient de 0,05% de Tween-20 dans 1 x PBS. Ne pas toucher ni égratigner la surface du puits, où l'anticorps a lié.
  4. Bloquer avec un tampon bloquant, 100 pl / puits. Le tampon de blocage contenant 4% de lait sec non gras dans du PBS. Sceller la plaque et incuber 1 heure à 37 ° C.
  5. Ne pas laver. Jeter un tampon bloquant et gifler la plaque 3 fois à l'envers sur une serviette en papier pour enlever le liquide résiduel.
  6. Incuber les surnageants et les normes de clones.
    1. Pour un premier test, diluer surnageants de clone obtenu à l'étape 5.6 ou 5.7 1/3 dans du RPMI. Pour les normes diluer avec du milieu RPMI solution d'IgG humaine pour obtenir: 1,000 ng /ml, 500 ng / ml, 250 ng / ml, 125 ng / ml, 62,5 ng / ml, 31,25 ng / ml, 15,6 ng / ml et en blanc. Utilisez 50 pl / puits et incuber à 37 ° C pendant 60 min. Analyser les dilutions du clone "surnageant pour tester l'affinité de l'anticorps, tels que 1/10 ou 1/100.
  7. Lavez comme cela se fait dans l'étape 6.3.
  8. Utilisez 50 pl / puits de chèvre F (ab) 2 anti-humain conjugué peroxydase IgG Fc diluée 1: 20.000 dans le tampon d'incubation. tampon d'incubation contient 1% de BSA et 0,02% de Tween 20 dans du PBS 1x. Incuber à 37 ° C pendant 60 min.
  9. Lavez comme cela se fait dans l'étape 6.3.
  10. Ajouter / solution bien substrat de 100 pi contenant 0,1% de 3,3 ', 5,5'-tétraméthylbenzidine (TMB). Incuber 10 min jusqu'à ce qu'un stables formes de couleur bleue dans les puits. Faites attention; ne pas attendre trop longtemps!
  11. Arrêter la réaction en ajoutant 50 ul de 2 MH 2 SO 4. Mesurer l'absorption à 450 nm, dans les 30 minutes après l'arrêt de la réaction.
    Remarque: l 'Tous les clonesupernatants avec 3 écarts-types sur le blanc seront considérés comme positifs pour les anticorps humains IgG. Pour confirmation des clones positifs ELISA ce doit être répétée au moins trois fois en différents surnageants de la même clone. Aussi pour écarter la possibilité d'une réactivité croisée non spécifique est recommandée pour assurer qu'il n'y a pas de signal lorsque les surnageants sont incubés dans des puits non revêtu mais bloquée. À cette étape, un test de détection pour le dépistage de la spécificité antigénique des anticorps d'intérêt peut être effectuée avant de procéder à l'article 7.

7. Isolement de l'ARN et First Strand cDNA Synthesis des producteurs IgG Clones

  1. Dès que la production de IgG est confirmée par ELISA, extraire l'ARN du clone.
  2. Pour extraire l'ARN à partir de cellules en croissance dans les étapes 5,7 ou 5,9, en utilisant le kit de cellules exposant III directe de synthèse d'ADNc, ce qui permet l'obtention d'ADN à partir de 10 000 cellules à une cellule.
  3. Pour extraire l'ARN à partir de larmontants ger de cellules, ou à partir de la pastille stockée à l'étape 5.11 utilisent le kit d'isolement d'ARN haute pur. D'autres systèmes d'extraction de l'ARN peuvent également convenir à cette étape. Suivez les instructions du fabricant.
  4. Pour les numéros de cellulaires entre 1 x 10 6 et 1 x 10 4 utilisation du système de transcription inverse, en suivant les instructions du fabricant. D'autres systèmes pour la synthèse d'ADNc premier brin peuvent également être utilisés.

8. 1 er et 2 ème PCR pour l'amplification de la chaînes lourdes et légères des productrices d'IgG clones de cellules B

  1. Avec l'ADNc des clones de cellules, obtenues à l'étape 5.6 et 5.7 et positif dans le test ELISA IgG à l'étape 6, effectuer une PCR avec les amorces énumérées dans le tableau 1.
  2. Mettre en place PCR indépendantes pour chaque lourd, kappa et lambda chaîne IgG. Faire une solution d'achat d'actions avec des amorces sens et antisens à des concentrations égales. Ajoutez-les à la réaction à 0,4 uM concentration finale. </ Li>
  3. Utiliser une pi de la synthèse d'ADNc pour effectuer la PCR 1 ST. Ici, effectuer 20 réactions ul en utilisant les instructions du fabricant Takara Taq. Vous pouvez également utiliser d'autres polymérases.
  4. Placer le 1 er PCR dans les conditions de cycle suivantes: 94 ° C pendant 5 min; (50 cycles de: 94 ° C pendant 30 sec, 58 ° C pendant 30 secondes et 72 ° C pendant 45 sec, 72 ° C pendant 7 min et laisser refroidir à 4 ° C.Include un blanc dans la réaction, à détecter les contaminations possibles.
  5. Préparer TBE 1x (89 mM de Tris-borate et 2 mM EDTA). Dans un volume de 100 ml de TBE 1x ajouter 1 g d'agarose (gel d'agarose à 1%). Chauffer la solution dans le micro-ondes pendant environ 1 min, jusqu'à ce que l'agarose se dissout. Ensuite, ajoutez 4 pi de 10 mg / ml de bromure d'éthidium (ou colorant d'ADN équivalent) et mélanger.
    1. Verser le contenu dans un bac et attendre obtient polymérisé. Exécuter 5 ul du mélange de PCR dans le gel pour visualiser les bandes. Fragment de chaîne lourdes devrait être autour de 400 à 550 pb, tandis que la chaîne légère devrait être autour de 300 - 400 pb. Si les bandes ne sont pas détectés, procédera de même à 2 ème PCR.
  6. Utilisez 1 pl de la première PCR mélanger pour effectuer la 2 ème PCR. Utilisez les mêmes réactifs que dans l'étape 8.2 mais en utilisant la combinaison appropriée d'amorces (voir tableau 1). Pour la 2 ème PCR utilisent les conditions suivantes: 94 ° C pendant 5 min; (50 cycles de: 94 ° C pendant 30 sec, 56,5 ° C pendant 30 s et 72 ° C pendant 55 s); 72 ° C pendant 7 min; laisser refroidir à 4 ° C. Inclure une découpe dans la réaction, afin de détecter les contaminations possibles de PCR.
  7. Préparer un gel d'agarose comme décrit dans 8.5. Exécutez le gel de visualiser le produit PCR comme dans 8.5.1 Utilisez les amplifications qui contiennent les fragments de bonne taille pour le clonage à l'étape 9 et produire les anticorps à l'étape 10.
  8. Séquence de l'ADN, en utilisant 10 ul réaction contenant: 100 ng de la 2 ème PCR, 0.2 uM de l'amorce ou de mélange d'amorce, 1 ul de la terminaison et une pi du tampon. Effectuer la réaction de séquençage dans ces conditions: (25 cycles de: 96 ° C pendant 10 s; 50 ° C pendant 5 s et à 60 ° C pendant 4 min); 60 ° C pendant 7 min; laisser refroidir à 4 ° C.
  9. Purifier les réactions de séquençage avec des colonnes G50 MicroSpin suivant les instructions du fabricant. Évaluer les séquences de la ligature dans un analyseur de séquence automatique 18 comme décrit précédemment. Electrophérogrammes doit être propre et correspondent à une séquence d'immunoglobuline unique.
    Remarque: Si les produits de PCR montrent séquences d'immunoglobuline imprécises ou mixtes, s'il vous plaît envisager de les cloner en utilisant le système TOPOTA, pour obtenir des séquences isolées, puis passez à l'étape 9.

9. Clonage et séquençage des chaînes lourdes et légères des clones produisant IgG

  1. Préparez 1 ug d'ADN de vecteurs pFUSE2ss-CLIG-hk, pFUSE2ss-CLIG-HL2 et pFUSEss-ChiG-hg1.
  2. Digérer ces vecteurs avec les enzymes de restriction appropriées. Utiliser Eco RI et Bsi WI pour pFUSE2ss-CLIG-hk, Eco RI et Avr II pour pFUSE2ss-CLIG-HL2, et Eco RI et Nhe I pour pFUSEss-ChiG-hg1. Utilisez 3 unités de chaque enzyme de restriction pour 1 ug d'ADN du vecteur.
    1. Digérer avec une enzyme et purifier le produit digéré avec un kit de purification PCR. Digérer avec la deuxième enzyme et de purifier avec un kit d'extraction sur gel (selon le protocole du fabricant). Couper le fragment d'intérêt à partir du gel d'agarose. Préparer gel d'agarose comme dans l'étape 8.5.
  3. Digérer les 2 ème PCR produits du clone IgG production: Eco RI et Bsi WI pour la chaîne kappa amplification, Eco RI et Avr II pour la chaîne lambda amplification, et Eco RI et Nhe I pour lourde amplification en chaîne. Digérer avec une enzyme et purifier le produit digéré avec un PPurification Kit CR. Digérer avec la deuxième enzyme et purifier le produit digéré avec un kit de purification PCR. Utiliser les mêmes unités d'enzymes et de la quantité d'ADN comme dans l'étape 9.2.
  4. Ligaturer les fragments PCR intérieur des vecteurs avec les recommandations de l'ADN ligase T4 16 ° CO / N suivants fabricant. Le rapport utilisé devrait être de 1: 2 (vecteur: insert).
  5. Utiliser une pi de la ligature pour transformer des bactéries DH5a. Suivez conditions DH5a fabricant »pour la transformation. Etaler les bactéries sur des plaques blasticidine ou la zéocine, en fonction du type de vecteur utilisé. Incuber les plaques O / N à 37 ° C.
  6. Poussent des colonies simples, et extraire l'ADN avec un kit de miniprep, suivant les instructions du fabricant ". Utilisez pour seule colonie grandir et extraction de l'ADN, les recommandations du fabricant du kit ADN miniprep. Analyser par digestion avec les enzymes utilisées pour la préparation des vecteurs et des inserts comme dans les étapes 9.2 et 9.3.
  7. Séquence de l'ADN, par using 100 ng du vecteur tel que réalisé dans les étapes 8,8 et 8,9.

10. Production d'anticorps dans des cellules HEK

  1. Cultiver des cellules HEK en milieu de Eagle modifié par Dulbecco (DMEM) supplémenté avec 10% de sérum de veau foetal, 1% de L-glucose, 1% de pénicilline / streptavidine (DMEM +) à une confluence de 75% dans une plaque de culture cellulaire de 150 mm. Effectuer dans une hotte étapes 10.01 à 10.07.
  2. Avant transfection, échanger le medium à medium comme avant, mais sans sérum de veau foetal.
  3. Pour chaque lourde, une chaîne légère transfection, préparer un mélange de transfection avec 2,5 ml de DMEM (sans sérum), 9 pg du vecteur avec la chaîne lourde, 6 pg du vecteur avec la chaîne légère, et 100 ul de polyéthylène-imine (PEI ) solution (à partir d'un 1 ug / ul stock). Incuber à température ambiante pendant 15 min.
  4. Ajouter délicatement 2,5 ml du mélange de transfection préparé à l'étape 10.3 aux cellules HEK dans la plaque. Balancer la plaque de distribuer de façon homogène.
  5. Danscubate les cellules dans l'incubateur à 37 ° C avec 5% de CO2 pendant 24 heures.
  6. Changer le milieu de culture à un milieu sans sérum de veau foetal.
  7. Recueillir le milieu des plaques 4 jours plus tard.
    Remarque: Les anticorps dans les milieux peuvent être utilisés pour caractériser leur réactivité in vitro et in vivo.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Le déclenchement de tri après coloration des cellules positives CD22 et IgG est montré à la figure 1 Dans cette image le domaine des cellules doubles positives -. Lymphocytes B producteurs d'anticorps IgG - est sélectionné pour trier tous ces cellules dans un tube séparé. Dans l'analyse, environ 1% du total des CMSP correspondent à cette population positive double. Le nombre de cellules triées obtenus dépendra du nombre de cellules obtenues à l'article 1.

Les différents résultats après 5 semaines de immortalisation par EBV et (CpG) ODN2006 stimuli sont présentés sur la figure 2 La détection des clones en croissance est facile. Cellules nourricières WI38 ont une forme plus allongée des fibroblastes, et les clones de cellules B apparaissent comme de très petites cellules rondes croissante cluster dans le milieu de la plaque ronde multi-puits à fond. A ce stade, il est évident que certains clones commencent à se développer. Cependant, la vitesse de croissance peut être variable et bien sûr certains des puits ContaiNing cellules immortalisées peuvent ne pas avoir toutes les cellules de croissance du tout.

Le surnageant de culture des clones est testée dans un test ELISA pour la détection des IgG comme indiqué dans le tableau 2. Dans cet ELISA une courbe d'étalonnage pour l'IgG est testé, avec le surnageant des clones et les flans. Un clone positif est considéré lorsque la valeur dans le test ELISA est plus de trois écarts-types à la valeur à blanc. Les valeurs négatives sont clones dans les trois écarts types de l'ébauche. Pour confirmation, les clones positifs doivent être positifs dans le test ELISA au moins trois fois en différents surnageants de la même clone et, si possible, vérifiée par un procédé de criblage supplémentaire.

La séquence complète d'un anticorps IgG humain obtenu en appliquant les étapes décrites dans ce manuscrit est représenté sur la Figure 3. Cette séquence a été obtenu après clonage de la paire de chaîne lourde d'immunoglobuline et lambda par clonage d'une cellule B expansé. Une variablend régions constantes de la chaîne lourde et légère peuvent être caractérisés avec cette technique. Après avoir obtenu les séquences, les séquences d'anticorps peuvent être clonées et produites in vitro dans des cultures de cellules HEK.

Figure 1
Figure 1. Flow analyse cytométrique de CD22 + et IgG + à partir de cellules mononucléaires périphériques humaines de sang. (A) Sélection de la population de cellules vivantes est montré dans P1. (B) diagramme de dispersion avant. (C) Taille nuage de points. (D) L'axe des Y montre les cellules séparées par anti-CD22-PerCP et sur l'axe des X séparés par des IgG-PE. place du P4 indique la fraction de cellule qui a été trié (CD22 +, + IgG) et récupéré pour la culture. S'il vous plaît cliquez ici pour voir une version plus grande de cette fifigure.

Figure 2
Figure 2. Représentant l'image de la cellule B immortalisé clones dans une plaque à 96 puits après 5 semaines de culture. (A) Dans ce puits ne immortalisation a été observée après 5 semaines, mais WI38 irradié cellules nourricières peut être observée. (B) Un clone à croissance lente a été observée dans ce puits, avec des petits ronds agrégats dans le milieu. (C) clone à croissance rapide montrant tour agrégats de cellules B immortalisées. S'il vous plaît, cliquez ici pour voir une version plus grande de cette figure.

Figure 3
Figure 3. séquences d'anticorps humains de paire chaîne lourde et de la lumière à partir d'un clone de cellules B humaines immortalisées, F50,2, indiquant V CDR1, CDR2 et CDR3. S'il vous plaît, cliquez ici pour voir une version plus grande de cette figure.

"> Λ
1 er amorces PCR
Forward (5'-3 ') Inverse (3'-5 ')
IgG 5 'L-VH 1 ACAGGTGCCCACTCCCAGGTGCAG 3 'Cy CH1 GGAAGGTGTGCACGCCGCTGGTC
5 'VH-L 3 AAGGTGTCCAGTGTGARGTGCAG
5 'L-VH 4/6 CCCAGATGGGTCCTGTCCCAGGTGCAG
5 'L-VH 5 CAAGGAGTCTGTTCCGAGGTGCAG
κ 5 'L 02/01 VK ATGAGGSTCCCYGCTCAGCTGCTGG 3 'CK 543 GTTTCTCGTAGTCTGCTTTGCTCA
5 '3 L VK CTCTTCCTCCTGCTACTCTGGCTCCCAG 3 'CK 494 GTGCTGTCCTTGCTGTCCTGCT
5 'L VK 4 ATTTCTCTGTTGCTCTGGATCTCTG
5 'Pan VK ATGACCCAGWCTCCABYCWCCCTG
λ 5 'L Vλ 1 GGTCCTGGGCCCAGTCTGTGCTG 3 'Cλ CACCAGTGTGGCCTTGTTGGCTTG
5 'L Vλ 2 GGTCCTGGGCCCAGTCTGCCCTG
5 'L Vλ 3 GCTCTGTGACCTCCTATGAGCTG
5 'L Vλ 4/5 GGTCTCTCTCSCAGCYTGTGCTG
5 'L Vλ 6 GTTCTTGGGCCAATTTTATGCTG
5 'L Vλ 7 GGTCCAATTCYCAGGCTGTGGTG
5'L Vλ 8 GAGTGGATTCTCAGACTGTGGTG
2 ème amorces PCR
Forward (5'-3 ') Inverse (3'-5 ')
IgH 5 'EcoRI VH1 CAACCGGAATTCGCAGGTGCAGCTGG
TGCAG
3 'Nhel JH 1,2,4,5 CTGCTAGCTAGCTGAGGAGACGGT
GACCAG
5 'EcoRI à VH1 5 CAACCGGAATTCAGAGGTGCAGCTG
GTGCAG
3 'Nhel JH 3 CTGCTAGCTAGCTGAGAGACGGTGA
CCATTG
5 'EcoRI VH3 CAACCGGAATTCAGAGGTGCAGCTG
GTGGAG
3 'Nhel JH 6 CTGCTAGCTAGCTGAGGAGACGGTG
ACCGTG
5 'EcoRI 23 VH3 CAACCGGAATTCAGAGGTGCAGCT
GTTGGAG
5 'EcoRI VH4 CAACCGGAATTCACAGGTGCAGCT
GCAGGAG
5 'EcoRI VH 34 4 CAACCGGAATTCACAGGTGCAGCTAC
AGCAGTG
5 'EcoRI VH 1 18 CTTCCGGAATTCACAGGTTCAGCT
GGTGCAG
5 'EcoRI VH 1 24 CTTCCGGAATTCACAGGTCCAGCT
GGTACAG
5 'EcoRI 33 VH3 CTTCCGGAATTCACAGGTGCAGCT
GGTGGAG
5 '3 9 EcoRIVH GATCCGGAATTCAGAAGTGCAGCT
GGTGGAG
5 'EcoRI VH4 39 GATCCGGAATTCACAGCTGCAGCT
GCAGGAG
5 'EcoRI VH 6 1 GATCCGGAATTCACAGGTACAGCT
GCAGCAG
κ 5 'EcoRI VK 1 5 CAACCGGAATTCAGACATCCAGATGA
CCCAGTC
3 'BsiWI JK 1-4 GCCACCGTACGTTTGATYTCCACCTTGGTC
5 'EcoR1 VK 1 9 CTTCCGGAATTCAGACATCCAGTTGAC
CCAGTCT
3 'Jk BsiWI 2 GCCACCGTACG TTTGATCTCCAG
CTTGGTC
5 'EcoR1 VK 1D 43 CTTGGCGAATTCAGCCATCCGGATGA
CCCAGTC
3 'BsiWI Jk 3 GCCACCGTACGTTTGATATCCACT
TTGGTC
5 'EcoR1 VK 2 24 CTTCCGGAATTCAGATATTGTGATGA
CCCAGAC
5 'EcoR1 VK 2 28 CTTCCGGAATTCAGATATTGTGATG
ACTCAGTC
5 'EcoR1 VK 2 30 CTTCCGGAATTCAGATGTTGTGATGA
CTCAGTC
5 '3 11 EcoR1 VK CTTCCGGAATTCAGAAATTGTGTTG
ACACAGTC
5 '3 15 EcoR1 VK CTTCCGGAATTCAGAAATAGTGATG
ACGCAGTC
5 '3 20 EcoR1 VK CTTCCGGAATTCAGAAATTGTGTTGA
CGCAGTCT
5 'EcoR1 VK 4 1 CTTCCGGAATTCAGACATCGTGATG
ACCCAGTC
5 'EcoR1 Vλ une CTTCCGGAATTCACAGTCTGTGCT
GACKCAG
3 'AvrII Jλ 1 à 3 CTGGTTACCTAGGAGGACGGTSACCT
TGGTCCC
5 'EcoR1 Vλ 2 CTTCCGGAATTCACAGTCTGCCC
TGACTCAG
3 '4 AvrII Jλ CTGGTTACCTAGGAAAATGATCAGC
TGGGTTCC
5 '3 EcoR1 Vλ CTTCCGGAATTCATCCTATGAGC
TGACWCAG
3 '5 AvrII Jλ CTGGTTACCTAGGAGGACGGTCAGC
TCGGTCCC
5 'EcoR1 Vλ 4 à 5 CTTCCGGAATTCACAGCYTGTG
CTGACTCA
3 '6 AvrII Jλ CTGGTTACCTAGGAGGACGGTCAGCT
GGGTGCC
5 '6 EcoR1 Vλ CTTCCGGAATTCAAATTTTATGC
TGACTCAG
3 'AvrII Jλ 7 CTGGTTACCTAGGAGGACGGTCAC
TTGGTCCAT
5 'EcoR1 Vλ 7 à 8 CTTCCGGAATTCACAGRCTGTG
GTGACYCAG
»> Tableau 1. amorces utilisées.

EFT "> 0,080
1 2 3 4 5 6 7 8 9 10 11 12
UNE 0,076 0,077 2.003 0,080 0,138 0,102 0,188 0,338 0,040 2.041 0,051 0,081
B 2.011 0,085 0,074 0,069 0,081 0,122 0,372 2.133 0,119 0,097 0,072 0,072
C 0,068 0,179 0,091 0,073 0,077 0,097 0,606 1.882 0,081 2.071 0,094 0,075
0,063 0,070 0,065 0,071 0,082 2.071 0,339 2.089 0,076 0,086 0,066 0,069
E 1.921 0,077 0,065 0,085 0,095 1.968 1.910 0,122 0,072 0,070 0,065 0,066
F 0,113 0,068 0,066 0,082 0,088 0,090 0,460 0,070 0,079 0,952 0,098 0,065
G 2.041 2.108 1.472 0,665 0,331 0,194 0,123 0,094 0,072 0,070 0,072
H 2.146 2.132 1.634 0,665 0,341 0,178 0,132 0,094 0,082 0,080 0,074 0,068
Normes ng / pl 1000 500 250 125 62,5 31.25 15,6 7.8 3.9 1.95 0,975 0

Tableau 2. Les résultats représentatifs de dépistage IgG par ELISA. Clone surnageants sont en A1-A10, B1-B10, C1-C10, D1-D10, E1-E10, F1-F10. Blanks sont en A11, B11, C11, D11, E11, F11, A12, B12, C12, D12, E12, courbe de F12.Standard est dupliqué: G1-G12 et H1-H12. La concentration d'immunoglobulines correspondant dans chaque exemplaire est représenté below.Positive ou IgG clones producteurs sont représentés en gris foncé. Clones produisant négatifs ou non-IgG sont présentés en gris clair

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Dans ce manuscrit, toutes les étapes de la production d'anticorps IgG à partir de PBMC humaines sont présentés en détail. Ce protocole comprend certains avantages par rapport aux techniques déjà publiés. L'un des avantages est que l'anticorps produit conserve les chaînes lourdes et légères correspondant à la paire initiale dans le clone de cellule B. L'identification des anticorps IgG peut être effectué dans tout type de donneur humain, et il n'y a pas besoin d'exacerbation de la réponse immunitaire due à la vaccination 5. L'utilisation de la WI38 lignée cellulaire de fibroblastes en tant que cellules nourricières, permet une détection plus rapide des clones en croissance, étant donné qu'ils sont morphologiquement différents et très facile à distinguer, par rapport aux PBMC servant de cellules nourricières en précédemment décrit fonctionne 1,6- 8. En outre, l'utilisation de WI38 comme cellules nourricières favorise la congélation de grandes quantités d'aliquotes de cellules qui peuvent être facilement cultivées et décongelés avant chaque expérience.

L'un des critiCal étapes de ce protocole est le matériau de départ: la CMSP. Si le sang a été en attente trop longue pour la centrifugation, soit après l'extraction du PBMC, ils ne sont pas stockés dans les conditions de gel appropriés; en tant que tel le nombre de cellules viables est réduit, en même temps que le numéro de la IgG de cellule B produisant des clones obtenus. Pour cette raison, une extraction précoce et une bonne préservation de la CMSP sont recommandés pour un résultat positif. Le nombre de clones produisant des IgG sera limité au nombre de PBMC au début de l'expérience. Un nombre plus élevé de CMSP donneront un plus grand nombre de clones produisant IgG et une production d'anticorps diversifiée. Une autre étape critique est le clonage des fragments de PCR de chaînes légères et lourdes de l'anticorps. Si la ligature ne réussit pas après plusieurs tentatives, une étape supplémentaire de clonage du produit de PCR 2 ème dans un système TOPOTA est recommandé. La digestion de l'insert avec les enzymes appropriées peut être plus facileTOPOTA dans le vecteur, pour une ligature ultérieure dans les vecteurs d'expression pFUSEss.

Cette technique peut être transféré à tout type de tissu humain dans lequel des cellules B humaines sont enrichies 3. Il peut également être appliqué à l'étude d'autres types d'immunoglobulines, en changeant simplement les anticorps marqués utilisés pour le tri (anticorps contre IgM, IgE, IgA ou IgD), la conception d'amorces pour la PCR, et les vecteurs exprimant. Les études de ces immunoglobulines peuvent être d'intérêt pour comprendre la réponse immunitaire initiale, un anticorps de sécrétion muqueuse et des profils d'allergie, entre autres.

En conclusion, nous avons décrit une technique pour produire des anticorps monoclonaux recombinants humains IgG qui laisse les chaînes lourdes et légères paires de l'immunoglobuline humaine intacte. La technique est utile et facile à réaliser à partir d'un échantillon de sang. Les anticorps monoclonaux obtenus par ce procédé sont potentiellement utiles dans des études sur immunitaire humainréponses. En outre, les anticorps monoclonaux produits avec cette méthode pourrait être un bon point de départ pour le développement d'immuno-thérapeutiques pour différentes conditions pathologiques.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs déclarent qu'ils ont aucun intérêt financier concurrentes.

Acknowledgments

Contrat de recherche Miguel Servet (ISCIII CD14 / 00032) à (GN-G.). Bourse de l'Organisation néerlandaise pour la recherche "Graduate School of Neuroscience Program translationnelle" scientifique (022005019) à (CH).

Les subventions du Fonds Prinses Beatrix (Projet WAR08-12) et l'Association Française contre les Myopathies à (PM-M.); ainsi que par un Veni Communauté de l'Organisation néerlandaise pour la recherche scientifique (916.10.148) une bourse de la Fondation du cerveau des Pays-Bas (FS2008 (1) -28) et le Prinses Beatrix Fonds (Projet WAR08-12) (à ML ).

Nous remercions Jozien Jaspers pour son aide dans le B-tri cellulaire par cytométrie de flux.

Materials

Name Company Catalog Number Comments
Histopaque-1077  Sigma-Aldrich 10771 solution containing polysucrose and sodium diatrizoate
FACSAria II cell sorter  BD Biosciences 
96 U-bottom micro well plates  Costar 3799
Advanced Roswell Park Memorial Institute (RPMI) 1640 medium  Gibco, Life Technologies 12633-020
30% v/v EBV-containing supernatant of the B95-8 cell line   ATCC CRL-1612 3.4 x 108 copies/ml
CpG2006  Invivogen ODN 7909
Wi38 cells  Sigma-Aldrich 90020107
Interleukin-2 Roche  10799068001
ELISA plates Greiner Bio-One, Microlon 655092
AffiniPure F(ab')2 Fragment Goat Anti-Human IgG, Fcγ Fragment Specific (unconjugated) Jackson ImmunoResearch 109-006-008
4% non-fat dry milk (Blotting Grade Blocker)  Biorad 170-6404
Human IgG  Sigma I 2511 HUMAN IgG purified Immunoglobulin, 5.6 mg/ml
Goat F(ab)2 antihuman IgG Fcγ (conjugated with peroxidase (PO)) Jackson ImmunoResearch 109-036-008
ELISA reader (Perkin Elmer 2030)  Perkin Elmer  2030-0050
Peroxidase-conjugated AffiniPure Rabbit Anti-Human IgM, Fc5µ  Jackson ImmunoResearch 309-035-095
SuperScript III Cells Direct cDNA Synthesis System  Invitrogen  18080-200
Applied Biosystems (ABI) GeneAm PCR System 2700 Applied Biosystems
High Pure RNA Isolation Kit  Roche 11828665001
Reverse transcription system kit  Promega A3500
Recombinant Taq DNA Polymerase TAKARA R001A
Primers (2 μl) Sigma
Ultrapure Agarose  Invitrogen 16500-500
100 bp ladder Invitrogen 15628-019
Quantity One 4.5.2 (Gel Doc 2000) Biorad 170-8100
QIAquick PCR purification kit QIAGEN 28106
BigDye Terminator v3.1 cycle sequencing kit  Applied Biosystems 4337455
0.1 ml reaction plate (MicroAMP Optical 96-well) Applied Biosystems 4346906
Genetic analyser ABI300  Applied Biosystems 4346906
DH5α competent cells (E. coli) Invitrogen 18263-012
pFUSEss-CHIg-hG1 (4,493 bp) Invivogen pfusess-hchg1
pFUSEss-CHIg-hG4 (4,484 bp)  Invivogen pfusess-hchg4
pFUSE2ss-CLIg-hk (3,875 bp) Invivogen pfuse2ss-hclk
pFUSE2ss-CLIg-hl2 (3,883 bp)  Invivogen pfuse2ss-hcll2
SOC medium Invitrogen 15544-034
LB-based agar medium supplemented with Zeocin (Fast-Media Zeo Agar) Invivogen fas-zn-s
Terrific Broth (TB)-based liquid medium supplemented with Zeocin (Fast-Media Zeo TB) Invivogen fas-zn-l
DNA Miniprep kit  Omega Bio Technology D6942-02
Nanodrop (ND1000 Spectrophotometer) Nanodrop
LB-based agar medium supplemented with Blasticidin (Fast-Media Blast Agar) Invivogen fas-bl-s
Terrific Broth (TB)-based liquid medium supplemented with Blasticidin (Fast-Media Blast TB) Invivogen fas-bl-l
EcoRI New England Biolabs R0101S 20,000 U/ml, in 10x NEBuffer EcoRI
NheI New England Biolabs R0131S 10,000 U/ml, in 10x NEBuffer 2.1
2-Log DNA ladder New England Biolabs N3200S 0.1-10.0 kb, 1,000 μg/ml
XmaI New England Biolabs R0180S 10,000 U/ml, in 10x CutSmart Buffer 
BsiWI New England Biolabs R0553S 10,000 U/ml, in 10x NEBuffer 3.1
AvrII New England Biolabs R0174S 5,000 U/ml, in 10x CutSmart Buffer 
FastAP Thermosensitive Alkaline Phosphatase Thermo Scientific EF0651 1 U/µl, in 10x FastAP Buffer
DH5α competent cells  Invitrogen 18263-012
PE Mouse Anti-Human IgG BD Pharmingen 555787
anti-CD22, PerCP-Cy5.5, Clone: HIB22 Fisher scientific BDB563942
QIAprep Spin Miniprep Kit  QIAGEN 27106
BigDye Terminator v3.1 Applied Biosystems 4337455

DOWNLOAD MATERIALS LIST

References

  1. Vrolix, K., et al. Clonal heterogeneity of thymic B cells from early-onset myasthenia gravis patients with antibodies against the acetylcholine receptor. J Autoimmun. 52, 101-112 (2014).
  2. Yamashita, M., Katakura, Y., Shirahata, S. Recent advances in the generation of human monoclonal antibody. Cytotechnology. 55, (2-3), 55-60 (2007).
  3. Pereira, K. M., Dellavance, A., Andrade, L. E. The challenge of identification of autoantibodies specific to systemic autoimmune rheumatic diseases in high throughput operation: Proposal of reliable and feasible strategies. Clin Chim Acta. 437, 403-410 (2014).
  4. Losen, M., et al. Treatment of myasthenia gravis by preventing acetylcholine receptor modulation. Ann N Y Acad Sci. 1132, 174-179 (2008).
  5. Smith, K., et al. Rapid generation of fully human monoclonal antibodies specific to a vaccinating antigen. Nat Protoc. 4, (3), 372-384 (2009).
  6. Fraussen, J., et al. A novel method for making human monoclonal antibodies. J Autoimmun. 35, (2), 130-134 (2010).
  7. Traggiai, E., et al. An efficient method to make human monoclonal antibodies from memory B cells: potent neutralization of SARS coronavirus. Nat Med. 10, (8), 871-875 (2004).
  8. Fraussen, J., et al. Autoantigen induced clonal expansion in immortalized B cells from the peripheral blood of multiple sclerosis patients. J Neuroimmunol. 261, (1-2), 98-107 (2013).
  9. Yamashita, M., et al. Different individual immune responses elicited by in vitro immunization. Cytotechnology. 40, (1-3), 161-165 (2002).
  10. Hui-Yuen, J., Koganti, S., Bhaduri-McIntosh, S. Human B cell immortalization for monoclonal antibody production. Methods Mol Biol. 1131, 183-189 (2014).
  11. Tiller, T., et al. Efficient generation of monoclonal antibodies from single human B cells by single cell RT-PCR and expression vector cloning. J Immunol Methods. 329, (1-2), 112-124 (2008).
  12. Lanzavecchia, A., Corti, D., Sallusto, F. Human monoclonal antibodies by immortalization of memory B cells. Curr Opin Biotechnol. 18, (6), 523-528 (2007).
  13. Traggiai, E. Immortalization of human B cells: analysis of B cell repertoire and production of human monoclonal antibodies. Methods Mol Biol. 901, 161-170 (2012).
  14. Strober, W., et al. Monitoring cell growth. Curr Protoc Immunol / edited by. John E. Coligan ... [et al.]. Appendix 3, Appendix 3A (2001).
  15. Ibrahim, S. F., van den Engh, G. Flow cytometry and cell sorting. Adv Biochem Eng Biotechnol. 106, 19-39 (2007).
  16. Leith, J. T., Padfield, G., Faulkner, L. E., Quinn, P., Michelson, S. Effects of feeder cells on the X-ray sensitivity of human colon cancer cells. Radiother Oncol. 21, (1), 53-59 (1991).
  17. Hui-Yuen, J., McAllister, S., Koganti, S., Hill, E., Bhaduri-McIntosh, S. Establishment of Epstein-Barr virus growth-transformed lymphoblastoid cell lines. J Vis Exp. (57), 3321 (2011).
  18. Smith, L. M., et al. Fluorescence detection in automated DNA sequence analysis. Nature. 321, (6071), 674-679 (1986).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics