Inductie van mesenchymale-epitheliale Transities sarcoomcellen

JoVE Journal
Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

ERRATUM NOTICE

Summary

We presenteren hier een celkweek werkwijze voor het induceren mesenchymale-epitheliale overgangen (MET) sarcoom cellen op basis van gecombineerde ectopische expressie van microRNA-200 familieleden en grainyhead-achtig 2 (GRHL2). Deze methode is geschikt voor een beter begrip van de biologische gevolgen van de fenotypische plasticiteit in de agressiviteit van kanker en behandelingen.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Ware, K. E., Gilja, S., Xu, S., Shetler, S., Jolly, M. K., Wang, X., Bartholf Dewitt, S., Hish, A. J., Jordan, S., Eward, W., Levine, H., Armstrong, A. J., Somarelli, J. A. Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. J. Vis. Exp. (122), e55520, doi:10.3791/55520 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Fenotypische plasticiteit verwijst naar een fenomeen waarin cellen transiënt trekken van een lijn krijgen. Tijdens carcinoom progressie, fenotypische plasticiteit drijft invasie, verspreiding en metastase. Inderdaad, terwijl de meeste van de studies van fenotypische plasticiteit in het kader van epitheliale carcinomen afkomstig zijn, blijkt sarcomen, die mesenchymale oorsprong zijn, ook fenotypische plasticiteit vertonen, met een subset van sarcomen een verschijnsel dat lijkt mesenchymal- ondergaan epitheliale transitie (MET). Hier hebben we een werkwijze omvattende de miR-200-familie en grainyhead als 2 (GRHL2) deze MET-achtige fenomeen waargenomen sarcoom patiënten samples.We achtereenvolgens tot expressie GRHL2 en miR-200 familie die cel transductie en transfectie nabootsen respectievelijk , beter inzicht in de moleculaire onderbouwing van deze fenotypische overgangen in sarcoma cellen. Sarcoma cellen die miR-200s en GRHL2 aangetoond verbeterde epitheliale characteristics in cel morfologie en verandering van epitheliale en mesenchymale biomarkers. Toekomstige studies met behulp van deze methoden kunnen worden gebruikt om beter inzicht in de fenotypische gevolgen van de MET-achtige processen op sarcoma cellen, zoals migratie, invasie, metastatische neiging, en therapie weerstand.

Introduction

Fenotypische plasticiteit heeft betrekking op een reversibele overgang tussen cellulaire fenotypes en wordt gewoonlijk verdeeld in twee types, epitheliale naar mesenchymale (EMT) overgangen en mesenchymale tot epitheliale overgangen (MET). Deze fenotypische plasticiteit speelt een belangrijke rol in de normale processen van meercellige organismen, zoals de ontwikkeling en wondgenezing 1; echter kan deze zelfde paden en genexpressie programma ook leiden tot ziekten zoals fibrose (samengevat in 2, 3, 4) en carcinoom metastase (samengevat in referenties 5, 6, 7, 8). Tijdens metastase, bijvoorbeeld EMT verstoort celpolariteit, cel-cel interacties en bevordert invasie 9, 10. Samen EMT bijdragens om een ​​fenotypische staat die kankercel verspreiding vergemakkelijkt. Bovendien, EMT leidt ook tot een aantal andere fenotypische veranderingen die een agressieve fenotype trekken, inclusief deregulering van kankercel metabolisme 6, ontwikkeling van geneesmiddelresistentie 11, 12, verhoogde tumor-initiatie vermogen 13, 14 en gastheer immuunontwijking 15.

Fenotypische plasticiteit is goed onderzocht in carcinoom progressie; Maar ook sarcomen fenotypische plasticiteit vertonen. Interessant, lijkt het alsof een aantal van dezelfde drijfveren van fenotypische plasticiteit in carcinomen ook bijdragen aan sarcoom plasticiteit en agressiviteit. Zo zijn circulerende tumorcellen (CTCs) vanaf sarcoom patiënten aangetoond dat EpCAM, een celoppervlakte-eiwit dat gewoonlijk wordt gevonden op epitheelcellen 16 expressie brengen. Additioneel werd 250 wekedelensarcoom monsters geclassificeerd als epitheel-achtige of mesenchymale-achtige basis van genexpressie. Patiënten in de epitheliale-achtige biomarker handtekening had een betere prognose dan patiënten met de mesenchymale-achtige biomarker handtekening 17. Dit is consistent met vele carcinomen, waarbij patiënten met meer epitheel-achtige carcinomen hebben betere resultaten in vergelijking met patiënten met meer mesenchymale-achtige tumoren 18.

Terwijl sommige sarcomen geven biomerkers en genexpressie paden in overeenstemming met BMO blijven de moleculaire onderbouwing van deze fenotypische plasticiteit slecht begrepen. Om de mechanismen en bestuurders van BMO in sarcoma bestuderen we een model ontwikkeld van BMO inductie met behulp van twee epitheliale-specifieke factoren, de microRNA (MIR) -200 familie en grainyhead-achtige 2 (GRHL2). De miR-200S zijn een familie van kleine niet-coderende RNAs die genexpressie reguleren door te binden aan de 3' UTR van messenger RNA en verhinderen translatie in eiwit. Het miR-200 familie bestaat uit twee subgroepen - een met miR-141 en miR-200a en de andere met inbegrip van miR-200b, miR-200c en miR-429. Familieleden miR-200 verrijkt in epitheliale weefsels, en het verlies van miR-200s is geassocieerd met metastase in carcinomen 19. De familie miR-200 ook omlaag gereguleerd in zacht weefsel sarcomen in vergelijking met normaal weefsel 20. Net als bij de miR-200S, GRHL2 is een belangrijke regulator die belangrijk is voor epitheliale ontwikkeling 21. De GRHL2 transcriptiefactor fungeert op twee manieren epitheliale genen, zoals E-cadherine upregulate: 1) in epitheelcellen, GRHL2 direct onderdrukt de EMT hoofdregelaar, ZEB1 22; en 2) GRHL2 direct activeert transcriptie van genen epitheliale 23. Onze eerdere onderzoekingen hebben aangetoond dat de gecombineerde expressie van miR-200s en GRHL2 in sarcoomcelleninduceert een MET-fenotype 24. Hier presenteren we een gedetailleerd protocol voor een in vitro model van MET inductie in sarcoomcellen via ectopische expressie van miR-200s en GRHL2 creëren.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Bereiding van reagentia

  1. Bereid DMEM gedurende celkweek door toevoeging van 50 ml foetaal runderserum (FBS) en 5 ml penicilline-streptomycine (5000 U / ml) en 500 ml DMEM. Dit medium kan voor maximaal zes maanden worden bewaard bij 4 ° C.
  2. Resuspendeer gevriesdroogde primers in nuclease-vrij water tot een eindconcentratie van 10 uM. WINKEL hersuspendeerd primers bij -20 ° C.
  3. Bereid radioimmunoprecipitatietest (RIPA) buffer (150 mM NaCl, 0,5% natriumdeoxycholaat, 0,1% SDS, 50 mM Tris, pH 8,0). Aanvullen met proteaseremmer cocktail voor het gebruik en bewaar buffer op ijs tijdens het gebruik. Bewaren bij 4 ° C.
  4. Bereid 10 mg / ml polybreen (hexadimethrinebromide) in water en spuitfilter te steriliseren met behulp van een 0,45 um filter polyethersulfon. Oplossing kan voor maximaal zes maanden worden bewaard bij 4 ° C.
  5. Maak een 1 mg / ml werkoplossing uit nitro blue tetrazolium chloride door oplossen van 10 mg in 10 ml PBS. Bewaren bij 4 ° C.

2. Lentiviral Transductie van GRHL2

Dag 1

  1. Plaat 3 x 10 5 HEK293T-cellen per putje van een 6-well plaat in 2 ml DMEM aangevuld. Kwantificeren cellen met behulp van een geautomatiseerde celteller. 60% confluent na overnacht kweken bij 37 ° C met 5% CO2 - cellen moeten 40 zijn.

Dag 2

  1. Verdun 2 ug lege vector (pCMV-UBC-EGFP) of 2 ug pCMV-GRHL2-UBC-EGFP 24, 25 in 200 ul serumvrij medium met 1,8 ug pΔ8.9 en 0,2 ug pCMV-VSV G helper plasmiden. In een afzonderlijke buis, verdunde 4 pi van een lipide-gebaseerde transfectie reagens in 200 ul serumvrij medium per transfectie (8 pl in 400 pl van twee monsters). Voeg 200 ul van transfectiereagens mengsel aan elk plasmide-oplossing en incubeer gedurende 20 minuten bij kamertemperatuur geroerd.
  2. Tijdens de incubatie, wassen HEK293T-cellen door het verwijderen van het medium door afzuigen in vacuo en spoelen cellen met 1 ml PBS. Vervang de PBS met 800 pl van serum-vrije media. Na 20 minuten, voeg 200 ul transfectiereagens: plasmide mengsel van stap 2.2 druppelsgewijs aan elk putje en incubeer cellen gedurende 2 uur bij 37 ° C in 5% CO2.
  3. Verwijder voorzichtig transfectie medium door afzuigen in vacuo en vervangen door 2 ml DMEM aangevuld. Terugkeer van de cellen naar de incubator voor overnachting cultuur.
    LET OP: HEK293T cellen zijn losjes aanhanger. Medium vervangen dient voorzichtig te gebeuren om het verwijderen van cellen beperken van de bodem van de schaal of kolf.

Dag 3

  1. Refresh media getransfecteerde HEK293T-cellen en de plaat 3 x 10 5 RD-cellen per putje van een 6-well plaat in 2 ml DMEM aangevuld. Kweekcellen 's nachts. RD-cellen zijn een in de handel verkrijgbare humane rhabdomyosarcoom cellijn.

dag 4

  • Verzamelen viraal materiaal uit HEK293T-cellen. Pipetteer de DMEM medium van HEK293T-cellen en plaats in een nieuwe 15 ml conische. Plaats voorzichtig met nieuwe DMEM media en plaats HEK293T cellen terug in de incubator voor de volgende dag.
  • Voeg 2 pi van 10 mg / ml polybreen per ml virale media in twee nieuwe 50 ml conische buizen (een voor de lege vector transfectie en andere voor het GRHL2 transfectie). Spuitfilter virale media door verwijdering van de plunjer van een 3 ml spuit en bevestig een 0,45 urn filter om polyethersulfon de punt.
    1. Voeg de virale media verzameld in stap 2.6 in de cilinder van de injectiespuit, en duik media in de nieuwe 50 ml conische buisjes met polybreen. Verwijder media uit RD-cellen door vacuümaspiratie toevoegen gefiltreerd virale media RD-cellen.
  • dag 5

    1. Herhaal Dag 4. HEK293T cellen kunnen worden weggegooid na de virale media is verzameld.

    dag 7

    1. RD wassen cellen met 1 ml PBS en voeg 200 ul van 0,05% trypsine per putje. Incubeer bij 37 ° C gedurende 5 min, voeg 2 ml aangevulde media en verplaatsen celsuspensie om een ​​nieuwe 15 ml conische. Centrifugeer cellen bij 250 xg gedurende 5 minuten bij kamertemperatuur en zuig media. Resuspendeer in 1 ml DMEM (aangevuld met 5% FBS en 1% penicilline-streptomycine).
      LET OP: Het gebruik van een hoger percentage van FBS kan verstopping tijdens flowcytometrie veroorzaken
      1. Filter cellen voor flowcytometrie. Gebruik een pipet om de RD 1 ml celsuspensie toepassing door een 30 urn filter in flowcytometrie buizen en pijpen plaats op ijs.
      2. Sorteren EGFP + cellen 26 in 1,5 ml microcentrifuge buisjes die 0,5 ml DMEM aangevuld met 10% FBS en 1% penicilline-streptomycine en plaats op ijs. Plaat EGFP + gesorteerde cellen in totaal van 1 ml DMEM aangevuld in een enkel putje van een 12 putjesplaat en plaats in de incubator gedurende kweek.
        Noot: De opbrengst van EGFP + cellen van stromingscytometrie daarna transductie gewoonlijk laag (50.000-100.000 cellen). Cellen moeten worden gekweekt gedurende 10-14 dagen alvorens tot stap 3.

    3. Reverse Transfectie van miR-200s

    1. Bereid 50 uM voorraden miR-200 bootst behulp nuclease-vrij H2O Aliquot bestanden en bewaar bij -20 ° C om herhaalde vries / ontdooi cycli te voorkomen.
    2. Voeg 3 ul van elk 50 uM miR-200 mimic (miR-200a, miR-200b en miR-200c) aan 300 ui serumvrije media of 9 pl 50 pM negatieve controle miRNA 300 ul serumvrij medium.
    3. Voeg 6 ul van siRNA-specifieke transfectiereagens tot 600 gl serumvrij medium en verdeel 300 pi van dit mengsel in twee buizen, één voor elk van de twee miR mengsels uit stap 3.2. Combineer de 300 pi van elk miR mengsel van stap 3.2 met een mengsel van 300 gl transfectiereagens. Incubeer gedurende 20 minuten bij kamertemperatuur temperature.
    4. Gedurende incubatie Bereid een celsuspensie van 600.000 EGFP + RD-cellen die LW of GRHL2 die in paragraaf 2 in 2,4 ml (250 cellen / pl) serum-vrij medium per behandeling.
    5. In een plaat met 24 putjes, 100 ul per putje van miR-200 mix of negatieve controle mengsel uit stap 3.3 in zes putjes en voeg 400 ul van elke celsuspensie in drie putjes van elke miR mix.
    6. Incubeer cellen bij 37 ° C in 5% CO2 gedurende de nacht en materiaaltype volledig DMEM gesupplementeerd de volgende dag. Verzamel cellen 2 dagen later te analyseren met de geschikte buffer (zie hieronder). Time-lapse imaging van RD sarcoma cellen die BMO is beschikbaar als aanvullend materiaal. Afbeelding elk putje om de 2 uur met een 10x objectief met behulp van een geautomatiseerd levende cellen imager 27.

    4. RNA-extractie, reverse transcriptie en qPCR

    1. Extract RNA volgens de instructies van de fabrikant onder gebruikmaking van een standaard-RNAextractiekit 24. Geëxtraheerd RNA kan worden opgeslagen bij -80 ° C.
    2. Kwantificeren RNA-concentratie. Ontdooien en werken met RNA op ijs. RNA concentraties kwantificeren meten UV absorptie bij 260 nm met een plaatlezer spectrofotometer volgens het protocol van de fabrikant. Alle monsters verdund tot de laagste concentratie met nuclease-vrij water.
    3. Voeren reverse transcriptie van totaal RNA in complementair DNA (cDNA). Combineer liefst 100 ng totaal RNA met PCR buffer, dNTP mix (100 mM), willekeurig hexameer primers, reverse transcriptase en nuclease-vrij water in een 20 gl reactievolume 24. RT werking cycli volgens het protocol van de fabrikant. cDNA kan worden opgeslagen op lange termijn bij -20 ° C.
    4. Verdun 20 pi reacties 100 ul 80 ul nuclease-vrij H2O
    5. Meng 5 pi van een op fluorescentie gebaseerde intercalerende kleurstof 2x qPCR hoofdmengsel, 0,06 pl van elk 10 uM primer, eennd 2 pl verdunde RT-reactie per monster.
    6. Run qPCR volgens het protocol van de fabrikant voor de op fluorescentie gebaseerde master mix.
    7. Kwantificeren relatieve hoeveelheden van mRNA door delta CT methode en normaliseren GAPDH. Plot van de gemiddelde mRNA-expressie van biologische replica ± standaardafwijking voor elke behandelingsgroep.
      LET OP: Speciale voorzorgsmaatregelen moeten worden genomen bij het werken met RNA om contact met RNases, zoals het gebruik van RNasevrije kunststoffen en reagentia te voorkomen. Non-wegwerpmateriaal moeten worden behandeld voor gebruik om RNases verwijderen.

    5. Immunofluorescentie kleuring

    1. Na stap 3.6, afgezogen medium door afzuigen in vacuo uit RD-cellen in 24 putjes format.
    2. Fix cellen door toevoeging van 500 pl 4% paraformaldehyde (PFA) per putje en incubeer gedurende 15 minuten bij kamertemperatuur (RT). Na het fixeren plaats cellen in met fosfaat gebufferde zoutoplossing (PBS) en bewaar bij 4 ° C gedurende de nacht indien nodig.
    3. permeabilizecellen door toevoeging van 500 pi PBS + 0,2% Triton-X100 en incubeer 30 minuten bij kamertemperatuur. Door vacuümaspiratie, verwijdert permeabilisatie buffer en was driemaal met PBS.
    4. Blok in 500 ui 5% runderserumalbumine (BSA) / PBS en incubeer cellen gedurende 30 minuten bij kamertemperatuur. Cellen kunnen een nacht eventueel worden bewaard bij 4 ° C.
    5. Bereid primaire antilichaam verdunning. Pipetteer 200 ul 5% BSA / PBS per putje in een 15 ml conische (12 wells = 2,4 ml) en voeg 1 ul van primair antilichaam per ml 5% BSA / PBS nodig. Verwijderen blokkerende buffer door afzuigen in vacuo en afzien 200 pl verdund primair antilichaam aan elk putje.
      1. Incubeer cellen in 1: 1000 verdunde primaire antilichamen in 5% BSA / PBS gedurende 1 uur bij kamertemperatuur of overnacht bij 4 ° C. Na incubatie tweemaal wassen cellen met PBS.
    6. Bereid het secundaire antilichaam verdunning in hetzelfde volume van 5% BSA / PBS zoals hierboven. Voeg de ver-rode kleurstof-geconjugeerd secundair antilichaam met behulp van een 1: 2000 verdunning. Bovendien voegen1 ug / ml Hoechst kleurstof aan de mix. Verwijder de PBS en voeg 200 ul van het mengsel aan elk putje.
      1. Incubeer bij kamertemperatuur gedurende 1 h in het donker. Was 3 maal met PBS, laat cellen in PBS en cellen tegen licht met behulp folie. De cellen kunnen worden bewaard bij 4 ° C indien noodzakelijk.
    7. Afbeeldingscellen bij 400X totale vergroting op een omgekeerde epifluorescentie microscoop met excitatie golflengte 594-650 nm.

    6. Western Blotting

    1. Was de cellen tweemaal met 3,6 ijskoude PBS. Op ijs, cellen lyseren met 50 pl 1x RIPA buffer aangevuld met 1 x proteaseremmercocktail.
    2. Rots lysaten bij 4 ° C gedurende 15 min, verzamel lysaten in 1,5 ml buisjes en centrifugeer bij hoge snelheid (20.000 x g) gedurende 5 minuten om monsters te verduidelijken. Cellysaten worden opgeslagen op lange termijn bij -80 ° C indien nodig.
    3. Kwantificeren totaal eiwit onder toepassing van een Bradford-bepaling en aliquot een gelijke hoeveelheid eiwit in nieuwe 1,5 ml microcentrifugebuizen. Bring monsters gelijk volume met RIPA buffer en 3 x Laemmli beladingsbuffer aangevuld met 2-mercaptoethanol.
    4. Incubeer monsters in 1 x Laemmli monster beladingsbuffer gedurende 5 minuten bij 95 ° C en werking SDS-PAGE onder toepassing van een 4-12% Tris-glycine gel bij 200V gedurende 45 minuten. De hoeveelheid eiwit geladen varieert afhankelijk van de cellijn. In sommige gevallen is 50-100 ug totaal eiwit nodig E-cadherine in mesenchymale cellijnen te detecteren.
    5. Transporterende eiwitten op een nitrocellulosemembraan gedurende 2 uur bij 50 V in 1 x Tris-glycine-overdrachtsbuffer.
    6. Blok membraan gedurende 1 uur bij kamertemperatuur of overnacht bij 4 ° C in een BSA-gebaseerde blokkerende buffer.
    7. Verdunde primaire antilichamen 1: 1000 concentratie in 5 ml blokkeerbuffer en voeg verdunning tot het membraan, en geïncubeerd onder rustig schommelen gedurende 1 uur bij kamertemperatuur of overnacht bij 4 ° C. Was het membraan 3 maal in PBS met 0,05% Tween-20.
    8. Incubeer membranen gedurende 1 uur bij kamertemperatuur met infrarood fluorescerend gekoppeld SECUNDAIRy antilichaam bij 1: 20.000 verdunning in blokkeringsbuffer zoals hierboven.
    9. Was membraan tweemaal in PBS met 0,05% Tween-20 en vervolgens eenmaal in PBS.
    10. Afbeelding membraan met behulp van standaard infrarood fluorescentiedetectie.

    7. Anchorage-onafhankelijke groei Assays

    LET OP: Voor een gedetailleerde zachte agar assay protocol, zie 28.

    1. Warme steriele 2x DMEM-medium tot 42 ° C in heet waterbad. Gedurende deze tijd, warmte pre-geautoclaveerde 1% agarose in de magnetron gedurende 3 min. Magnetron voor nog eens 30 s in een tijd als nodig is of tot het volledig gesmolten. Agarose verplaatsen naar een 42 ° C waterbad.
    2. Plaats een 50 ml conische buis in een beker met 42 ° C water in een steriele kap en meng 1% agarose en 2 x DMEM media in een 1: 1 verhouding goed voor 1,5 mL mengsel per putje in een 6-wells plaat. bereiden altijd extra DMEM / agarose om rekening te houden pipetteren fouten en om luchtbellen te vermijden.
    3. mengsel toe te voegen aan dezijkanten van de goot, zodat er geen belletjes en laat gedurende 30 minuten bij kamertemperatuur.
    4. Terwijl de onderste laag stollen bereiden elke groep van zeldzame cellen in stap 3 getransfecteerd door opzuigen media en eenmaal gewassen met 1 ml PBS. Aspireren PBS en voeg 0,2 ml 0,05% trypsine en incubeer bij 37 ° C gedurende 5 minuten.
    5. Neutraliseren trypsine in 0,8 ml medium en fijnstampen cellen om een ​​eencellige suspensie. Transfer celsuspensie aan een 15 ml conische buis.
    6. Aantal cellen en bereken volume celsuspensie vereist 10.000 cellen per putje.
    7. Verwarm 0,6% agarose in de magnetron gedurende 3 min gevolgd door 30 seconden in tot volledig gesmolten. Bewegen agarose tot 42 ° C waterbad.
    8. Plaats een 50 ml conische buis in een beker met 42 ° C water in een steriele kap. Meng 0,6% agarose en verdunde celsuspensie in een 1: 1 verhouding tot 1,5 ml per putje mengsel bereid in een 6-wells plaat. bereiden altijd extra celsuspensie / agarose mix om rekening te houden pipetteerfout enom luchtbellen te vermijden.
      LET OP: Het is belangrijk om te werken bij 42 ° C hier. Als de temperatuur te laag is zal het mengsel stollen plating en temperaturen boven 42 ° C wordt de levensvatbaarheid van cellen beïnvloeden.
    9. Meng goed door tritureren cellen meerdere malen toevoegen celmengsel aan de putjes, zodat er geen bellen vormen, en laat stollen gedurende 20 minuten bij kamertemperatuur.
    10. Voeg 2 ml gesupplementeerd medium aan elk putje en platen bewegen incubator.
      1. Verander media een keer per week voor 3-4 weken of tot meercellige kolonies vormen. Wees voorzichtig om te voorkomen dat het aanraken van de agar bij het verwijderen van de media door middel van vacuüm aspiratie. Of gebruik een P1000 om de bovenste laag van vloeibare media te verwijderen.
      2. Vlek zachte agar platen door toevoegen van 200 pl nitroblauwtetrazolium-oplossing (1 mg / ml in PBS) en een nacht incuberen van de plaat bij 37 ° C. Vervang media de volgende dag met PBS voor de beeldvorming.
      3. Afbeelding putten 40x totale vergroting op een omgekeerde microscoop.
      4. Analyse uitvoeren op ImageJ voor kolonie gebied en het nummer. Plot betekenen kolonie aantal biologische herhalingen ± standaarddeviatie.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    Schema voor BMO inductie in sarcoma cellen

    Een algemene tijdschema voor de inductie van MET-achtige veranderingen in sarcoma cellen wordt getoond in figuur 1. Het protocol begint met transducerende GRHL2 (figuur 1A), gevolgd door transfectie van de familie miR-200 (Figuur 1B). GRHL2 of miR-200 familieleden waren niet in staat om de impact van de verschijning van RD-cellen wanneer alleen tot expressie, maar ectopische expressie van GRHL2 en miR-200s bij elkaar resulteert in epitheel-achtige morfologische veranderingen in RD-cellen. Cellen overgang van een spoelvormige vorm van een ronder uiterlijk met verhoogde cel-celcontact (figuur 1C).

    Inductie van MET-achtige veranderingen in sarcoma cellen

    De morfologische veranderingen in RD-cellen na GRHL2 en miR-200over-expressie ging gepaard met opwaartse regulatie van de epitheliale merker E-cadherine (Figuur 2A). Toevoeging van miR-200s gereguleerd E-cadherine alleen, maar in combinatie miR-200s en GRHL2 overexpressie synergistisch versterkte E-cadherine-expressie (figuur 2A; niet log schaal). Bovendien was er een toename in cel-cel contacten van epitheliale adhesiemoleculen, EpCAM en TJP1, witte pijlen (ook bekend als zona occludens 1, ZO-1) (Figuur 2B).

    MET inductie vermindert de kolonievorming vermogen van sarcoomcellen

    Opregulatie van epitheliale eiwitten ging gepaard met neerwaartse regulatie van mesenchymale genen Zeb1 en Notch1 (figuur 3A), die bekend zijn doelen voor miR-200. Inductie van MET verminderde de verankering-onafhankelijke groei van zeldzame cellen, zoals gemeten door aantal kolonies (Figuur 3B). dit growth remming werd veroorzaakt door alleen miR-200s; als overexpressie van GRHL2 leidde tot een toename van verankering onafhankelijke groei (figuur 3). Dit is consistent met eerdere rapporten tonen GRHL2 expressie induceert verankering-onafhankelijke groei 22.

    Figuur 1
    Figuur 1: tijdlijn BMO inductie met GRHL2 Overexpressie en miR-200 transfectie. (A) tijdlijn van ectopische overexpressie van GRHL2 in doelwitcellen. (B) tijdlijn van MET inductie via reverse transfectie van miR-200 familieleden in doelwitcellen. (C) GRHL2 en miR-200 overexpressie leidde tot veranderingen in morfologie van doelcellen in overeenstemming met MET. Schaal bar = 75 pm Klik hiervoor een grotere versie van deze afbeelding te bekijken.

    Figuur 2
    Figuur 2: Gelijktijdige overexpressie van GRHL2 en miR-200s Geleid tot MET in doelcellen. (A) Expressie van miR-200s geleid tot verhoogde E-cadherine-expressie terwijl gecombineerde expressie van GRHL2 en miR-200s een synergetisch effect op de E-cadherine-expressie op zowel mRNA (gemiddelde waarden ± standaardafwijking) en eiwitniveaus geproduceerd. (B) Gecombineerde expressie van GRHL2 en miR-200s leidde tot verhoogde expressie van EpCAM en TJP1 bij cel-cel contacten (pijlen). Schaalstaaf = 20 urn. * Geeft p <0,05 zijn geanalyseerd met ANOVA met Tukey's post-hoc correction.This figuur is aangepast referentie 24. Copyright © American Society for Microbiology, Molecular Cell Biology, volume 36, Issue 19, 2503-2513, 2016. Klik hier om een grotere versie van deze afbeelding te bekijken.

    figuur 3
    Figuur 3: Expressie van miR-200s onderdrukt Mesenchymale Markeringen en hiermee maakt Anchorage-onafhankelijke groei in sarcoomcellen. (A) over - expressie van miR-200s maar niet GRHL2 geremd Zeb1 en Notch 1 mRNA expressie (gemiddelde waarden ± standaarddeviatie). (B) Overexpressie van miR-200s maar niet GRHL2 geremd anoikis resistentie in sarcoma cellen. Representatieve beelden van gekleurde kolonies (schaalbalk = 200 pm) en kwantificering van kolonieaantal (gemiddelde waarden ± standaardafwijking) getoond. * Geeft p <0,05 zijn geanalyseerd met ANOVA met Tukey's post-hoc correction.This figuur aangepast is raslagwerk 24. Copyright © American Society for Microbiology, Molecular Cell Biology, volume 36, Issue 19, 2503-2513, 2016. Klik hier voor een grotere versie van deze afbeelding te bekijken.

    figuur 3
    Aanvullende Video: RD-cellen die lege vector en negatieve controle miRNAs. Video's zijn samengesteld uit beelden van de RD-cellen die met lege vector en negatieve controle miRNAs elke twee uur verkregen met behulp van een geautomatiseerd levende cellen imager. Klik hier om deze video te bekijken. (Klik met de rechtermuisknop om te downloaden.)

    figuur 3 />
    Aanvullende Video 2: RD cellen die GRHL2-EGFP en Negatieve controle miRNAs. Video's zijn samengesteld uit beelden van de RD-cellen die met GRHL2-EGFP en negatieve controle miRNAs elke twee uur verkregen met behulp van een geautomatiseerd levende cellen imager. Klik hier om deze video te bekijken. (Klik met de rechtermuisknop om te downloaden.)

    figuur 3
    Aanvullende Video 3: RD cellen die lege vector en miR200 miRNAs. Video's zijn samengesteld uit beelden van de RD-cellen die met lege vector en miR200 miRNAs elke twee uur verkregen met behulp van een geautomatiseerd levende cellen imager. Klik hier om deze video te bekijken. (Klik met de rechtermuisknop om te downloaden.)

    nt" fo: keep-together.within-page = "1"> figuur 3
    Aanvullende Video 4: RD cellen die GRHL2-EGFP en miR200 miRNAs. Video's zijn samengesteld uit beelden van de RD-cellen die met GRHL2-EGFP en miR200 miRNAs elke twee uur verkregen met behulp van een geautomatiseerd levende cellen imager. Klik hier om deze video te bekijken. (Klik met de rechtermuisknop om te downloaden.)

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    Sarcomen zijn zeldzaam, maar zeer agressieve kanker van een mesenchymale lijn. Ondanks hun mesenchymale lijn, een subset van sarcomen blijkt een fenotypische overgang naar een epitheel-achtige toestand ondergaan. Dit MET-achtige schakelaar prognostische impact, zoals patiënten met epitheel-achtige tumoren zijn minder agressief 24. Ondanks hun klinische relevantie, zijn er weinig studies over de moleculaire mechanismen die deze fenotypische overgangen in sarcomen.

    Om MET-achtige overgangen in sarcoma cellen te onderzoeken, hebben we een MET-inductie model dat is ontwikkeld door het combineren van de expressie van epitheliale factoren GRHL2 en miR-200 familie. Deze werkwijze induceert snel sarcomacellen meer epitheelachtige worden gemeten door veranderingen in morfologie en genexpressie. Met dit protocol te BMO induceren in sarcoma cellen faciliteert onderzoek van het effect van deze overgangen op fenotypen die sarcoom agressie, zoals rijdenzoals migratie, invasie, proliferatie en dood weerstand en hoe elk van deze veranderingen in de biologie kan invloed hebben op resistentie tegen geneesmiddelen.

    In de context van epitheliaal afgeleide carcinomen, expressie van één mesenchymale factor is vaak voldoende voor inductie EMT 14. In dit sarcoom afgeleide model van MET de expressie van twee epitheliale factoren, GRHL2 en miR-200s, vereist. Interessant is dat de miR-200S staan een sterker effect op de meeste biomarkers BMO dan GRHL2 had, terwijl GRHL2 kunnen stevig activeren epitheliale genen alleen in de aanwezigheid van miR-200-gebaseerde repressie van epitheliale gen repressoren zoals ZEB1 24 was. Het is mogelijk dat sommige mesenchymale celtypen epitheliale genen moeten zowel de onderdrukte (bijvoorbeeld via miR-200S) en geactiveerde (bijvoorbeeld via GRHL2) rijden MET.

    We hebben ervaren variatie in de niveaus van GRHL2 expressie in verschillende cell lijnen. Om dit te overwinnen gebruikten we een GRHL2 expressieplasmide dat ook tot expressie EGFP 25 voor sortering stroomcytometrie EGFP positieve cellen voorafgaand aan experimenten. Het is ook kritisch om de functionaliteit van miR-200s en GRHL2 valideren verschillende celtypen. EMT wordt gezien als een spectrum op basis van expressie van epitheliale en mesenchymale geassocieerde genen die context-afhankelijke variatie kan hebben op basis cellijn type kanker, behandeling, enz. Derhalve analyseerden we vijf genen gereguleerd door miR-200 of GRHL2 aan goed voor cel context-afhankelijke veranderingen. Een ander nadeel van deze test is de afhankelijkheid van een transiënte transfectie van miR-200s voor BMO inductie. Aldus kan langdurige experimenten kostbaar en gecompliceerd wanneer meerdere herhalende transfecties noodzakelijk. Dit kan worden ondervangen door toepassing van miR-200 expressieplasmiden.

    Andere studies hebben ook gemeld bewijs van BMO in sarcomen. Zo werd BMO waargenomen in een subset van leiomyosarcomas en werd geassocieerd met een betere overleving van patiënten. Mechanistisch, Yang et al. gevonden dat een leiomyosarcoma cellijn remming van Slug met siRNA voldoende om MET-achtige veranderingen 29 te induceren. Evenzo uitputting van nog een andere mesenchymale factor Slak in mesenchymale stamcellen verminderde vorming sarcoom bij muizen 30. Aldus blijkt uit de literatuur dat er meerdere routes naar een MET-fenotype, eventueel gedifferentieerd celtype. Hoewel dit niet de enige manier om BMO te wekken, hebben we onze methode gebruikt om BMO te induceren in twee sarcoom subtypen, waaronder rhabdomyosarcoom (RD-cellen) en osteosarcoom (143B cellen). In de toekomst zou het interessant zijn om deze verschillende methoden te vergelijken in een breder scala van sarcoma cellen. Bijvoorbeeld, bepaalde sarcoom subtypes hebben onderliggende genetische of epigenetische veranderingen die ze meer of minder gevoelig voor BMO inductie te maken?

    Het identificeren van de impact van de BMOop een verscheidenheid van biologische uitgangen in sarcomen cellen kan een beter begrip van waarom patiënten met meer epitheel-achtige sarcomen een verbeterde prognose te verschaffen. Daarnaast is het begrijpen van de invloed van de behandeling op het rijden de fenotypische overgangen tussen staten zou onze biologische kennis verdiepen en te informeren over reactie op de huidige therapieën bij patiënten met een sarcoom.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    De auteurs hebben niets te onthullen.

    Acknowledgments

    JAS erkent steun van het Duke Cancer Institute, The Duke University Genitourinary Oncology Laboratory, en de Duke University Afdeling Orthopedie. HL werd gesteund door de National Science Foundation (NSF) Centrum voor Theoretische Biological Physics (NSF PHY-1.427.654) en NSF DMS-1.361.411, en als een CPRIT (Cancer Prevention and Research Institute of Texas) Scholar in Cancer Research van de staat Texas aan de Rice University. KEW werd ondersteund door NIH F32 CA192630 MKJ en HL geprofiteerd van nuttige besprekingen met Mary C. Farach-Carson, JN Onuchic, Samir M. Hanash, Kenneth J. Pienta en Donald S. Coffey.

    Materials

    Name Company Catalog Number Comments
    Countess automated counter Life technologies AMQAX1000
    Countess cell counting chamber slides Invitrogen C10283
    SimpliAmp Thermal Cycler Thermo Fisher A24811
    Odyssey Fc LI-COR Inc
    ViiA7 Real Time PCR System Thermo Fisher 4453536
    PCR microplate Corning 321-29-051
    KAPA SYBR Fast Universal qPCR Kit KAPA Biosystems KK4602
    Starting Block (PBS) Blocking Buffer Thermo Fisher 37538 BSA-based blocking buffer
    Agarose General Purpose LE Genesee Scientific 20-102
    10x Tris/Glycine/SDS Buffer Bio-Rad Laboratories Inc 161-0732 Running buffer
    10x Tris/Glycine Buffer Bio-Rad Laboratories Inc 161-0734 Transfer buffer
    RIPA Buffer Sigma Life Sciences SLBG8489
    Amersham Protran 0.45 μm nitrocellulose GE Healthcare Lifesciences 10600012
    Quick-RNA MiniPrep Kit Genesee Scientific 11-358
    Laemmli Sample Buffer (4X) Bio-Rad Laboratories Inc 1610747
    Mini Trans-Blot Cell Bio-Rad Laboratories Inc 1703930
    Mini-Protean Tetra Cell Bio-Rad Laboratories Inc 1658005EDU
    DPBS Life technologies 14190-144
    0.05% Trypsin-EDTA Life technologies 11995-065
    DMEM Life technologies 11995-065
    Lipofectamine RNAi Max Thermo Fisher 13778150
    Lipofectamine 2000 Ragents Thermo Fisher 11668019
    Penicillin Streptomycin Life technologies 15140-122
    miRVana miRNA mimic negative control #1 Thermo Fisher 4464058 neg miRNA
    hsa-miR-200 mirVana miRNA mimic Thermo Fisher 4464066 miR200A
    has-miR-200 mirVana miRNA mimic Thermo Fisher 4404066 miR200B
    has-miR-200 mirVana miRNA mimic Thermo Fisher 4404066 miR200C
    Opti-MEM Life technologies 11088-021 serum-free media
    anti-Ecadherin antibody BD Bioscience 610182
    anti-beta actin Santa Cruz Biotechnology sc-69879
    anti-EpCam Ab Serotec MCA18706
    anti-ZO1 Invitrogen 402200
    IRDye 800W LI-COR Inc 925-32210
    IRDye 680 LI-COR Inc 926-32223
    anti-mouse AlexaFluor 647 Thermo Fisher A211241
    anti-rabbit AlexaFluor 647 Thermo Fisher ab150075
    Halt Protease and Phosphatesse Inhibitor Thermo Fisher 1861281
    Precision Plus Protein Dual Color Bio-Rad Laboratories Inc 161-0374
    Partec CellTrics Sysmex 04-004-2326 30 μm filter for flow
    GAPDH-F IDT AGCCACATCGCTCAGACAC
    GAPDH-R IDT GCCCAATACGACCAAATCC
    Ecadherin-F IDT TGGAGGAATTCTTGCTTTGC
    Ecadherin-R IDT CGCTCTCCTCCGAAGAAAC
    ZEB1-F IDT GCATACAGAACCCAACTTGAACGTC
    ZEB1-R IDT CGATTACACCCAGACTGC
    NOTCH-F IDT GGCAATCCGAGGACTATGAG
    NOTCH-R IDT CTCAGAACGCACTCGTTGAT
    nitro blue tetrazolium  Sigma N5514
    hexadimethrine bromide Sigma H9268 polybrene
    3 mL syringe BD Bioscience 309657
    Sterile syringe filter VWR 28145-505
    5mL polypropylene round-bottom tube 352063 flow cytometry tubes
    High-Capacity cDNA Reverse Transcription Kit Thermo Fisher 4368814 reverse transcription kit
    4% paraformaldyhyde Santa Cruz Biotechnology sc-281612
    Triton-X100 Sigma 93443
    bovine serum albumin Sigma A7906

    DOWNLOAD MATERIALS LIST

    References

    1. Weber, C. E., Li, N. Y., Wai, P. Y., Kuo, P. C. Epithelial-mesenchymal transition, TGF-beta, and osteopontin in wound healing and tissue remodeling after injury. J Burn Care Res. 33, (3), 311-318 (2012).
    2. Galichon, P., Finianos, S., Hertig, A. EMT-MET in renal disease: should we curb our enthusiasm. Cancer Lett. 341, (1), 24-29 (2013).
    3. Carew, R. M., Wang, B., Kantharidis, P. The role of EMT in renal fibrosis. Cell Tissue Res. 347, (1), 103-116 (2012).
    4. Willis, B. C., Borok, Z. TGF-beta-induced EMT: mechanisms and implications for fibrotic lung disease. Am J Physiol Lung Cell Mol Physiol. 293, (3), L525-L534 (2007).
    5. Ye, X., Weinberg, R. A. Epithelial-Mesenchymal Plasticity: A Central Regulator of Cancer Progression. Trends Cell Biol. 25, (11), 675-686 (2015).
    6. Li, L., Li, W. Epithelial-mesenchymal transition in human cancer: comprehensive reprogramming of metabolism, epigenetics, and differentiation. Pharmacol Ther. 150, 33-46 (2015).
    7. Tsai, J. H., Yang, J. Epithelial-mesenchymal plasticity in carcinoma metastasis. Genes Dev. 27, (20), 2192-2206 (2013).
    8. Bitting, R. L., Schaeffer, D., Somarelli, J. A., Garcia-Blanco, M. A., Armstrong, A. J. The role of epithelial plasticity in prostate cancer dissemination and treatment resistance. Cancer Metastasis Rev. 33, (2-3), 441-468 (2014).
    9. Schaeffer, D., Somarelli, J. A., Hanna, G., Palmer, G. M., Garcia-Blanco, M. A. Cellular Migration and Invasion Uncoupled: Increased Migration Is Not an Inexorable Consequence of Epithelial-to-Mesenchymal Transition. Mol Cell Biol. 34, (18), 3486-3499 (2014).
    10. Mathow, D., et al. Zeb1 affects epithelial cell adhesion by diverting glycosphingolipid metabolism. EMBO Rep. 16, (3), 321-331 (2015).
    11. Ware, K. E., et al. A mechanism of resistance to gefitinib mediated by cellular reprogramming and the acquisition of an FGF2-FGFR1 autocrine growth loop. Oncogenesis. 2, e39 (2013).
    12. Yauch, R. L., et al. Epithelial versus mesenchymal phenotype determines in vitro sensitivity and predicts clinical activity of erlotinib in lung cancer patients. Clin Cancer Res. 11, (24 Pt 1), 8686-8698 (2005).
    13. Jolly, M. K., et al. Towards elucidating the connection between epithelial-mesenchymal transitions and stemness. J R Soc Interface. 11, (101), 20140962 (2014).
    14. Mani, S. A., et al. The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell. 133, (4), 704-715 (2008).
    15. Chen, L., et al. Metastasis is regulated via microRNA-200/ZEB1 axis control of tumour cell PD-L1 expression and intratumoral immunosuppression. Nat Commun. 5, 5241 (2014).
    16. Nicolazzo, C., Gradilone, A. Significance of circulating tumor cells in soft tissue sarcoma. Anal Cell Pathol (Amst). 697395 (2015).
    17. Somarelli, J. A., et al. Mesenchymal-epithelial transition in sarcomas is controlled by the combinatorial expression of miR-200s and GRHL2. Mol Cell Biol. (2016).
    18. Bae, Y. K., Choi, J. E., Kang, S. H., Lee, S. J. Epithelial-Mesenchymal Transition Phenotype Is Associated with Clinicopathological Factors That Indicate Aggressive Biological Behavior and Poor Clinical Outcomes in Invasive Breast Cancer. J Breast Cancer. 18, (3), 256-263 (2015).
    19. Humphries, B., Yang, C. The microRNA-200 family: small molecules with novel roles in cancer development, progression and therapy. Oncotarget. 6, (9), 6472-6498 (2015).
    20. Renner, M., et al. MicroRNA profiling of primary high-grade soft tissue sarcomas. Genes Chromosomes Cancer. 51, (11), 982-996 (2012).
    21. Petrof, G., et al. Mutations in GRHL2 result in an autosomal-recessive ectodermal Dysplasia syndrome. Am J Hum Genet. 95, (3), 308-314 (2014).
    22. Werner, S., et al. Dual roles of the transcription factor grainyhead-like 2 (GRHL2) in breast cancer. J Biol Chem. 288, (32), 22993-23008 (2013).
    23. Werth, M., et al. The transcription factor grainyhead-like 2 regulates the molecular composition of the epithelial apical junctional complex. Development. 137, (22), 3835-3845 (2010).
    24. Somarelli, J. A., et al. Mesenchymal-Epithelial Transition in Sarcomas Is Controlled by the Combinatorial Expression of MicroRNA 200s and GRHL2. Mol Cell Biol. 36, (19), 2503-2513 (2016).
    25. Varma, S., et al. The transcription factors Grainyhead-like 2 and NK2-homeobox 1 form a regulatory loop that coordinates lung epithelial cell morphogenesis and differentiation. J Biol Chem. 287, (44), 37282-37295 (2012).
    26. Pruitt, S. C., Mielnicki, L. M., Stewart, C. C. Analysis of fluorescent protein expressing cells by flow cytometry. Methods Mol Biol. 263, 239-258 (2004).
    27. Zhao, Z., et al. A high-content morphological screen identifies novel microRNAs that regulate neuroblastoma cell differentiation. Oncotarget. 5, (9), 2499-2512 (2014).
    28. Borowicz, S., et al. The soft agar colony formation assay. J Vis Exp. (92), e51998 (2014).
    29. Yang, J., et al. Integrated proteomics and genomics analysis reveals a novel mesenchymal to epithelial reverting transition in leiomyosarcoma through regulation of slug. Mol Cell Proteomics. 9, (11), 2405-2413 (2010).
    30. Alba-Castellon, L., et al. Snail1 expression is required for sarcomagenesis. Neoplasia. 16, (5), 413-421 (2014).
    31. Takaishi, M., Tarutani, M., Takeda, J., Sano, S. Mesenchymal to Epithelial Transition Induced by Reprogramming Factors Attenuates the Malignancy of Cancer Cells. PLoS One. 11, (6), e0156904 (2016).

    Erratum

    Formal Correction: Erratum: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells
    Posted by JoVE Editors on 07/03/2018. Citeable Link.

    An erratum was issued for: Induction of Mesenchymal-Epithelial Transitions in Sarcoma Cells. An author name was updated.

    One of the authors' names was corrected from:

    Shenghan Xu

    to:

    Shengnan Xu

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics