טכניקות מעבדה המשמשות לשמירה על ביו-טיפוסים של * These authors contributed equally

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

כתב יד זה מתאר ראוי Vibrio cholerae טכניקות תחזוקה בנוסף סדרה של מבחני ביוכימי, מנוצל קולקטיבית עבור הבחנה מהירה ואמינה בין קליני וסביבתי V. ביו-טיפוסים של כולרה במעבדה.

Cite this Article

Copy Citation | Download Citations

Brumfield, K. D., Carignan, B. M., Ray, J. N., Jumpre, P. E., Son, M. S. Laboratory Techniques Used to Maintain and Differentiate Biotypes of Vibrio cholerae Clinical and Environmental Isolates. J. Vis. Exp. (123), e55760, doi:10.3791/55760 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

החיידק הגרימי שלילי של גראם הוא Vibrio cholerae הוא הסוכן האטיולוגי של כולרה זיהומית זיהומית. בשל השכיחות והחומרה הגלובלית של המחלה, V. Cholerae נחקרה בהרחבה הן בהגדרות סביבתיות והן במעבדה, המחייבת תחזוקה נאותה וטכניקות טיפוח. קלאסי ואל טור הם שני ביו-טיפוסים עיקריים המרכיבים את ה- V. Cholerae O1 serogroup, שכל אחד מהם מציג מאפיינים גנוטיפיים ופנוטיפיים ייחודיים המספקים מנגנונים אמינים לאפיון ביוטיפ, ודורשים ארסיות מובהקות הגורמות לתרבות. ללא קשר לביוטיפ של זן סיבתי עבור כל זיהום או פרוץ מסוים, הטיפול הסטנדרטי עבור המחלה כולל טיפול rehydration בתוספת משטר של אנטיביוטיקה. עם זאת, סיווג ביוטיפ עשוי להיות נחוץ ללימודי מעבדה ועלולות להיות השפעות רחבות יותר בתחום הביו-רפואי.בתחילת שנות האלפיים, זוהו הבדידות הקליניות, אשר הציגו תכונות גנוטיפיות ופנוטיפיות הן מהביוטיקים הקלאסיים והן מהאל-טור. ההיברידיות שזוהו לאחרונה, המכונה אל וריאציות של אל-טור, גרמו לקליניקה ולסביבה לזהות בידוד ביו-טיפוסי כדי להיות מורכבות יותר מאשר בפרוטוקולי זיהוי מסורתיים בודדים. בנוסף לתיאור V. Cholerae תחזוקה כללית ו culturing טכניקות, כתב היד הזה מתאר סדרה של גנים ספציפיים ( ctxB ו tcpA ) מסכי PCR מבוססי PCR ו מבחנים פנוטיפי (התנגדות polyyxin B, מטבוליזם ציטראט, פעילות proteolytic, פעילות hemolytic, תנועה, ומטבוליזם גלוקוז באמצעות Voges- Assay Proskauer) השתמשו באופן קולקטיבי לאפיין ו / או להבדיל בין ביוטוסים קלאסיים לאל טור. יחד, מבחני אלה מספקים גישה שיטתית יעילה לשמש חלופה, או בנוסף, יקר, ניסויים עתירי עבודה ב characterizaשל V. Cholerae קליני (וסביבתי) מבודד.

Introduction

כולרה היא מחלה של המעי הדק הרחוק שנגרם על ידי הצריכה של מזון מזוהם או מים המכילים את החיידק הגראמי שלילי חיידקים Vibrio cholerae. תסמינים של כולרה כוללים הקאות ושילשול מימי בלתי נשלט, מה שמוביל להתייבשות קשה, אשר אם לא מטופלים כראוי, יביא למוות. אשר Cholerae יכול להיות מחולק ליותר מ 200 serogroups מבוסס על המבנה של משטח התא lipopolysaccharide O- אנטיגן. עם זאת, רק 2 serogroups, O1 ו O139, הראו מגיפה או פוטנציאל מגיפה 1 , 2 . יתר על כן, serogroup O139 היה מבודד בעיקר בדרום מזרח אסיה 3 , 4 , בעוד serogroup O1 מופץ ברחבי העולם. יתר על כן, ניתן לחלק את הסרוגרופוס O1 לשני ביו-טיפוסים עיקריים: קלאסית ואל טור. הביוטיפ הקלאסי היה אחראי על מגיפת הכולרה הראשונהS בין 1817 ו 1923. המגיפה השביעית המתמשכת היא תוצאה של ביוטיפ אל טור, אשר גלשו באופן גלובלי את הביוטיפ הקלאסי בסביבה 5 , 6 , 7 . לאחרונה נוצרו זנים המכילים מאפיינים ייחודיים של ביו-טיפוסים קלאסיים ואל-טוריים 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 ומאז נקראו אל וריאנטים של אל טור 13 , 17 . כמה גרסאות של אל-טור הראו יכולות ארסיות גבוהות עם התקדמות מחלה מהירה וחמורה יותר ממה שנצפתה קודם לכן, והדגישהצורך בגישה מקיפה יותר לזיהוי סוכן ומניעת מחלות וטיפול 8 , 9 , 18 . בעוד הזיהוי של ביו-טיב אינו מכתיב מיד טיפול, התקדמות נוספת בפיתוח החיסונים ובסוכני הטיפול העתידיים עשויה להפיק תועלת מהבחנה ביו-טייתית.

הסדרה הראשונה של הפרוטוקולים המפורטים כאן תאפשר לחוקרים לשמור כראוי V. Cholerae זנים במעבדה הגדרה. עקביות וניתוח שלאחר מכן דורש הכנת מלאי וצמיחה של מבודדים, אשר אינו תלוי ביו-טיב. עם זאת, כדי לגרום באופן אופטימלי ביטוי גנים ארסיות, ביוטיפ עצמאית טכניקות culturing ספציפיים נדרשים 19 . בנוסף, הכנה לבדיקות גנטיות וביוכימיות שונות מתוארים בכתב יד זה.

כולרה רעלן (CT) ואת רעלן שיתוף reגלוטן gulated (TCP) הם שני הגורמים העיקריים ארסיות נשלט על ידי הרגולטור הראשי ToxT בשני biotypes של V. Cholerae O1 serogroup 20 . CT הוא רעלן דו-חמצני המורכב מחמש CtxB תת יחידות המקיפות יחידה אחת של CtxA, ואחראית על אובדן אלקטרוליטים מהיר הקשור לכולרה. TCP הוא סוג IV פילוס מקודדים על ידי tcp operon ( tcpABqCRDSTEF ), והוא מעורב בהתקשרות ו קולוניזציה של המעי הדק הרחוק. TcpA הוא הגן הראשון של אופרון tcp אשר מקודד את יחידות יחידת הפרט Pilin חיוני לבנייה של הפילוס 8 . רצף הגן עבור ctxA נשמר לחלוטין בין ביוטיקים קלאסיים אל Tor, בעוד ctxB ו tcpA נבדלים על פני שני biotypes אבל נשמרים בתוך כל ביוטיפ 8 . CtxB נשמר לחלוטין בין biotypes למעט שתי posi בסיסTions (115 ו 203). ב biotype אל Tor, thymine מתגורר בנקודות הבסיס 115 ו 203, בעוד הביוטיפ הקלאסי מכיל ציטוזין בבסיסים אלה. Tcpa נשמר לחלוטין בתוך כל ביוטיפ, אך נבדלים בסיסים מרובים בין biotypes. הבדלים גנטיים אלה משמשים כסימני זיהוי ביו-טיים ראשוניים, ולאחר סידור תגובת תגובת שרשרת הפולימרז (PCR), כולל אלה, ניתן לבודד רצפים מבודדים עם O395 או WT El N1696 הקלאסית מסוג Wild-type כדי לקבוע את הרקע הביוטיפי של CT ו- TCP, בהתאמה, ב V. cholerae נתון לבודד.

פרוטוקולים רבים פותחו על מנת לאפיין את ההבחנות הפנוטיפיות בין הביוטיקים הקלאסיים לאל טור , 21 , 22 , 23 . Polymyxin B הוא אנטיביוטיקה פפטיד כי compromises את יושרה של קרום התא החיצוני ב- Gram שלילי bacTeria, ואת התנגדות polyixxin B יכול להיות דמיינו דרך assay התנגדות polymyxin B 21 . ציטרט הוא המצע העיקרי של מחזור של Kreb, ואת היכולת metabolize ציטרט כמקור פחמן יחיד ניתן לקבוע באמצעות assay מטבוליזם ציטראט 22 . HapR מקודד הרגולטור העולמי ו הרגולטור חישה המניין קוורום ב V. cholerae, HapR, אשר נקשר לאזורים שונים האמרגן מסדיר ביטוי הגן האופרה 24 . כמה זנים פתוגניים של V. cholerae יש באופן טבעי מוטציה משמרת מסגרת בגן hapR שגרם זה צפיפות תלויה תקנה של ביטוי גנים ארסיות לאיבוד 24 , 25 . מדידת פעילות פרוטאז HAPR-regulated באמצעות מדיה אגר חלב מאפשר החוקר כדי לזהות אם לבודד מסוים מכיל HAPR תפקודית 23 . הבדיקות המוליזה של המעי הגס על יכולתו של מתח להפריש אנזימים hemolytic כי lyse תאי דם אדומים; את מידת המוליזה יכול להיות דמיינו על צלחות אגר דם 23 . תנועתיות קשורה לעיתים קרובות עם ארסיות V. cholerae וניתן לנתח באמצעות לוחות אגר התנועה 23 . מבחני ה- Voges-Proskauer בודקים את יכולתו של זן להסיס את הגלוקוז כמקור פחמן יחיד ומייצרים את התוצר האסייתי 21 . עם הופעת גרסאות אל Tor, קשה לחזות את התוצאות של assay פנוטיפי נתון ללא בדיקות genotypic נרחב, ולפני deducing את הרקע של ביוטייפ של V. Cholerae מבודד, מומלץ לבצע את הרכבה זו של מבחני 23 ולהשוות את התוצאות זנים התייחסות כמו בטבלה 2 .

כאן, יש לנו סדרה מתקדמת של פרוטוקולים, באופן קולקטיבי ניצול foreeeהבחינו genotypic ו מבחני פנוטיפי לגישה מקיפה יותר לאפיון V. ביוטכנולוגי כולרה . יתר על כן, יש לנו תיאר את ההבחנה גנוטיפי פנוטיפי של V ידוע. Cholerae אל Tor וריאנטים (MQ1795 ו BAA-2163), בהשוואה זנים התייחסות ביוטיפ נפוץ (WT קלאסי O395, WT אל Tor C6706, ו ​​WT אל Tor N16961, טבלה 1 ). הופעתה של גרסאות אל Tor הציגה אתגרים האמינות של המועסקים בעבר פרוטוקול יחיד אפיון ביו-טיוב אפיון; עם זאת, זה מספר רב של מערכת זיהוי assay יאפשר אפיון אמין יותר של קליני וסביבתי V. כולסטרס מבודד.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

הערה: שיקולי זמן עבור כל assay חייב להיעשות כמו ההכנות התקשורת הפרט דורשים פעמים שונות. לדוגמה, מוצק התקשורת צלחת אגר צריך להיות מותר מספיק מגניב ויבש (1-2 ימים). שיקולי זמן נוספים ( כלומר מושבה אחת וצמיחה תרבותית בין לילה) מפורטים תחת כל פרוטוקול ומצויים בטבלה 2 .

1. הכנת מדיה

  1. 1x פוספט שנאגרו מלוחים (PBS)
    1. לשקול 4.0 גרם NaCl, 0.1 גרם KCl, 0.72 גרם Na 2 HPO 4 , ו 0.12 גרם KH 2 PO 4 . שלב את המרכיבים של בקבוק 1 L Erlenmeyer, להתאים את עוצמת הקול ל 500 מ"ל עם מים deionized, להתאים את ה- pH 7.2 באמצעות מד pH והוספת drop drop HCL לפתרון, החיטוי או לסנן לעקר באמצעות מסנן 0.22 מיקרומטר. 1x PBS ניתן לאחסן בטמפרטורת החדר ללא הגבלת זמן.
      זהירות: HCl היא חומצה מרוכזת ויש לטפל בה בהתאםלתקנות מוסדיות, מקומיות, מדינה ופדרליות. לקבלת הנחיות טיפול מתאימות, עיין בגיליון נתוני הבטיחות שמספק היצרן.
  2. לוריא-ברטאני (LB)
    1. שוקל 5.0 גרם טריפטון, 2.5 גרם שמרים לחלץ, ו 2.5 גרם NaCl. שלב את המרכיבים בבקבוק 1 L, להתאים את עוצמת הקול ל 500 מ"ל עם מים deionized, החיטוי, ואת החנות בטמפרטורת החדר למשך עד 6 חודשים. עבור biotype קלאסית ארסיות גרימת התנאים, להתאים את ה- pH 6.5 באמצעות HCl לפני החיטוי.
  3. AKI בינוני המכיל 0.03% (w / v) NaHCO 3
    1. עבור רכיב 1 (בינוני AKI): לשקול 7.5 גרם peptone, 2.0 גרם שמרים לחלץ, ו 2.5 גרם NaCl. שלב את המרכיבים בבקבוק 1 L, להתאים את עוצמת הקול ל 450 מ"ל עם מים deionized ו החיטוי. המדיום AKI ניתן לאחסן בטמפרטורת החדר למשך עד 6 חודשים.
    2. עבור רכיב 2 (NaHCO 3 ): לשקול 1.5 גרם NaHCO 3 , ולהתאים את עוצמת הקולל 50 מ"ל עם מים deionized ב שלפוחית ​​סטרילית. מסנן לעקר NaHCO 3 באמצעות מסנן 0.22 מיקרומטר. NaHCO 3 חייב להיות מוכן מיד לפני השימוש.
    3. לשלב את שני הרכיבים באופן אקספטי יצירת יחס 1:10 על ידי סינון רכיב 2 לתוך Component 1 לפני השימוש.
  4. Luria-Bertani (LB) אגר צלחות
    1. לשקול 5.0 גרם טריפטון, 2.5 גרם שמרים לחלץ, 2.5 גרם NaCl, ו 7.5 גרם אגר. שלב את המרכיבים בבקבוק 1 L Erlenmeyer, להתאים את עוצמת הקול ל 500 מ"ל עם מים deionized, החיטוי, ולהכין בגודל סטנדרטי בגודל 100 מ"מ x 15 מ"מ מנות סטרילי פטרי. מדיה מצופה יכול להיות מאוחסן עטוף פלסטיק עד 6 חודשים, מכסה בצד למעלה ב 4 ° C.
  5. LB אגר צלחות מוסף עם Polymyxin B
    1. עבור רכיב 1 (אגר LB): לשקול 5 גרם טריפטון, 2.5 גרם שמרים לחלץ, 2.5 גרם NaCl, ו 7.5 גרם אגר. שלב את המרכיבים של בקבוק 1 L Erlenmeyer, להתאים את עוצמת הקול ל 500 מ"ל wiמים מאויירים וחיטוי.
    2. עבור רכיב 2 (polymyxin B): להמיס polymyxin B במים deionized צינור סטרילי 2 מ"ל microcentrifuge לריכוז של 50,000 IU / μL ו מסנן לעקר באמצעות מסנן 0.22 מיקרומטר.
    3. לאחר רכיב 1 הוא מגניב למגע, אך לא מוצק עדיין, aseptically להוסיף 500 μL של רכיב 2 כדי רכיב 1 יצירת ריכוז סופי של 50 IU / μL ומערבבים היטב. להתכונן בגודל סטנדרטי 100 מ"מ x 15 מ"מ צלחות פטרי סטרילי על ידי שפכו התקשורת אגר מעורב לתוך צלחות פטרי. מדיה מצופה יכול להיות מאוחסן עטוף פלסטיק עד 3 חודשים, מכסה בצד למעלה ב 4 מעלות צלזיוס.
  6. מינימלי ציטראט בינוני אגר צלחות
    1. עבור רכיב 1 (אגר עם כחול bromothymol): לשקול 7.5 אגר אגר ו 0.02 גרם bromothymol כחול. שלב את המרכיבים של בקבוק 1 L Erlenmeyer, להתאים את עוצמת הקול ל 450 מ"ל עם מים deionized ו החיטוי התערובת.
    2. עבור רכיב 2 (10x VBMM): שקול 1.0 גרם MgSO 4 7H 2 O, 10.0 גרם חומצה לימון H 2 O, 50.0 גרם נטול מים K 2 HPO 4 , ו 17,5 גרם NaNH 4 HPO 4 4H 2 O. לשלב את המרכיבים בבקבוק 1 L Erlenmeyer, להתאים את עוצמת הקול ל 500 מ"ל עם מים deionized ו החיטוי או לסנן לעקר באמצעות מסנן 0.22 מיקרומטר. 10x VBMM ניתן לאחסן בטמפרטורת החדר עד 6 חודשים.
    3. הוסף 50 מ"ל של רכיב 2 כדי רכיב 1 ולהכין בגודל סטנדרטי בגודל 100 מ"מ x 15 מ"מ צלחות פטרי סטרילי על ידי שפכו התקשורת אגר מעורב לתוך מנות פטרי. מדיה מצופה יכול להיות מאוחסן עטוף פלסטיק עד 6 חודשים, מכסה בצד למעלה ב 4 ° C.
  7. לוחות אגר חלב
    1. עבור רכיב 1 (חלב): שוקל 8.0 גרם מיידי יבש חלב nonfat בבקבוק 1 L Erlenmeyer, להתאים את עוצמת הקול ל 200 מ"ל עם מים deionized ו החיטוי.
    2. עבור רכיב 2 (אגר עם אינפוזיה בלב המוח): לשקול 3.68 גרם לב המוח אינפוזיה ו 6.0 גרם אגר. שלב את conStituents בקבוק 500 מ"ל Erlenmeyer, להתאים את עוצמת הקול ל 200 מ"ל עם מים deionized ו החיטוי.
    3. שלב את שני הרכיבים על ידי לשפוך רכיב 2 לתוך רכיב 1, לאחר החיטוי ומערבבים היטב. הכן 150 מ"מ x 15 מ"מ מנות סטרילי פטרי. לוחות חלב ניתן לאחסן עד שבוע עטוף פלסטיק, המכסה בצד למטה ב 4 מעלות צלזיוס. הכן 150 מ"מ x 15 מ"מ צלחות פטרי סטרילי על ידי שפכו התקשורת אגר מעורב לתוך צלחות פטרי.
  8. לוחות אגר
    1. עבור רכיב 1 (אגר LB): לשקול 5 גרם טריפטון, 2.5 גרם שמרים לחלץ, 2.5 גרם NaCl, ו 2.0 גרם אגר. שלב את המרכיבים בבקבוק 1 L Erlenmeyer, להתאים את עוצמת הקול ל 500 מ"ל עם מים deionized ו החיטוי.
    2. עבור רכיב 2 (1% (w / v) triphenyltetrazolium כלוריד, TTC): שוקלים 0.25 גרם TTC. כוונן את עוצמת הקול ל 25 מ"ל עם מים deionized ב שלפוחית ​​סטרילית מסנן לעקר באמצעות מסנן 0.22 מיקרומטר. חנות עד 6 חודשים בטמפרטורת החדר עטוףב לסכל כדי למזער את החשיפה לאור.
    3. הוסף 2.5 מ"ל של 1% (w / V) סטרילי TTC מדיה autoclaved.
    4. יוצקים התקשורת עבה ככל האפשר (≥ 50 מ"ל / צלחת) לתוך 150 מ"מ x 15 מ"מ מנות סטרילי פטרי. מדיה מצופה ניתן לאחסן עטוף פלסטיק עד שבוע אחד, מכסה בצד למעלה ב 4 ° C. הכן 150 מ"מ x 15 מ"מ צלחות פטרי סטרילי על ידי שפכו התקשורת אגר מעורב לתוך צלחות פטרי.
  9. Voges-Proskauer (סגן נשיא)
    1. עבור רכיב 1 (Methyl Red-Voges-Proskauer מרק, MR-VP): לשקול 1.7 גרם MR- סגן נשיא בבקבוק ארלנמאייר 500 מ"ל, להתאים את עוצמת הקול ל 100 מ"ל עם מים deionized ו החיטוי. ניתן לאחסן במרקר סטרילי MR-VP בטמפרטורת החדר למשך עד 6 חודשים.
    2. עבור רכיב 2 (5% (w / v) אלפא (α) naphthol): לשקול 1.0 גרם α-naphthol שלפוחית ​​סטרילית ולהתאים את עוצמת הקול ל 20 מ"ל עם אתנול 95%. Α-naphthol ניתן לאחסן בטמפרטורת החדר עד שבוע 1 עטוף בנייר כדי למזער expOsure.
    3. עבור רכיב 3 (40% (w / v) הידרוקסיד אשלגן, KOH): שוקלים 20.0 גרם KOH ב שלפוחית ​​סטרילית, להתאים את עוצמת הקול ל 50 מ"ל עם מים סטרילי deionized. KOH ניתן לאחסן עד 6 חודשים בטמפרטורת החדר בכלי פלסטיק.

2. תחזוקה וצמיחה של V. Cholerae זנים

  1. הכנה ושימוש תרבויות מלאי קפוא
    1. גלולה 1.8 מ"ל של תרבות לילה נוזלי במשך 2 דקות על ידי צנטריפוגה (≥ 8,600 x ג ') צינור סטרילי 2 מ"ל microcentrifuge, להסיר supernatant, ולהשעות מחדש את גלולה התא 900 μL של מרק LB טרי על ידי pipetting.
    2. הוסף 900 ​​μL של סטרילי 60% (v / v) גליצרול לתרבות ומערבבים על ידי vortexing.
    3. מעבירים את התערובת לצינור סטרילי 2 מ"ל קריוגני ולאחסן ללא הגבלה ב -80 מעלות צלזיוס.
    4. כדי להשתמש, להסיר כמות קטנה של מלאי קפוא באמצעות לולאה inoculating סטרילי ופס עבור מושבות בודדות על LB AGלוחות. מיד להחזיר מלאי קפוא ל -80 מעלות צלזיוס לאחר השימוש כדי למנוע תרבויות מן ההפשרה לחלוטין. דגירה צלחות מכסה בצד למטה במשך 12 עד 16 שעות ב 37 מעלות צלזיוס.
  2. גידול תרבויות לילה במדיום נוזלי
    1. פס עבור מושבות בודדות (לפי סעיף 2.1.4) ממלאי קפוא על גבי לוחות אגר LB. דגירה צלחות מכסה בצד למטה במשך 12 עד 16 שעות ב 37 מעלות צלזיוס.
    2. לחסן 4 מ"ל של מרק LB נוזלי בצינור תרבות סטרילי 10 מ"ל עם מושבה אחת על ידי נגיעה פני השטח של המושבה בודדת עם מקל המוליך סטרילית והעברת המושבה לתוך מרק נוזלי.
    3. דגירה עם אוורור בחממה שאכר בסל"ד 225 במשך 12 עד 16 שעות ב 37 ° C.
  3. עקומת הצמיחה
    1. הכן תרבות לילה LB נוזלי מרק כאמור לעיל בפרוטוקול 2.2.
    2. לעשות דילול 1: 100 של תרבות לילה על ידי העברת 250 μL של תרבות לילה ל 25 מ"ל של מרק LB טרי של בקבוק סטרילית 250 מ"ל Erlenmeyer.
    3. למדוד את הצפיפות האופטית של תרבויות נוזלי ב 600 ננומטר (OD 600 ) כל שעה מתחילה בזמן החיסון (T 0 ).
    4. דגירה דילול 1: 100 של תרבות לילה עם אוורור בחממה שייקר בסל"ד 225 עד 30 שעות ב 37 מעלות צלזיוס, או עד התרבות מגיע צפיפות מקסימלית.
    5. גרף את ה- OD 600 לעומת הזמן והשתמש ברגרסיה ליניארית כדי לקבוע את זמן הכפלת הזמן המשוער עבור כל זן.
  4. אלטר ביוטיפ
    1. פס עבור מושבות בודדות ממלאי קפוא על גבי לוחות אגר LB. דגירה צלחות מכסה בצד למטה, במשך 12 עד 16 שעות ב 37 מעלות צלזיוס.
    2. לחסן 10 מ"ל של מדיום AKI המכיל 0.03% (w / v) NaHCO 3 עם מושבה אחת.
    3. דגירה התרבות ללא אוורור ב 37 מעלות צלזיוס במשך 3.5 שעות.
    4. הסר 7 מ"ל של התרבות דגירה הנותרים 3 מ"ל של cultuמחדש עם אוורור בחממה שייקר בסל"ד 225 עבור 4 שעות נוספות.
  5. קלאסי ביוטיפ
    1. פס עבור מושבות בודדות ממלאי קפוא על גבי לוחות אגר LB. דגירה צלחות מכסה בצד למטה במשך 12 עד 16 שעות ב 37 מעלות צלזיוס.
    2. לחסן 4 מ"ל LL נוזלי מרק (pH 6.5) עם מושבה אחת.
    3. דגירה עם אוורור בחממה שאכר בסל"ד 225 במשך 12 עד 16 שעות ב 30 מעלות צלזיוס.
  6. כביסה תא גלולה ב 1x PBS
    1. גלולה 1.8 מ"ל של תרבות לילה במשך 2 דקות על ידי צנטריפוגה (≥ 8,600 xg) בצינור microcentrifuge סטרילית 2 מ"ל ולהסיר supernatant באמצעות פיפטה. Re- להשעות תא גלולה ב 1.8 מ"ל 1x PBS ידי pipetting.
    2. חזור על הליך הכביסה שלוש פעמים ואחריו resuspension הסופי 1.8 מ"ל 1x PBS.

3. אפיון V. ביולוגים של כולרה

  1. עמ 'CR מבוסס גנטי מסכי באמצעות ctxB ו tcpA
    1. עיצוב קבוצה של primers, אשר anneal כ 50-70 BP במעלה או במורד הזרם של התחנה להתחיל אתרי להפסיק של ctxB ו tcpA , בהתאמה.
    2. הכן תרבות לילה LB נוזלי מרק כאמור לעיל בפרוטוקול 2.2.
    3. בידוד DNA כרומוזומלי באמצעות ערכת זמין מסחרית המיועדת חיידקים שלילי גרם. DNA מטוהרים כרומוזומליות ניתן לאחסן ללא הגבלת ב -20 מעלות צלזיוס. בידוד דנ"א כרומוזומלי באמצעות ערכות זמין מסחרית בדרך כלל לקחת כ 4 שעות.
    4. השתמש ספקטרופוטומטר נפח מיקרו כדי להבטיח את הדגימה DNA כרומוזומלית היא באיכות גבוהה (A 260/280 > 1.8).
    5. עבור כל בידוד דנ"א כרומוזומלי, להכין תגובת שרשרת פולימראז (ים) (PCR) על קרח סטרילית 200 μL צינור PCR (ים) ו להגביר אזורים של ctxB ו tcpA באמצעות רכיבי PCR סטנדרטיים: פולימרז Taq ו buFfer (או שווה ערך), פתרון dNTP, ו primers קדימה / לאחור. השתמש בפרמטרים סטנדרטיים PCR (~ 3 שעות). לדוגמה, השתמש בפרוטוקול הבא:
      1. מחלוקות ראשונות ב 95 מעלות צלזיוס במשך 120 שניות.
      2. דחה ב 95 מעלות צלזיוס למשך 60 s.
      3. פריימרים אנאליות ב 60 מעלות צלזיוס במשך 45 s.
      4. להאריך ב 72 מעלות צלזיוס במשך 90 s.
      5. חזור על שלבים 3.1.5.2 עד 3.1.5.4 עבור 34 מחזורים.
      6. סיומת סופי 72 מעלות צלזיוס עבור 600 s.
      7. אינסופי להחזיק ב 4 ° C.
    6. צבע 5 μL של המוצר PCR בהתאמה (ים) באמצעות ג'ל 6x תקן העמסת ג'ל, לטעון כ 10 μL של סולם 1 קילו ו 10 μL של מוצר ה- PCR על ג'ל agarose 1% 1x Tris-Borate-EDTA (TBE) בַּלָם.
    7. הפעל ג'ל אלקטרופורזה ב 130 V עד חזית צבע מגיע לסוף, אבל לא הנחה, של ג'ל (כ 90 דקות). ניטור מתמיד מומלץ כמו מתח פעמים פועל יכול להשתנות בהתאם לציוד.
    8. עם אימות שלהגברה מוצלחת PCR בגודל הצפוי, לטהר את המוצר הנותר 45 μL PCR (ים) באמצעות דנ"א זמין מסחרית נקי & ערכת concentrator.
    9. רצף ניקה מוצר PCR (ים) באמצעות פריימרים אותו המשמש הגברה PCR, ולהכין לכל הנחיות מתקן רצף המקומי.
    10. השווה את פורמט FASTA של רצפי גנים מכל אחד מבודד לרצף שפורסם זמין באתר האינטרנט של NCBI (http://www.ncbi.nlm.nih.gov/gene/), על ידי חיפוש מספרי ההצטרפות הבאים בתיבה שאילתת החיפוש.
    11. CtxB : (קלאסי) אזור בין VC0395_A1059 ל VC0395_A1060 (El Tor) VC_1456
    12. TcpA : (קלאסי) VC0395_A0353 (El Tor) VC_0828
  2. מבחני פנוטיפ עבור סיווג ביוטיפ באמצעות איתור
    1. הכן תרבות לילה LB נוזלי מרק כאמור לעיל בפרוטוקול 2.2.
    2. שטפו את התא גלולה (ים) כמפורט בפרוטוקול 2.6.
    3. השתמש פיפטה לנקודה 1 μL של תרבות שטף על המדיום בהתאמה. עבור בחירת בינונית ודגירה דגמים, עיין בטבלה 2.
  3. Assay תנועתיות
    1. הכן תרבות לילה (ים) במרק נוזלי LB כאמור לעיל בפרוטוקול 2.2.
    2. שטפו את התא גלולה (ים) כמפורט בפרוטוקול 2.6.
    3. לחסן לוחיות אגר ארוג על ידי הוספת inoculating דקירה לתוך התרבות נוזלים שטף "דקירה" אנכית לתוך התקשורת. בין כל חיסון, לעקר את חוט דקירה באמצעות מבער Bunsen, וכאשר דקירה אגר, להבטיח דקירה inoculating לא להתכופף, כמו זה יכול לשנות את התוצאות.
    4. דגירה צלחות מכסה בצד במשך 14 עד 24 שעות ב 37 מעלות צלזיוס. לאחר 14 שעות, לפקח על לוחות התנועה מקרוב כדי למנוע overgrowth של תרבויות.
  4. Voges-Proskauer (סגן נשיא) Assay
    1. הכן תרבות לילה (ים) במרק נוזלי LB כאמור לעיל בפרוטוקול 2.2.
    2. לחסן 4מ"ל של מתיל אדום Voges-Proskauer, או MR- סגן מרק, על ידי pipetting 10 μL של תרבות לילה שהוכנו בעבר לתוך 4 מ"ל MR-VP סגן בתוך צינור תרבות סטרילית דגירה עם אוורור בחממה שייקר בסל"ד 225 עבור 12 עד 16 שעה ב 37 ° C.
    3. הוסף 150 μL של 5% (w / v) α-naphthol ו 50 μL 40% (w / v) KOH ל aliquots 1 מ"ל של MR- סגן נשיא לילה תרבות צינורות סטרילי, בהתאמה.
    4. מערבולת קצרה ולתת לעמוד בטמפרטורת החדר עד 4 שעות עד שינוי צבע מתפתח.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

עבור תחזוקה נאותה ושימוש בכל זן חיידקי, מומלץ לדעת את זמן הכפלה של זן (ים) של עניין. הנה, את שיעורי הצמיחה המשתנים של V נפוץ. זנים cholerae הודגמו דרך עקומת הצמיחה, ואת זמני הכפלה משוער חושבו באמצעות רגרסיה ליניארית. WT El Tor N16961 ו El Tor וריאנט MQ1795 הוכיחו פעמים הכפלת קצר (~ 1 שעה ו ~ 1 שעות, בהתאמה) מאשר WT קלאסי O395 (~ 2 שעות) ( איור 1 , טבלה 2 ).

V. cholerae מניפולציה גנטית ניתוח שלאחר מכן לעתים קרובות מסתמך על היכולת להבחין כראוי בין biotypes. PCR מבוסס גנטי מסכי מבחני פנוטיפי יושמו באופן קולקטיבי כמערכת אמינה להבחין בין רקע ביוטיפ של V. Cholerae קליני וסביבתי iסולטים; עבור ייצוג, זנים ייחוס ביוטיפ (WT קלאסי O395, WT אל Tor C6706, ו ​​WT אל Tor N16961) וכן אלגורנטים נציג אל (MQ1795 ו BAA-2163) נכללו ( טבלה 1 ). WT קלאסי O395 הפגינו ctxB קלאסי רצפים tcpA. לעומת זאת, WT אל Tor זנים N16961 ו C6706 הפגינו אל Tor ctxB ו tcpA sequences. מעניין, MQ1795 ו BAA-2163 הכיל את ביוטיפ קלאסי ctxB יחידת משנה להשוות O395, אך שתי גירסאות אל Tor הכיל את tcpA מעיד על רקע ביוטיפ אל Tor ( טבלה 1 ). WT קלאסי ביוטיפ זן O395 הראו רגישות polyyxin B, בעוד זנים WT אל טור ביוטיפ (C6706 ו N16961) הראו התנגדות הציג צמיחה על צלחות אגר LB בתוספת פולימקסין B. נציג אל טור זנים שונים (MQ1795 ו BAA-2163) הפגינו התנגדות דומה לאנטיביוטיקה ביחס ל - WT El Bi biotype stra(C6706 ו- N16961) ( איור 2 : טבלה 2 ). WT קלאסי ביוטיפ זן O395 לא גדל על התקשורת ציטראט מינימלית, ואילו WT אל זנים Tor (C6706 ו N16961) היו מסוגלים לנצל ציטרט כמקור פחמן צמיחה בתערוכות ציטראט מינימלי. נציג אל טור זנים ביוטיפ משתנה (MQ1795 ו BAA-2163) הפגינו צמיחה דומה לזו של זנים BiType WT אל טור (C6706 ו N16961) ( איור 3 , טבלה 2 ). WT קלאסי זן O395 ו WT אל Tor זן N16961 להחזיק HAPR לא פונקציונלי, ולכן, לא להפגין HAPR- מוסדר פעילות פרוטאז; WT אל Tor זן C6706, וכן נציג אל Tor וריאנטים (MQ1795 ו BAA-2163) הם hapR -positive-visualized כאזור של סיקול הנובע מנקודת החיסון ( איור 4 , טבלה 2 ). WT קלאסית זן O395 אינו מפריש האנזימים hemolytic והיה שםE-γ-hemolytic, בעוד זנים ביוטיפ WT אל WT Tor (C6706 ו N16961) ו נציג אל Tor זר סוגים שונים (MQ1795 ו BAA-2163) להפריש אנזימים hemolytic כי לחלוטין lyse תאי דם אדומים המקיפים את נקודת החיסון הראו β המוליזה ( איור לוח 2 ). תנועתיות משתנה על פני, ובתוך, זנים ביוטיפ; עם זאת, WT אל Tor זן N16961 ו אל Tor וריאנטים (MQ1795 ו BAA-2163) הפגינו יתר על המידה בהשוואה נימה WT קלאסית פחות יחסית O395 ו WT אל זן C6706 ( איור 6 , טבלה 2 ). WT קלאסי O395 ו נציג אל וריאנטים נציג לא metabolize גלוקוז לייצר אצטון, ואילו זן WT אל ביוטיפ זנים מיוצר אצטון כתוצר לוואי של תסיסה גלוקוז, כפי שצוין על ידי פיתוח של צבע אדום עמוק במהלך Assay Voges-Proskauer ( איור 7 לוח 2 ).

מתח CtxB ג 'ין TcpA התייחסות
בסיס 115 בסיס 203 ביוטיפ ביוטיפ
O395 ג ג קלַאסִי קלַאסִי 8
C6706 T T אל טור אל טור 8
N16961 T T אל טור אל טור 8
MQ1795 ג ג קלַאסִי אל טור 13
BAA-2163 ג ג קלַאסִי אל טור 8

טבלה 1: ביוטיפ תלוי גנטי הבחנות של Vibrio cholerae הפניה זנים. שמופיעים בטבלה זו הם השינויים בסיס DNA ו עמדות יחסית גנים ctxB ו tcpA . WT קלאסי O395 ו WT אל זנים N16961 ו C6706 משמשים בדרך כלל זנים התייחסות ביוטיפ. MQ1795 ו BAA-2163 ידועים וריאנטים El Tor.

Assay יישום בחירה בינונית דְגִירָה תוצאות צפויות
O395 C6706 N16961 MQ1795 BAA-2163
2.3) עקומת הצמיחה 27 קובע זמני הכפלה של זני כולסטרס שונים 1.2) LB Liquid נוזלי עד 30 שעות (37 ° C עם אוורור) ~ 2 שעות ND * ~ 1 h ~ 1 h ND *
3.1) PCR מבוסס מסך גנטי באמצעות ctxB ו tcpA 8 מבחין בין רקע קלאסי אל ביוטיפ אל טור של ctxB N / A N / A קלַאסִי אל טור אל טור קלַאסִי קלַאסִי
מבדיל בין רקע קלאסי אל ביוטיפ אל Tor של tcpA N / A N / A קלַאסִי אל טור אל טור אל טור אל טור
3.2) התנגדות Polymyxin B 21 רגישות לפולימיקסין אנטיביוטי ב 1.5) LB אגר צלחות בתוספת polyyxin B 18 שעות (37 ° C) - + + + +
3.2) מטבוליזם של ציטראט 22 יכולת חילוף חומרים ציטראט כמקור פחמן יחיד 1.6) מינימלי ציטרט בינוני אגר צלחות 24 שעות (37 ° C) - + + + +
3.2) קזין הידרוליזה 23 HAPR-regulated פעילות פרוטאז 1.7) לוחות אגר חלב 18 שעות (37 ° C) - - + + +
3.2) המוליזה 23 מודד פעילות המוליטית לוחות אגר דם 48 שעות (37 ° C) גמא בטא בטא בטא בטא
3.3) תנועתיות 23 מידת התנועה של התנועה 1.8) לוחות אגר 14-24 שעות (37 ° C) 10 מ"מ 15 מ"מ 21 מ"מ 25 מ"מ 29 מ"מ
3.4) Voges-Proskauer 21 מודד יכולת התסיס גלוקוז לייצר אצטון כתוצר לוואי 1.9) בינוני נוזלי Voges-Proskauer עד 4 שעות (טמפרטורת החדר) - + + - -
הערה: "ND *" מציין לא נקבע; "+" מציין תוצאה חיובית; "-" מציין תוצאה שלילית

טבלה 2: סיכום המבחנים הגנטיים והפנוטיפיים המשמשים עבור ויבריו cholerae ביוטיפ הבחנה. טבלה זו מסכמת את המבחנים הגנטיים והפנוטיפיים השונים, היישומים, והתוצאות הצפויות המשמשות להבדיל בין ביו-טיפוסים קלאסיים לאל-טור המשמשים במחקר זה. מספרי פרוטוקול והפניות לפרוטוקולים ספציפיים מסומנים בעמודה Assay. "ND *" מציין לא נחוש; "+" מציין תוצאה חיובית; "-" מציין תוצאה שלילית.

איור 1
איור 1: V. Cholerae צמיחה עקומה של WT קלאסי O395, WT אל Tor N16961, ו אל Tor Variant MQ1795. שיעורי הצמיחה של זנים התייחסות ביוטיפ (WT קלאסי O395 ו WT אל Tor N16961) נציג אל Tor וריאנט MQ1795, גדל במרק LB עם אוורור ב 37 מעלות צלזיוס, נותחו על ידי מדידת OD 600 eשעה מאוד מתחילה ב- T 0 . עקומות הצמיחה בוצעו על 8 משכפל ניסיוני עצמאי, עם כל לשכפל המייצג אירוע culturing עצמאית עבור כל משפט. WT אל Tor זן N16961 ו אל Tor וריאנט MQ1795 הוכיחו פעמים הכפלת קצר (~ 1 שעה ו ~ 1 שעות, בהתאמה) ביחס WT קלאסית זן O395 (~ 2 שעות), כפי שנצפה על ידי זמן הכפלה ארוכה יותר. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

איור 2
איור 2: קביעת ההתנגדות Polymyxin B באמצעות LB Agar מוסף עם Polymyxin B. ההתנגדות לאנטיביוטיקה peptide polymyxin B נקבע על ידי היכולת לגדול על אגר LB בתוספת 50 IU / μLx פולימקסין B. WT זן קלאסי O395 הראה שום צמיחה על אגר An UniversityEmented עם polymyxin B ונחשב רגיש לאנטיביוטיקה. בעוד WT אל Tor זנים (C6706 ו N16961) ונציג אל ור גירסאות (MQ1795 ו BAA-2163) הציג צמיחה בנוכחות אנטיביוטיקה נחשבו עמידים polymyxin ב צלחות הודגרו ב 37 מעלות צלזיוס במשך 18 שעות. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

איור 3
איור 3: מדידת מטבוליזם של סיטראט באמצעות מדיה מינימלית של ציטראט. היכולת לנצל ציטרט כמקור פחמן יחיד נקבעה על ידי יכולתו של הבודד לגדול באמצעי ציטראט מינימלי. WT קלאסית זן O395 לא גדל על מדיה ציטראט מינימלי (שלילי). הצמיחה ניכרת בכל זני WT El Tor (C6706 ו- N16961) ונציג אלוריאציות טור (MQ1795 ו BAA-2163), אשר הוכיחו את היכולת לנצל ציטרט כמקור פחמן יחיד (חיובי). צלחות הודגרו על 37 מעלות צלזיוס במשך 18 שעות. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

איור 4
איור 4: מדידת HAPR- מוסדר Proteolytic קאסין הידרוליזה באמצעות חלב אגר מדיה. CASIN הידרוליזה דרך HAPR- מוסדר פעילות פרוטאז נקבע על ידי אזור חזותי של אישור סביב נקודת החיסון על אגר חלב. זנים המכילים HAPR לא פונקציונלי, כגון WT קלאסית זן O395 ו WT אל זן N16961, לא לייצר אזור של סיקול סביב הנקודה של חיסון ( hapR- שלילי). WT אל Tor זן C6706 נציג אל וריאנטים אל Tor (MQ1795 ו BAA-2163) מכילים HAPR פונקציונלי, אשר יכול להיות דמיינו כמו אזורי גודל משתנה של אישור ( hapR- positive). צלחות הודגרו על 37 מעלות צלזיוס במשך 18 שעות. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

איור 5
איור 5: מדידת הפעילות המוליטית באמצעות אגר דם מדיה. הפעילות המוליטית נמדדה באמצעות צלחות אגר בתוספת דם של כבשים. WT קלאסי זן O395 אינו מפריש אנזימים כי lyse תאי דם אדומים (γ-hemolytic). WT אל Tor זנים (N16961 ו C6706) ו נציג אל ור גירסאות (MQ1795 ו BAA-2163) להפריש אנזימים hemolytic, אשר הביא לאזור שקופה של סיקול סביב נקודת החיסון (β-hemolytic). צלחות הודגרו בגיל 37° C במשך 48 שעות. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

איור 6
איור 6: קביעת תנועתיות באמצעות לוחות אגר ניידות. האזור של תנועתיות צוין על ידי שינוי צבע ויזואלי של TTC מלח אשר הופך מאדום לאדום כאשר מטבוליזם, המציין היכן חיידקים עברו. WT הקלאסי O395 (10 מ"מ) ו WT אל טור זן C6706 (15 מ"מ) הוכיחו תנועתיות מינימלית, ואילו אל הטור N16961 (21 מ"מ) ונציג אל וריאנטים (MQ1795 (25 מ"מ) ו BAA-2163 (29 מ"מ) ) הפגינו תנועתיות יתר ביחס ל- O395 ו- C6706. צלחות הודגרו על 37 מעלות צלזיוס במשך 18 שעות. בבקשה תלחץכאן כדי להציג גרסה גדולה יותר של דמות זו.

איור 7
איור 7: Voges-Proskauer Assay. ייצור Acetoin באמצעות תסיסה גלוקוז נקבע באמצעות Assay Voges-Proskauer. WT קלאסי זן O395 ו נציג אל וריאנטים אל Tor (MQ1795 ו BAA-2163) לא לייצר אצטון כתוצאה תסיסה גלוקוז (שלילי). WT אל זנים Tor (N16961 ו C6706) הפיק את התוצר אצטון והוא יכול להיות דמיינו על ידי שינוי צבע אדום עמוק (חיובי). צינורות הודגרו בטמפרטורת החדר למשך 4 שעות. אנא לחץ כאן כדי להציג גרסה גדולה יותר של דמות זו.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

של מעל 200 מזוהה V. Cholerae serogroups, רק O1 ו O139 יש פוטנציאל מגיפה. ניתן לחלק את הסרוגרופ O1 לשני ביו-טיפוסים: קלאסית ואל טור. עם זאת, זנים היברידיים, הנקראים אל ור גורפים 13 , 17 , התברר כי בעלי רקע ביוטיפ אל Tor, ומאפיינים קלאסיים הנמל 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 . הפרוטוקולים המתוארים בכתב יד זה נועדו לספק לחוקרים, המעוניינים לאפיין ו / או להבחין בין מבודדים קליניים ולא קליניים שונים של V. cholerae, עם אמיניםרב assay מערכת זיהוי. שימוש רב מהימן assay מערכת זיהוי כחלופה היא שיפור מעל בעבר הוקמו יחיד assay מערכות זיהוי ומסכים גנטית אינטנסיבית עבודה. כל מבחני genotypic ו פנוטיפי צריך לכלול WT קלאסית זן O395 ו WT אל זנים C6706 ו N16961 להשוואה ( טבלה 1 ). בעוד הזנים הקלאסיים ו El Tor ביוטיפ כלולים עבור התייחסות, מבודד, כגון MQ1795 ו BAA-2163 כלולים במחקר שלנו, יכולים להציג פרופילים פנוטיפי מ ביוטיפ או ( איור 2 , איור 3 , איור 4 , איור 5 , איור 6 , איור 7 , טבלה 2 ), המדגים את הצורך בניתוח של תכונות גנוטיפיות ופנוטיפיות רבות לאפיון אמין. כל פרוטוקולים צריך להתבצע aseptical26 בטמפרטורת החדר, אלא אם צוין אחרת. אשר Cholerae הוא רמה 2 של Biosafety 2 (BSL-2) פתוגן כי הוא סוכן etiological של קטלני מחלה קטלנית קטלני; טיפול נאות וסילוק של כל החומרים ומוצרי הפסולת חייבים להיות נאכפים לפי תקנות מוסדיות, מקומיות, מדינה ופדרליות.

הכנה של כל חומרי התקשורת ואת ריאגנטים חייב להתבצע באמצעות ריאגנטים כיתה אנליטית ו ultrapure מים deionized לרגישות מינימלית של 18 MΩ ס"מ. לפני עיבוד, התקשורת צריכה להיות מוכנה ומותר יבש מספיק (1-2 ימים); לוחות נחשבים יבש מספיק כאשר נוזל נשאר על פני השטח של אגר. בשל טווח המוטציה ואזורי הסילוק המקיפים את הגידול החיידקי, לוחיות הניידות והחלביות צריכות להיות מוכנות במנות פטרי גדולות (150 מ"מ x 15 מ"מ) עד 50 מ"ל לכל צלחת, וניתן לאחסן אותן עד שבוע עטוף בפלסטיק , LiD בצד למטה ב 4 מעלות צלזיוס. בנוסף, ריכוז אגר של לוחות התנועה יכול להיות מותאם להאט את תנועתיות; עם זאת, לא מומלץ יעלה על 3 גרם של אגר לכל פתרון 500 מ"ל, כמו זה יהיה להפחית באופן משמעותי את התנועה הכללית כך ההבדלים לא יהיה ניתן לצפייה. כל שאר התקשורת צלחת צריך להיות מוכן כ 25 מ"ל לכל צלחת בגודל סטנדרטי פטרי צלחות (100 מ"מ x 15 מ"מ) והוא יכול להיות מאוחסן עד שישה חודשים עטוף פלסטיק, בצד המכסה למטה ב 4 מעלות צלזיוס. להכנת צלחות פולימקסין B, חשוב לאפשר מדיה מותכת להתקרר לאחר מעוקר לפני הוספת polymyxin B, כמו חום מוגזם יכול להשפיל אנטיביוטיקה. צלחות Polymyxin B ניתן לאחסן עד 3 חודשים עטוף פלסטיק, המכסה בצד למטה ב 4 מעלות צלזיוס. הבדיקות שנדונו בכתב יד זה דורשות יום לצמיחה של מושבה אחת (12-16 שעות), יום נוסף לצמיחה של תרבויות לילה (12-16 שעות), ויום שלישי לשיקולים של גנוטיפי (~ 4 שעות עבור DN כרומוזומליבידוד ו 3 שעות עבור PCR) או מבחני פנוטיפי (18-48 ח ', טבלה 2 ). לפני הניתוח הביוכימי של מבחני פנוטיפי המתוארים בכתב יד זה, תרבויות יש לשטוף 1x PBS כדי למנוע תרבות שיורית התקשורת carryover מתוצאות מוטה. בנוסף, polyyxin B, ציטראט, פעילות פרוטאז, המוליזה, מבחני התנועה עשוי להיות מחוסן בו זמנית באמצעות תרבות לילה שטף אחד. כאשר מציגים מדיה מצופה, מתיז של תרבויות עשוי להתרחש והוא יכול לגרום זיהום לחצות בין זנים. כדי למנוע מתיז, למנוע לחלוטין פולטת תרבות פיפטה, במקום להפסיק את פליטת התרבות בתחנה הראשונה של פיפטה. בנוסף, לאפשר כתמים לספוג באופן מלא לתוך פני אגר לפני הדגירה, ולוודא לא לנקב את אגר, אשר יכול להשפיע על התוצאות. מבחני פנוטיפי המביאים לאזורי סריקה ( איור 4 , איור 5 , טבלה 2)) ו / או תנועתיות ( איור 6 , טבלה 2 ) סביב הנקודה של חיסון, צריך להיות מרווח מרבי כדי למנוע מיזוג של אזורים של סיקול או צמיחה, בהתאמה, שבו בקטרים ​​בהתאמה ניתן למדוד לניתוח השוואתי. לאחר הדגירה פעמים, מבודדים ניתן הדמיה ונותחו ביחס זנים התייחסות ביוטיפ (WT קלאסי O395, WT אל Tor C6706, ו ​​WT אל Tor N16961).

המסכים הגנטיים מבוססי PCR באמצעות רצף המתואר בכתב היד הזה ניתן להשתמש כדי לזהות את הרקע הבודד של הבודד ביחס ctxB ו tcpA , בעקבות הגברה הראשונית PCR. הנחיות סטנדרטיות רצף דורשים כמות מסוימת של מוצר PCR בהתאם לגודל של האזור מוגבר (580 bp עבור ctxB ו 1420 bp עבור tcpA ), ועל הגדרת התגובות, פרוטוקולים הוקמה ניתן לעקוב. בקצרה, קדימה הפרט וראוורור רצף התגובות צריך להיות מוכן עם 3-5 pmol של פריימר / תגובה, ואת נפח צריך להיות מותאם μl 20 עם מים ultrapure סטרילית צינור microcentrifuge 1.5 מ"ל. לסיוע בעיצוב פריימר עבור הגברה PCR ו רצף, כלי עיצוב פריימר NCBI http://www.ncbi.nlm.nih.gov/tools/primer-blast/ יכול להיות מנוצל. הגברה מוצלחת ורצף של ctxB ו- tcpA הושגו באמצעות הפריימרים הבאים (5 '→ 3'): ctxB- קדימה GGGAATGCTCCAAGATCATCGATGAGTAATAC, ctxB הפוך CATXCGAACCACAAAAACTCTTACTGAGG, tcpA - קדימה CCGCACCAGATCCACGTAGGTGGG, tcpA - הפוך GTCGGTACATCACCTGCTGTGGGGGCAG. יש לציין כי כל אזור קידוד של ctxB נשמר על פני שני ביוטיפים למעט עמדות בסיס 115 ו 203 (שניהם ציטוזין קלאסית ו תימין באל טור). בנוסף, ב tcpA , שינויי בסיס מרובים נשמרים בין biotypes כי דעפר על פני שני ביוטיפים ( טבלה 1 ), אשר ניתן להשתמש בהם כדי לעזור להבחין בין biotypes.

במחקרים מעבדה רבים הקשורים אורגניזם מודל V. Cholerae, תחזוקה נכונה וטכניקות culturing הם קריטיים 27 . שיעורי הצמיחה של V נפוץ. Cholerae ביוטיפ זנים התייחסות, כגון WT קלאסית זן O395 ו WT אל Tor זן N16961, יכול לספק תובנה שימושית אפיון אל מבודדים אל Tor משתנה ( איור 1 : טבלה 2 ). בגלל שיעורי הצמיחה המשתנים על פני V. Cholerae מבודד, חשוב לקחת קריאת ספקטרופוטומטר קריאות בכל שעה עד התרבויות להגיע עכירות מקסימלית במהלך השלב נייח מאוחר. אמצע המוות עד שלב מאוחר לא יכול להיות דמיינו בשל הרמה עכירות הנובעות עודף פסולת הסלולר. דילול 1: 4 של תרבות סטרילית L B תוצרת צריכה להתבצע כדי להשיג עקומת צמיחה מלאה ולשמור על דיוק של המכשיר, כמו הקריאה ספיגת שיא ב OD 600 ≈ 1.0. בעת ביצוע עקומות הצמיחה על זנים מרובים, קריאות ספיגה צריך להיות מתוזמן כ 5 דקות בנפרד עבור כל זן כדי להבטיח עקביות בין הקריאות. הבנת V. Cholerae ביוטיפ שיעורי הצמיחה הם קריטיים עבור חקירות רבות, כולל ארסיות ביטוי גנים מחקרים, ניתוח של פעילויות מטבוליות, ראוי culturing ותנאי אחסון. עבור ניתוח שלאחר מכן, תרבויות לילה צריך להיות מעובד ביומן מאוחר בשלב נייח מוקדם של צמיחה (12-16 שעות) כדי למקסם את צמיחת התאים עדיין לשמור על שלמות הסלולר.

התנאים התרבויות עבור זנים קלאסיים אל טור ביוטיפ דומים, עם זאת, ניתוח של ביטוי גנים ארסיות ב V. Cholerae דורש ביוטיפ ספציפי ארסיות גרימת תנאיםRef. "19. שני הגורמים העיקריים ארסיות CT ו- TCP, נשלטים על ידי הרגולטור הראשי ToxT, והם באים לידי ביטוי אופטימלי בתנאי צמיחה ספציפיים, למשל, תחת אל Tor ארסיות גרימת התנאים ToxT ניתן לנתח על ידי עיבוד תמצית התא כולו ( WC), או גלולה התא, בשעה 3.5 שעות, בעוד ביטוי CT ו- TCP ניתן לנתח על ידי עיבוד supernatant ללא תאים ו WCE ב 7.5 שעות, בהתאמה 8 , 20. תכונות גנוטיפיות שונות פנוטיפי שהודגם לאורך כתב היד הזה מלמדים כיצד מגוון רחב של ביוטיקים מסוג Cholerae יכול להיות, ולהמחיש את הצורך חלופה בשימוש בעבר אפיון יחיד ביוטיפ assay.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

למחברים אין מה לחשוף.

Acknowledgements

מחקר נתמך על ידי ניו המפשייר- INBRE באמצעות פרס פיתוח מוסדי (IDeA), P20GM103506, מהמכון הלאומי למדעי הרפואה הכללית של NIH.

Materials

Name Company Catalog Number Comments
1 kb DNA Ladder New England Biolabs N3232S https://www.neb.com/products/n3232-1-kb-dna-ladder
60% Glycerol Calbiochem 356352 http://www.emdmillipore.com/US/en/product/Glycerol%2C-Molecular-Biology-Grade---CAS-56-81-5---Calbiochem,EMD_BIO-356352
Agar Becto, Dickinson and Co. 214030 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=214030&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D214030%26typeOfSearch%3DproductSearch
Agar with brain-heart infusion Becto, Dickinson and Co. 237500 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=237500&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D237500%26typeOfSearch%3DproductSearch
Agarose Peqlab 732-2789 https://de.vwr.com/store/catalog/product.jsp?catalog_number=732-2789&_DARGS=/store/cms/de.vwr.com/de_DE/header_2016111711383215.jsp_AF&_dynSessConf=1766917479792147141&targetURL=/store/catalog/product.jsp%3Fcatalog_number%3D732-2789&lastLanguage=en&/vwr/userprofiling/EditPersonalInfoFormHandler.updateLocale=&_D%3AcurrentLanguage=+&currentLanguage=en&_D%3AlastLanguage=+&_D%3A/vwr/userprofiling/EditPersonalInfoFormHandler.updateLocale=+
Anhydrous K2HPO4 Fisher Scientific P288-500 https://www.fishersci.com/shop/products/potassium-phosphate-dibasic-anhydrous-crystalline-powder-certified-acs-fisher-chemical-5/p288500?searchHijack=true&searchTerm=P288500&searchType=RAPID
Blood Agar Plates Remel R01200 Store at 4 °C;  http://www.remel.com/Catalog/Item.aspx?name=Blood+Agar
Boric Acid Fisher Scientific A73-500 https://www.fishersci.com/shop/products/boric-acid-crystalline-certified-acs-fisher-chemical-6/a73500?searchHijack=true&searchTerm=A73500&searchType=RAPID
Bromothymol Blue Fisher Scientific B388-10 https://www.fishersci.com/shop/products/bromothymol-blue-certified-acs-fisher-chemical/b38810?searchHijack=true&searchTerm=B38810&searchType=RAPID
Cirtric acid ·H2O Fisher Scientific S72836-3 https://www.fishersci.com/shop/products/citric-acid-monohydrate-4/s728363#?keyword=s728363
Deoxynucleotide (dNTP) Solution Kit New England Biolabs N0446S Store at -20 °C;  https://www.neb.com/products/n0446-deoxynucleotide-solutionset
Disodium EDTA Fisher Scientific S311-500 https://www.fishersci.com/shop/products/ethylenediaminetetraacetic-acid-disodium-salt-dihydrate-crystalline-certified-acs-fisher-chemical-7/s311500?searchHijack=true&searchTerm=S311500&searchType=RAPID
DNA Clean & Concentrator™ -25 Kit Zymo Research D4007 http://www.zymoresearch.com/dna/dna-clean-up/zymoclean-gel-dna-recovery-kit
GelGreen Nucleic Acid Stain Biotium 41005 https://biotium.com/product/gelgreentm-nucleic-acid-gel-stain-10,000x-in-water/
Genesys 10SUV-VIS Spectrophotometer Thermo Scientific 840-208100 https://www.thermofisher.com/order/catalog/product/840-208100?ICID=search-840-208100
Gentra Puregene Yeast/Bact. Kit Qiagen 158567 https://www.qiagen.com/us/shop/sample-technologies/dna/dna-preparation/gentra-puregene-yeastbact-kit/#orderinginformation
HCl Fisher Scientific A144-212 Corrosive;  https://www.fishersci.com/shop/products/hydrochloric-acid-certified-acs-plus-fisher-chemical-10/a144212?searchHijack=true&searchTerm=A144212&searchType=RAPID
KCl Fisher Scientific P217-500 https://www.fishersci.com/shop/products/potassium-chloride-crystalline-certified-acs-fisher-chemical-4/p217500?searchHijack=true&searchTerm=P217500&searchType=RAPID
KH2PO4 Fisher Scientific P285-500 https://www.fishersci.com/shop/products/potassium-phosphate-monobasic-crystalline-certified-acs-fisher-chemical-5/p285500?searchHijack=true&searchTerm=P285500&searchType=RAPID
KOH Fisher Scientific P250-500 https://www.fishersci.com/shop/products/potassium-hydroxide-pellets-certified-acs-fisher-chemical-5/p250500?searchHijack=true&searchTerm=P250500&searchType=RAPID
Le Loop Decon Labs Inc. MP190-25 http://deconlabs.com/products/leloop/
Le Stab Decon Labs Inc. MP186-5 http://deconlabs.com/products/lestab/
MgSO4·7H2O Fisher Scientific M63-500 https://www.fishersci.com/shop/products/magnesium-sulfate-heptahydrate-crystalline-certified-acs-fisher-chemical-3/m63500?searchHijack=true&searchTerm=M63500&searchType=RAPID
Mini-Sub Cell GT Horizontal Electrophoresis System Bio Rad Labs 1704406 http://www.bio-rad.com/en-us/product/mini-sub-cell-gt-cell?WT.srch=1&WT.mc_id=aw-cbb-NA-sub_cell_systems_brand_gold&WT.knsh_id=7eb1981f-a011-42a3-aece-1236ff453373
MR-VP Broth Difco 216300 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=216300&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3Dmr-vp%2Bmedium%26typeOfSearch%3DproductSearch
Na2HPO4 Fisher Scientific S374-500 https://www.fishersci.com/shop/products/sodium-phosphate-dibasic-anhydrous-granular-powder-certified-acs-fisher-chemical-5/s374500?searchHijack=true&searchTerm=S374500&searchType=RAPID
NaCl Fisher Scientific S271-10 https://www.fishersci.com/shop/products/sodium-chloride-crystalline-certified-acs-fisher-chemical-6/s27110?searchHijack=true&searchTerm=S27110&searchType=RAPID
NaHCO3 Fisher Scientific S233-500 https://www.fishersci.com/shop/products/sodium-bicarbonate-powder-certified-acs-fisher-chemical-5/s233500?searchHijack=true&searchTerm=S233500&searchType=RAPID
NaNH4HPO4·4H2O Fisher Scientific S218-500 https://www.fishersci.com/shop/products/sodium-ammonium-phosphate-tetrahydrate-crystalline-certified-fisher-chemical/s218500?searchHijack=true&searchTerm=S218500&searchType=RAPID
NanoDrop Lite Spectrophtometer Thermo Scientific ND-LITE-PR https://www.thermofisher.com/order/catalog/product/ND-LITE-PR?ICID=search-ND-LITE-PR
Nonfat dry milk Nestle Carnation N/A N/A
Peptone Becto, Dickinson and Co. 211677 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=211677&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D211677%26typeOfSearch%3DproductSearch
Petri Dishes (100 mm x 15 mm) Fisher Scientific FB0875712 https://www.fishersci.com/shop/products/fisherbrand-petri-dishes-clear-lid-12/fb0875712#?keyword=FB0875712
Petri Dishes (150 mm x 15 mm) Fisher Scientific FB0875714 https://www.fishersci.com/shop/products/fisherbrand-petri-dishes-clear-lid-12/fb0875714?searchHijack=true&searchTerm=FB0875714&searchType=RAPID
Polymyxin B sulfate salt Sigma-Aldrich P1004-10MU Store at 2-4 °C; http://www.sigmaaldrich.com/catalog/product/sial/p1004?lang=en&region=US
Taq DNA Polymerase New England Biolabs M0273S Store at -20 °C; https://www.neb.com/products/m0273-taq-dna-polymerase-with-standard-taq-buffer
Taq Reaction Buffer New England Biolabs M0273S Store at -20 °C;  https://www.neb.com/products/m0273-taq-dna-polymerase-with-standard-taq-buffer
Thermal Cycler Bio-Rad C1000 Touch™  Bio Rad Labs 1840148 http://www.bio-rad.com/evportal/evolutionPortal.portal?_nfpb=true&_pageLabel=search_page&sfMode=search&sfStartNumber=1&clearQR=true&js=1&searchString=1840148&database=productskus+productcategories+productdetails+abdProductDetails+msds+literatures+inserts+faqs+downloads+webpages+assays+genes+pathways+plates+promotions&tabName=DIVISIONNAME
Triphenyltetrazolium chloride Alfa Aesar A10870 https://www.alfa.com/en/catalog/A10870/
Tris Base Fisher Scientific BP152-1 https://www.fishersci.com/shop/products/tris-base-white-crystals-crystalline-powder-molecular-biology-fisher-bioreagents-7/bp1521?searchHijack=true&searchTerm=BP1521&searchType=RAPID
Tryptone Becto, Dickinson and Co. 211705 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=211705&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D211705%26typeOfSearch%3DproductSearch
Yeast Extract Becto, Dickinson and Co. 212750 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=212750&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D212750%26typeOfSearch%3DproductSearch
α-napthol MP Biomedicals 204189 http://www.mpbio.com/product.php?pid=05204189

DOWNLOAD MATERIALS LIST

References

  1. Shimada, T., et al. Extended serotyping scheme for Vibrio cholerae. Curr. Microbiol. 28, (3), 175-178 (1994).
  2. Yamai, S., Tadayuki, O., Toshio, S., Yasuji, K. Distribution of serogroups of Vibrio cholerae non-O1 non-O139 with specific reference to their ability to produce cholera toxin, and addition of novel serogroups. Jpn. J. Infect. Dis. 71, (10), 1037-1045 (1997).
  3. Karaolis, D. K., Lan, R., Reeves, P. R. The sixth and seventh cholera pandemics are due to independent clones separately derived from environmental, nontoxigenic, non-O1 Vibrio cholerae. J. Bacteriol. 177, (11), 3191-3198 (1995).
  4. Albert, M. J., et al. Large epidemic of cholera-like disease in Bangladesh caused by Vibrio cholerae O139 synonym Bengal. Lancet. 342, (8868), 387 (1993).
  5. Barua, D. History of Cholera. Cholera. Barua, D., Greenough III, W. B. Plenum Publishing Corporation. 1-36 (1992).
  6. Morales, R., Delgado, G., Cravioto, A. Population Genetics of Vibrio cholerae. Vibrio cholerae-Genomics and Molecular Biology. Faruque, S. M., Nair, G. B. Caister Academic Press. 29-47 (2008).
  7. Samadi, A. R., Chowdhury, M. K., Huq, M. K., Khan, M. U. Seasonality of classical and El Tor cholera in Dhaka, Bangladesh: 17-year trends. Trans. R. Soc. Trop. Med. Hyg. 77, (6), 853-856 (1983).
  8. Son, M. S., Megli, C. J., Kovacikova, G., Qadri, F., Taylor, R. K. Characterization of Vibrio cholerae O1 El Tor biotype variant clinical isolates from Bangladesh and Haiti, including a molecular genetic analysis of virulence genes. J. Clin. Microbiol. 49, (11), 3739-3749 (2011).
  9. Ghosh-Banerjee, J., et al. Cholera toxin production by the El Tor variant of Vibrio cholerae O1 compared to prototype El Tor and classical biotypes. J. Clin. Microbiol. 48, (11), 4283-4286 (2010).
  10. Ansaruzzaman, M., et al. The Mozambique cholera vaccine demonstration project coordination group. Cholera in Mozambique, variant of Vibrio cholerae. Emerg. Infect. Dis. 10, (11), 2057-2059 (2004).
  11. Ansaruzzaman, M., et al. Genetic diversity of El Tor strains of Vibrio cholerae O1 with hybrid traits isolated from Bangladesh and Mozambique. Int. J. Med. Microbiol. 297, (6), 443-449 (2007).
  12. Lan, R., Reeves, P. R. Pandemic spread of cholera: genetic diversity and relationships within the seventh pandemic clone of Vibrio cholerae determined by amplified fragment length polymorphism. J. Clin. Microbiol. 40, (1), 172-181 (2002).
  13. Nair, G. B., Faruque, S. M., Bhuiyan, N. A., Kamruzzaman, M., Siddique, A. K., Sack, D. A. New variants of Vibrio cholerae O1 biotype El Tor with attributes of the classical biotype from hospitalized patients with acute diarrhea in Bangladesh. J. Clin. Microbiol. 40, (9), 3296-3299 (2002).
  14. Nair, G. B., et al. Isolation of Vibrio cholerae O1 strains similar to pre-seventh pandemic El Tor strains during an outbreak of gastrointestinal disease in an island resort in Fiji. J. Med. Microbiol. 55, (11), 1559-1562 (2006).
  15. Nair, G. B., Mukhopadhyay, A. K., Safa, A., Takeda, Y. Emerging hybrid variants of Vibrio cholerae O1. Vibrio cholerae—Genomics and Molecular Biology. Faruque, S. M., Nair, G. B. Horizon Scientific Press. 179-190 (2008).
  16. Safa, A., et al. Genetic characteristics of Matlab variants of Vibrio cholerae O1 that are hybrids between classical and El Tor biotypes. J. Med. Microbiol. 55, (11), 1563-1569 (2006).
  17. Nusrin, S., et al. Diverse CTX phages among toxigenic Vibrio cholerae O1 and O139 strains isolated between 1994 and 2002 in an area where cholera is endemic. J. Clin. Microbiol. 42, (12), 5854-5856 (2004).
  18. Carignan, B. M., Brumfield, K. D., Son, M. S. Single nucleotide polymorphisms in regulator-encoding genes have an additive effect on virulence gene expression in a Vibrio cholerae clinical isolate. mSphere. 1, (5), e00253 (2016).
  19. Iwanaga, M., Yamamoto, K., Higa, N., Ichinose, Y., Nakasone, N., Tanabe, M. Culture conditions for stimulating cholera toxin production by Vibrio cholerae O1 El Tor. Microbiol. Immunol. 30, (11), 1075-1083 (1986).
  20. DiRita, V. J., Claude, P., Georg, J., Mekalanos, J. J. Regulatory cascade controls virulence in Vibrio cholerae. Proc. Natl. Acad. Sci. USA. 88, (12), 5403-5407 (1991).
  21. Kovacikova, G., Lin, W., Skorupski, K. Duel regulation of genes involved in acetoin biosynthesis and motility/biofilm formation by the virulence activator AphA and the acetate-responsive Lys-R type regulator AlsR in Vibrio cholerae. Mol. Microbiol. 57, (2), 420-433 (2005).
  22. Vogel, H. J., Bonner, D. M. Acetylornithinase of Escherechia coli: partial purification and some properties. J. Biol. Chem. 218, (1), 97-106 (1956).
  23. Son, M. S., Taylor, R. K. Genetic screens and biochemical assays to characterize Vibrio cholerae O1 biotypes: classical and El Tor. Curr. Protoc. Microbiol. 6A.2.1-6A.2.17 (2011).
  24. Kovacikova, G., Skorupski, K. Regulation of virulence gene expression in Vibrio cholerae by quorum sensing: HapR functions at the aphA promoter. Mol. Microbiol. 46, (4), 1135-1147 (2002).
  25. Wang, Y., et al. The prevalence of functional quorum-sensing systems in recently emerged Vibrio cholerae toxigenic strains. Environ. Microbiol. Rep. 3, (2), 218-222 (2011).
  26. Sanders, E. R. Aseptic laboratory techniques. J. Vis. Exp. (63), e3064 (2012).
  27. Martinez, R. M., Megli, C. J., Taylor, R. K. Growth and laboratory maintenance of Vibrio cholerae. Curr. Protoc. 6A.1.1-6A.1.6 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics