Лабораторные методы, используемые для поддержания и дифференциации биотипов * These authors contributed equally

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

В этой рукописи описываются правильные методы обслуживания Vibrio cholerae в дополнение к серии биохимических анализов, которые в совокупности используются для быстрой и надежной дифференциации между клиническим и экологическим V. Биотипы холеры в лабораторных условиях.

Cite this Article

Copy Citation | Download Citations

Brumfield, K. D., Carignan, B. M., Ray, J. N., Jumpre, P. E., Son, M. S. Laboratory Techniques Used to Maintain and Differentiate Biotypes of Vibrio cholerae Clinical and Environmental Isolates. J. Vis. Exp. (123), e55760, doi:10.3791/55760 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Водная грамотрицательная бактерия Vibrio cholerae является этиологическим агентом холеры инфекционных желудочно-кишечных заболеваний. Из-за глобальной распространенности и тяжести этого заболевания, V. Cholerae широко изучается как в окружающей среде, так и в лабораторных условиях, требуя надлежащего обслуживания и методов культивирования. Классический и El Tor - два основных биотипа, которые составляют V. Cholerae O1, каждая из которых демонстрирует уникальные генотипические и фенотипические характеристики, которые обеспечивают надежные механизмы биотипической характеристики и требуют различной вирулентности, вызывающей условия культивирования. Независимо от биотипа причинного штамма для любой данной инфекции или вспышки, стандартное лечение заболевания включает в себя регидратационную терапию, дополненную режимом антибиотиков. Однако классификация биотипов может потребоваться для лабораторных исследований и может иметь более широкие последствия в биомедицинской области.В начале 2000-х годов были идентифицированы клинические изоляты, которые проявляют генотипические и фенотипические признаки как от классических, так и от биотипов El Tor. Недавно идентифицированные гибриды, называемые вариантами El Tor, вызвали идентификацию биотипа клинической и экологической изоляции, чтобы стать более сложными, чем предыдущие традиционные протоколы идентификации одного теста. В дополнение к описанию V. Холеры общего обслуживания и методов культивирования, эта рукопись описывает серию генетических экранов на основе гена ( ctxB и tcpA ) на основе ПЦР и фенотипические анализы (устойчивость к полимиксину B, метаболизм цитрата, протеолитическая активность, гемолитическая активность, подвижность и метаболизм глюкозы через Voges- Proskauer assay), все вместе используемые для характеристики и / или различия между классическими и El Tor биотипами. Вместе эти анализы обеспечивают эффективный систематический подход, который будет использоваться в качестве альтернативы или, кроме того, для дорогостоящих трудоемких экспериментов в характеристикеV. Холеры клинических (и экологических) изолятов.

Introduction

Холера - это заболевание дистального тонкого кишечника, вызванное потреблением загрязненной пищи или воды, содержащей водную грамотрицательную бактерию Vibrio cholerae . Симптомы холеры включают рвоту и неконтролируемую водянистую диарею, что приводит к серьезному обезвоживанию, которое, если его не лечить должным образом, приведет к смерти. V. Холеру можно разделить на более чем 200 серогрупп, основанных на структуре O-антигена липополисахарида клеточной поверхности. Однако только 2 серогруппы O1 и O139 продемонстрировали эпидемический или пандемический потенциал 1 , 2 . Более того, серогруппа O139 была в основном изолирована от Юго-Восточной Азии 3 , 4 , а серогруппа O1 распределена во всем мире. Кроме того, серогруппу O1 можно разделить на 2 основных биотипа: классический и El Tor. Классический биотип отвечал за первые 6 пандемий холерыС 1817 по 1923 год. Продолжающаяся седьмая пандемия является результатом биотипа Эль-Тор, который во всем мире смещает классический биотип в окружающую среду 5 , 6 , 7 . Недавно возникли штаммы, которые содержат отличительные характеристики как классических, так и биотипов El Tor 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 и с тех пор назывались вариантами El Tor 13 , 17 . Некоторые варианты El Tor продемонстрировали повышенную способность вирулентности с более быстрым и тяжелым прогрессированием заболевания, чем ранее наблюдалось, подчеркиваяНеобходимость более комплексного подхода к идентификации агентов и профилактике и лечению болезней 8 , 9 , 18 . Хотя идентификация биотипа не сразу диктует лечение, дальнейшие улучшения в развитии вакцины и будущих терапевтических агентах могут выиграть от различия биотипов.

Первая серия протоколов, перечисленных здесь, позволит исследователям правильно поддерживать V. Штаммов холеры в лабораторных условиях. Последовательность и последующий анализ требуют подготовки запасов и роста изолятов, которые не зависят от биотипа. Однако для оптимального индуцирования экспрессии генов вирулентности необходимы независимые биотипические методы культивирования 19 . Кроме того, в этой рукописи изложена подготовка к различным генетическим и биохимическим анализам.

Толерант холеры (КТ) и токсин co-reGulated pilus (TCP) - два основных фактора вирулентности, контролируемых главным регулятором ToxT в обоих биотипах V. Cholerae O1 серогруппа 20 . CT - двудольный токсин, состоящий из пяти CtxB Субъединиц, окружающих одну субъединицу CtxA, и отвечает за быструю потерю электролита, связанную с холерой. TCP является типом IV пилота, закодированным операндом tcp ( tcpABQCRDSTEF ), и участвует в прикреплении и колонизации дистального тонкого кишечника. TcpA является первым геном оперона tcp , который кодирует отдельные субъединицы пилина, необходимые для построения пилюса 8 . Последовательность генов для ctxA полностью сохраняется между классическими и биотипами El Tor, тогда как ctxB и tcpA различаются по двум биотипам, но сохраняются в каждом биотипе 8 . CtxB полностью сохраняется между биотипами, за исключением двух базовых позиций(115 и 203). В биотипе El Tor тимин находится в базовых положениях 115 и 203, тогда как классический биотип содержит цитозин на этих основаниях. TcpA полностью сохраняется в каждом биотипе, но отличается на нескольких основаниях между биотипами. Эти генетические различия служат в качестве первичных идентификационных маркеров биотипа, и после секвенирования продукта амплификации полимеразной цепной реакции (ПЦР), включающего эти сайты, изолятные последовательности можно сравнить с классическим классическим O395 дикого типа (WT) или WT El Tor N16961 для определения фона биотипа CT и TCP, соответственно, в данном изоляте V. cholerae .

Разработаны многочисленные протоколы для описания фенотипических различий между классическими и биотипами El Tor 21 , 22 , 23 . Полимиксин В представляет собой пептидный антибиотик, который ставит под угрозу целостность наружной клеточной мембраны в грамотрицательном бакеТерия и полимиксина В можно визуализировать с помощью анализа резистентности к полимиксину В 21 . Цитрат является основным субстратом цикла Креба, и способность метаболизировать цитрат в качестве единственного источника углерода может быть определена с использованием анализа метаболизма цитрата 22 . HapR кодирует глобальный регулятор и главный регулятор кворума в V cholerae, HapR, который связывается с различными областями промотора и регулирует экспрессию гена и оперона 24 . Некоторые патогенные штаммы V. cholerae имеют естественную мутацию смены кадров в гене hapR , что привело к потере этой зависимой от плотности регуляции экспрессии гена вирулентности 24 , 25 . Измерение активности протеазы, регулируемой HapR, с использованием молочных агаровых сред позволяет исследователю определить, содержит ли конкретный изолят функциональный HapR 23 .Анализы гемолиза для определения способности штамма выделять гемолитические ферменты, которые лизят эритроциты; Степень гемолиза может быть визуализирована на пластинах 23 агара. Подвижность часто ассоциируется с вирулентностью у V. cholerae и может быть проанализирована с использованием пластинчатых агаровых пластин 23 . Анализ Voges-Proskauer проверяет способность штамма ферментировать глюкозу в качестве единственного источника углерода и продуцировать ацетоин побочного продукта 21 . С появлением вариантов El Tor трудно предсказать результаты любого данного фенотипического анализа без обширного генотипического скрининга и до выведения биотипического фона V. Холеры, рекомендуется выполнить эту сборку анализов 23 и сравнить результаты с ссылочными штаммами, как в таблице 2 .

В этой связи мы разработали ряд протоколов, совместно использующих aforemeГенотипических и фенотипических анализов для более полного подхода к характеристике V. Холерные биотипы. Кроме того, мы описали генотипические и фенотипические различия известных V. Cholerae El Tor (MQ1795 и BAA-2163) по сравнению с обычно используемыми ссылочными штаммами биотипов (классический WT классический O395, WT El Tor C6706 и WT El Tor N16961, таблица 1 ). Появление вариантов El Tor показало проблемы надежности ранее использованных протоколов характеризации биотипа одного анализа; Однако эта система идентификации с множественным анализом позволит обеспечить более надежную характеристику клинического и экологического V. Изолятов холеры .

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Примечание: соображения времени для каждого анализа должны быть сделаны, поскольку отдельные медийные препараты требуют разного времени. Например, твердые агаровые пластины должны быть достаточно охлаждены и сушатся (1-2 дня). Дополнительные соображения времени ( то есть рост культуры колоний и ночной жизни) указаны в каждом протоколе и приведены в таблице 2 .

1. Подготовка СМИ

  1. 1x фосфатный буферный солевой раствор (PBS)
    1. Взвешивают 4,0 г NaCl, 0,1 г KCl, 0,72 г Na 2 HPO 4 и 0,12 г KH 2 PO 4 . Объедините компоненты в колбе Эрленмейера емкостью 1 л, отрегулируйте объем до 500 мл деионизированной водой, отрегулируйте pH до 7.2 с помощью pH-метра и добавьте HCl по каплям к раствору, а автоклав или фильтр стерилизуют с использованием фильтра 0,22 мкм. 1x PBS можно хранить при комнатной температуре на неопределенный срок.
      ОСТОРОЖНО: HCl представляет собой концентрированную кислоту и должна обрабатываться в соответствии сК институциональным, местным, государственным и федеральным нормам. Для получения соответствующих инструкций по обращению обращайтесь к паспорту безопасности, предоставленному изготовителем.
  2. Бульон Лурия-Бертани (LB)
    1. Взвесьте 5,0 г триптона, 2,5 г дрожжевого экстракта и 2,5 г NaCl. Объедините составляющие в 1 л бутылке, отрегулируйте объем до 500 мл деионизированной водой, автоклавом и храните при комнатной температуре в течение 6 месяцев. Для классических условий, вызывающих вирулентность биотипа, отрегулируйте pH до 6,5 с использованием HCl перед автоклавированием.
  3. AKI, содержащий 0,03% (мас. / Об.) NaHCO 3
    1. Для компонента 1 (среда АКИ): взвесьте 7,5 г пептона, 2,0 г дрожжевого экстракта и 2,5 г NaCl. Объедините компоненты в бутылке емкостью 1 л, отрегулируйте объем до 450 мл деионизированной водой и автоклавом. Средство АКИ можно хранить при комнатной температуре в течение 6 месяцев.
    2. Для компонента 2 (NaHCO 3 ): взвесить 1,5 г NaHCO 3 и отрегулировать объемДо 50 мл деионизированной водой в стерильном везикуле. Фильтр стерилизует NaHCO 3 с использованием фильтра 0,22 мкм. NaHCO 3 должен быть приготовлен непосредственно перед использованием.
    3. Асептически объединить два компонента, создающих коэффициент 1:10, путем фильтрации компонента 2 в компонент 1 перед использованием.
  4. Агарные пластины Luria-Bertani (LB)
    1. Взвесьте 5,0 г триптона, 2,5 г дрожжевого экстракта, 2,5 г NaCl и 7,5 г агара. Объединить компоненты в колбе Эрленмейера емкостью 1 л, отрегулировать объем до 500 мл деионизированной водой, автоклавировать и приготовить в стандартных стерильных чашках Петри размером 100 мм х 15 мм. Плакированные носители можно хранить в пластике на срок до 6 месяцев, приподняв крышку до 4 ° C.
  5. Пластины агара LB с полимиксином B
    1. Для компонента 1 (агар LB): взвесить 5,0 г триптона, 2,5 г дрожжевого экстракта, 2,5 г NaCl и 7,5 г агара. Объедините составляющие в колбе Эрленмейера емкостью 1 л, отрегулируйте объем до 500 мл wiЙ деионизированной воды и автоклава.
    2. Для компонента 2 (полимиксин В): растворить полимиксин В в деионизированной воде в стерильной 2 мл микроцентрифужной пробирке до концентрации 50 000 МЕ / мкл и стерилизовать фильтр с использованием фильтра 0,22 мкм.
    3. Как только компонент 1 охлаждается на ощупь, но еще не затвердевает, асептически добавьте 500 мкл компонента 2 в компонент 1, создавая конечную концентрацию 50 МЕ / мкл и тщательно перемешайте. Подготовьте стерильные чашки Петри стандартного размера 100 мм х 15 мм путем заливки смешанных агаровых сред в чашки Петри. Плакированные носители можно хранить в пластмассе на срок до 3 месяцев, приподняв крышку до 4 ° C.
  6. Минимальные цитратные агар-пластины
    1. Для компонента 1 (агар с бромтимоловым синим): взвесить 7,5 г агара и 0,02 г бромотимола. Объедините компоненты в колбе Эрленмейера емкостью 1 л, отрегулируйте объем до 450 мл деионизированной водой и автоклавируйте смесь.
    2. Для компонента 2 (10x VBMM): вес 1.0 г MgSO 4 7H 2 O, 10,0 г лимонной кислоты H 2 O, 50,0 г безводного K 2 HPO 4 и 17,5 г NaNH 4 HPO 4 4H 2 O. Объединить компоненты в колбе Эрленмейера емкостью 1 л, отрегулировать объем до 500 мл С деионизированной водой и автоклавом или фильтром стерилизуют с использованием фильтра 0,22 мкм. 10x VBMM можно хранить при комнатной температуре до 6 месяцев.
    3. Добавить 50 мл компонента 2 в компонент 1 и приготовить в стандартных стерильных чашках Петри размером 100 мм х 15 мм путем заливки смешанных агаровых сред в чашки Петри. Плакированные носители можно хранить в пластике на срок до 6 месяцев, приподняв крышку до 4 ° C.
  7. Молочные агаровые плиты
    1. Для компонента 1 (молоко): взвесьте 8,0 г немедленного обезжиренного сухого молока в колбе Эрленмейера емкостью 1 л, отрегулируйте объем до 200 мл деионизированной водой и автоклавом.
    2. Для компонента 2 (агар с инфузией сердца и сердца): весят 3,68 г инфузии головного мозга и 6,0 г агара. Объедините conВ 500 мл колбе Эрленмейера, отрегулируйте объем до 200 мл деионизированной водой и автоклавом.
    3. Комбинируйте эти два компонента, выливая компонент 2 в компонент 1 после автоклавирования и тщательно перемешайте. Приготовьте в стерильных чашках Петри 150 мм х 15 мм. Молочные тарелки можно хранить в течение одной недели, завернутые в пластик, приподнятой стороной вниз при 4 ° C. Приготовить в стерильных чашках Петри 150 мм х 15 мм путем заливки смешанных агаровых сред в чашки Петри.
  8. Агаровые плиты подвижности
    1. Для компонента 1 (агар LB): взвесить 5,0 г триптона, 2,5 г дрожжевого экстракта, 2,5 г NaCl и 2,0 г агара. Объедините компоненты в колбе Эрленмейера емкостью 1 л, отрегулируйте объем до 500 мл деионизированной водой и автоклавом.
    2. Для компонента 2 (1% (мас. / Об.) Трифенилтетразолийхлорида, ТТК): весить 0,25 г ТТК. Отрегулируйте объем до 25 мл деионизированной водой в стерильном везикуле и стерилизуйте фильтр, используя фильтр 0,22 мкм. Хранить в течение 6 месяцев при комнатной температуреВ фольге, чтобы минимизировать воздействие света.
    3. Добавить 2,5 мл 1% (мас. / Об.) Стерильного ТТК в автоклавированные среды.
    4. Налейте как можно более толстое вещество (≥50 мл / пластину) в большие стерильные чашки Петри 150 мм х 15 мм. Плакированные носители можно хранить в пластике в течение одной недели, со стороны крышки до 4 ° C. Приготовить в стерильных чашках Петри 150 мм х 15 мм путем заливки смешанных агаровых сред в чашки Петри.
  9. Фогес-Проскауэр (ВП)
    1. Для компонента 1 (бульон Methyl Red-Voges-Proskauer, MR-VP): весить 1,7 г среды MR-VP в колбе Эрленмейера емкостью 500 мл, отрегулировать объем до 100 мл деионизированной водой и автоклавом. Стерильный бульон MR-VP можно хранить при комнатной температуре в течение 6 месяцев.
    2. Для компонента 2 (5% (мас. / Об.) Альфа (α) нафтола): взвесьте 1,0 г α-нафтола в стерильном везикуле и отрегулируйте объем до 20 мл с 95% этанолом. Α-нафтол можно хранить при комнатной температуре в течение 1 недели, обернутой в фольгу, чтобы минимизировать светosure.
    3. Для компонента 3 (40% (мас. / Об.) Гидроксида калия: КОН): взвесить 20,0 г КОН в стерильном везикуле, отрегулировать объем до 50 мл стерильной деионизированной водой. КОН можно хранить в течение 6 месяцев при комнатной температуре в пластиковом сосуде.

2. Техническое обслуживание и рост V. Штаммы холеры

  1. Подготовка и использование замороженных культур
    1. Пелле 1,8 мл жидкой ночной культуры в течение 2 мин путем центрифугирования (≥8,600 × г) в стерильной 2-микронной центрифужной пробирке, удаляли надосадочную жидкость и повторно суспендировали осадок клеток в 900 мкл свежего бульона LB путем пипетирования.
    2. Добавьте 900 мкл стерильного 60% (об. / Об.) Глицерина в культуру и перемешайте путем встряхивания.
    3. Перенесите смесь в стерильную 2-млую криогенную трубку и храните ее неограниченно при -80 ° C.
    4. Чтобы использовать, удалите небольшое количество замороженного материала, используя стерильный цикл инокуляции и полоску для отдельных колоний на LB ag. Немедленно возвращайте замороженный остаток до -80 ° C после использования, чтобы предотвратить полное оттаивание культур. Инкубируйте планшеты, закрывая крышку в течение 12-16 часов при 37 ° C.
  2. Рост ночных культур в жидкой среде
    1. Полоса для одиночных колоний (согласно разделу 2.1.4) из замороженного материала на пластины агара LB. Инкубируйте планшеты, закрывая крышку в течение 12-16 часов при 37 ° C.
    2. Инокулируют 4 мл жидкого бульона LB в стерильной 10 мл культуральной трубке с одной колонией, прикасаясь к поверхности одной колонии стерильной аппликационной палочкой и перенося колонию в жидкий бульон.
    3. Инкубируйте с аэрированием в инкубаторе шейкера при 225 об / мин в течение 12-16 часов при 37 ° C.
  3. Кривая роста
    1. Подготовьте ночную культуру в жидком бульоне LB, как указано ранее в протоколе 2.2.
    2. Сделайте разведение в течение ночи 1: 100 путем переноса 250 мкл ночной культуры до 25 мл свежего бульона LB в стерильной колбе Эрленмейера емкостью 250 мл.
    3. Измерьте оптическую плотность жидких культур при 600 нм (OD 600 ) каждый час, начиная со времени инокуляции (T 0 ).
    4. Инкубируйте 1: 100 разведение ночной культуры с аэрацией в шейкерном инкубаторе при 225 об / мин в течение 30 ч при 37 ° С или пока культура не достигнет максимальной плотности.
    5. График OD 600 против времени и использование линейной регрессии для определения приблизительного времени удвоения для каждого штамма.
  4. El Tor Biotype Вирулентность, вызывающая условия
    1. Полоса для одиночных колоний из замороженного материала на пластины агара LB. Инкубируйте пластины сбоку вниз, в течение 12-16 часов при 37 ° C.
    2. Инокулируют 10 мл среды АКИ, содержащей 0,03% (мас. / Об.) NaHCO 3 с одной колонией.
    3. Инкубируйте культуру без аэрации при 37 ° C в течение 3,5 часов.
    4. Удалите 7 мл культуры и инкубируйте оставшиеся 3 мл культуС аэрацией в шейкерном инкубаторе при 225 об / мин в течение дополнительных 4 часов.
  5. Классические биотипические причины, вызывающие вирулентность
    1. Полоса для одиночных колоний из замороженного материала на пластины агара LB. Инкубируйте планшеты, закрывая крышку в течение 12-16 часов при 37 ° C.
    2. Инокулируют 4 мл жидкого бульона LB (pH 6,5) с одной колонией.
    3. Инкубировать с аэрацией в шейкерном инкубаторе при 225 об / мин в течение 12-16 часов при 30 ° C.
  6. Гранулят промывочной камеры в 1x PBS
    1. Пелле 1,8 мл ночной культуры в течение 2 мин путем центрифугирования (≥8,600 × г) в стерильной 2 мл микроцентрифужной пробирке и удаляют супернатант с использованием пипетки. Повторно суспендируйте клеточный осадок в 1,8 мл 1x PBS путем пипетирования.
    2. Повторите процедуру стирки три раза, а затем окончательную ресуспензию в 1,8 мл 1 × PBS.

3. Характеристика V. Холеры Биотипы

  1. пГенетические экраны на основе CR с использованием ctxB и tcpA
    1. Разработайте набор праймеров, которые отжигают примерно 50-70 б.п. вверх и вниз по течению от начальных и конечных сайтов трансляции ctxB и tcpA, соответственно.
    2. Подготовьте ночную культуру в жидком бульоне LB, как указано ранее в протоколе 2.2.
    3. Изолировать хромосомную ДНК с использованием коммерчески доступного набора, предназначенного для грамотрицательных бактерий. Очищенную хромосомную ДНК можно хранить неограниченно при -20 ° C. Изоляция хромосомной ДНК с использованием имеющихся в продаже наборов обычно занимает около 4 часов.
    4. Используйте микро-объемный спектрофотометр, чтобы гарантировать, что образец хромосомной ДНК имеет высокое качество (A 260/280 > 1,8).
    5. Для каждого изолята хромосомной ДНК готовить полимеразную цепную реакцию (реакции) (ПЦР) на льду в стерильной 200 мкл ПЦР-пробирке (-ях) и амплифицировать области ctxB и tcpA с использованием стандартных компонентов ПЦР: Taq- полимераза и buFfer (или эквиваленты), dNTP-решение и праймеры прямого / обратного действия. Используйте стандартные параметры ПЦР (~ 3 ч). Например, используйте следующий протокол:
      1. Начальная денатурация при 95 ° С в течение 120 с.
      2. Денатурируют при 95 ° С в течение 60 с.
      3. Протравные грунтовки при 60 ° C в течение 45 с.
      4. Промойте при 72 ° С в течение 90 с.
      5. Повторите шаги с 3.1.5.2 по 3.1.5.4 для 34 циклов.
      6. Конечное удлинение 72 ° C в течение 600 с.
      7. Бесконечное удерживание при 4 ° C.
    6. Покрасьте 5 мкл соответствующего продукта (ов) ПЦР с использованием стандартного 6х-гель-гель-гель-красителя и загрузите приблизительно 10 мкл 1 кб-лестницы и 10 мкл продукта ПЦР на 1% -ный агарозный гель в 1 х Трис-Борат-ЭДТА (ТЭР) буфер.
    7. Проведите гель-электрофорез при 130 В, пока фронт красителя не достигнет конца, но не выключится, гель (приблизительно 90 мин). Рекомендуется постоянный мониторинг, так как напряжение и время работы могут меняться в зависимости от оборудования.
    8. После проверкиУспешную ПЦР-амплификацию при ожидаемом размере, очистите оставшиеся 45 мкл продукта (ов) ПЦР с использованием коммерчески доступного набора для очистки и концентрирования ДНК.
    9. Последовательность очищала ПЦР-продукт (ы) с использованием тех же праймеров, которые использовались для амплификации ПЦР, и подготавливалась в соответствии с рекомендациями по локальному секвенированию.
    10. Сравните FASTA-формат последовательностей генов от каждого изолята до опубликованной последовательности, доступной на веб-сайте NCBI (http://www.ncbi.nlm.nih.gov/gene/), путем поиска следующих номеров доступа в поле поиска.
    11. CtxB: (классическая) область между VC0395_A1059 и VC0395_A1060 (El Tor) VC_1456
    12. TcpA: (классический) VC0395_A0353 (El Tor) VC_0828
  2. Фенотипические анализы для классификации биотипов через споттинг
    1. Подготовьте ночную культуру в жидком бульоне LB, как указано ранее в протоколе 2.2.
    2. Вымойте гранулы (я) клеток, как указано в протоколе 2.6.
    3. Используйте пипетку дляПятно 1 мкл промытой культуры на соответствующей среде. Для средних вариантов выбора и инкубации см. Таблицу 2.
  3. Анализ подвижности
    1. Подготовьте ночную культуру (ов) в жидком бульоне LB, как указано ранее в протоколе 2.2.
    2. Вымойте гранулы (я) клеток, как указано в протоколе 2.6.
    3. Инокулируйте пластинки агара подвижности, вставив инокулирующий удар в промытую жидкую культуру и «ударите» вертикально в среду. Между каждой инокуляцией стерилизуйте проволочный наконечник, используя горелку Бунзена, и при ножевом агаре убедитесь, что инокулирующий удар не изгибается, так как это может изменить результаты.
    4. Инкубируйте пластины со стороны крышки вверх в течение 14-24 часов при 37 ° C. Через 14 ч наблюдайте подвижность пластин, чтобы предотвратить разрастание культур.
  4. Анализ Voges-Proskauer (VP)
    1. Подготовьте ночную культуру (ов) в жидком бульоне LB, как указано ранее в протоколе 2.2.
    2. Инокулировать 4Мл метил-красного Voges-Proskauer или бульона MR-VP путем пипетирования 10 мкл предварительно приготовленной ночной культуры в 4 мл бульона MR-VP в стерильной пробирке для культивирования и инкубировать с аэрированием в шейкерном инкубаторе при 225 об / мин в течение 12-16 Ч при 37 ° С.
    3. Добавляют 150 мкл 5% (мас. / Об.) Α-нафтола и 50 мкл 40% (мас. / Об.) КОН до 1 мл аликвоты культуры MP-VP в течение ночи в стерильных пробирках для культивирования соответственно.
    4. Коротко встряхните и дайте постоять при комнатной температуре в течение 4 часов, пока не изменится цвет.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Для правильного обслуживания и использования любого бактериального штамма рекомендуется знать время удвоения напряжения (-ов), которое представляет интерес. Здесь различные темпы роста обычно используемых V. Штаммы холеры были продемонстрированы с помощью кривой роста, а приблизительное время удвоения было рассчитано с использованием линейной регрессии. Варианты WT El Tor N16961 и El Tor MQ1795 продемонстрировали более короткие времена удвоения (~ 1 ч и ~ 1 ч соответственно), чем классический W39 O395 (~ 2 ч) ( рисунок 1 ; таблица 2 ).

V. cholerae генетическая манипуляция и последующий анализ часто основываются на способности правильно различать биотипы. Генетические экраны на основе ПЦР и фенотипические анализы были коллективно реализованы как надежная система для различения биотипов фона V. Холеры клинические и экологическиеsolates; Для представления были включены ссылочные штаммы биотипов (WT classic O395, WT El Tor C6706 и WT El Tor N16961) и представительные варианты El Tor (MQ1795 и BAA-2163) ( таблица 1 ). WT classic O395 продемонстрировал классические последовательности ctxB и tcpA. Напротив, штаммы WT El Tor N16961 и C6706 продемонстрировали последовательности El Tor ctxB и tcpA. Интересно, что MQ1795 и BAA-2163 содержали классическую субъединицу ctxB биотипа, сравнимую с O395, но оба варианта El Tor содержали tcpA, указывающий фон биотипа El Tor ( таблица 1 ). Классический штамм O395 классического биотипа WT показал чувствительность к полимиксину B, в то время как штаммы BOT El Tor biotype (C6706 и N16961) показали резистентность и демонстрировали рост на пластинках агара LB, дополненных полимиксином B. Репрезентативные штаммы варианта El Tor (MQ1795 и BAA-2163) продемонстрировали Аналогичная устойчивость к антибиотику относительно биотипа WT El Tor(C6706 и N16961) ( Рисунок 2 ; Таблица 2 ). Классический штамм O395 с биотипом WT не увеличивался на минимальных носителях цитрата, тогда как штаммы WT El Tor (C6706 и N16961) могли использовать цитрат в качестве источника углерода и демонстрировали рост на минимальных носителях цитрата. Репрезентативные штаммы биотипа El Tor (MQ1795 и BAA-2163) продемонстрировали рост, сравнимый с ростом штаммов биотипа WT El Tor (C6706 и N16961) ( рисунок 3 , таблица 2 ). Классический штамм WT O395 и WT El Tor N16961 обладает нефункциональным HapR и, таким образом, не демонстрирует HapR-регулируемую протеазную активность; WT El Tor штамм C6706 и репрезентативные варианты El Tor (MQ1795 и BAA-2163) являются hapR- позитивно-визуализированными как зона зазора, исходящая от точки инокуляции ( рис. 4 , таблица 2 ). Классический штамм W9 O395 не выделяет гемолитические ферменты и был для этогоE γ-гемолитическими, в то время как штаммы биотипа WT El Tor (C6706 и N16961) и репрезентативные штаммы вариантов El Tor (MQ1795 и BAA-2163) выделяют гемолитические ферменты, которые полностью лизируют эритроциты, окружающие точку инокуляции, и проявляют β-гемолиз ( рис. 5 , таблица 2 ). Подвижность варьируется в пределах и внутри штаммов биотипа; Однако, варианты WT El Tor деформации N16961 и El Tor (MQ1795 и BAA-2163) продемонстрировали гипермобильность по сравнению с относительно менее подвижным классическим штаммом WT O395 и штаммом W6 El Tor C6706 ( рис. 6 , таблица 2 ). Классический штамм WT O395 и репрезентативные варианты El Tor не метаболизировали глюкозу для получения ацетоина, тогда как штаммы штаммов WT El Tor продуцировали ацетоин в качестве побочного продукта ферментации глюкозы, о чем свидетельствует развитие глубокого красного цвета во время анализа Фогеза-Проскауэра ( рисунок 7 , Таблица 2 ).

Напряжение Ген ctxB TCPA Справка
База 115 База 203 Биотип Биотип
O395 С С классический классический 8
C6706 T T El Tor El Tor 8
N16961 T T El Tor El Tor 8
MQ1795 С С классический El Tor 13
BAA-2163 С С классический El Tor 8

Таблица 1: Зависимые генетические отличия биотипов зависимых штаммов Vibrio cholerae . В этой таблице показаны изменения ДНК и относительные положения в генах ctxB и tcpA . WT классические штаммы O395 и WT El Tor N16961 и C6706 являются обычно используемыми ссылочными штаммами биотипа. MQ1795 и BAA-2163 известны варианты El Tor.

анализ заявка Средний выбор инкубация Ожидаемые результаты
O395 C6706 N16961 MQ1795 BAA-2163
2.3) Кривая роста 27 Определяет время удвоения различных штаммов V. cholerae 1.2) Жидкий бульон LB До 30 ч (37 ° С с аэрацией) ~ 2 ч ND * ~ 1 ч ~ 1 ч ND *
3.1) Генетический экран на основе ПЦР с использованием ctxB и tcpA 8 Дифференцирует классический и биоцидный фон El Tor ctxB N / A N / A классический El Tor El Tor классический классический
Различает классический и биоцидный фон El Tor от tcpA N / A N / A классический El Tor El Tor El Tor El Tor
3.2) Сопротивление полимиксину В 21 Чувствительность к антибиотическому полимиксину B 1,5). Пластинки с агаром LB, дополненные полимиксином В 18 ч (37 ° С) - + + + +
3.2) Метаболизм цитрата 22 Способность метаболизировать цитрат в качестве единственного источника углерода 1.6). Минимальные цитратные агаровые пластины 24 ч (37 ° С) - + + + +
3.2) Гидролиза казеина 23 HapR-регулируемая протеазная активность 1.7) Пластины для агара молока 18 ч (37 ° С) - - + + +
3.2) Гемолиз 23 Измерение гемолитической активности Пластины для агара 48 ч (37 ° С) Гамма Бета Бета Бета Бета
3.3) Движение 23 Измеряет степень подвижности 1,8) Пластины агара подвижности 14-24 ч (37 ° С) 10 мм 15 мм 21 мм 25 мм 29 мм
3.4) Фоги-Проскауэр 21 Способствует ферментации гликоза и продуцирует ацетоин в качестве побочного продукта 1.9) Жидкость Voges-Proskauer medium До 4 ч (комнатная температура) - + + - -
Примечание: «ND *» обозначает не определено; «+» Обозначает положительный результат; «-» обозначает отрицательный результат

Таблица 2: Резюме генетических и фенотипических анализов, используемых для Vibrio cholerae Biotype Distinction. В этой таблице представлены различные генетические и фенотипические анализы, приложения и ожидаемые результаты, которые в совокупности используются для дифференциации классических и биотипов El Tor, используемых в этом исследовании. Номера протоколов и ссылки на конкретные протоколы указываются в столбце «Анализ». «ND *» означает « Не определено»; «+» Обозначает положительный результат; «-» обозначает отрицательный результат.

Рисунок 1
Рисунок 1: V. Cholerae Кривая роста WT Классический O395, WT El Tor N16961 и El Tor Variant MQ1795. Темпы роста ссылочных штаммов биотипов (классический W39 и WT El Tor N16961 WT) и представитель El Tor Variant MQ1795, выращенные в бульоне LB с аэрированием при 37 ° C, анализировали путем измерения OD 600 eОчень час начинается с T 0 . Кривые роста выполнялись на 8 независимых экспериментальных репликах, причем каждый репликат представлял собой независимое событие культивирования для каждого исследования. WT El Tor деформация N16961 и вариант El Tor MQ1795 продемонстрировали более короткие времена удвоения (~ 1 ч и ~ 1 ч соответственно) относительно классического штамма W39 O395 (~ 2 ч), что наблюдалось более длительным удвоением времени. Нажмите здесь, чтобы просмотреть увеличенную версию этого рисунка.

фигура 2
Рисунок 2: Определение резистентности к полимиксину В с использованием агара LB, дополненного полимиксином B. Устойчивость к полимиксину B пептидного антибиотика определялась способностью расти на агаре LB, дополненным полимиксином 50 МЕ / мкл B. Классический штамм O395 WT не показал роста агара полняющемуС использованием полимиксина В и считался чувствительным к антибиотику. В то время как штаммы WT El Tor (C6706 и N16961) и репрезентативные варианты El Tor (MQ1795 и BAA-2163) демонстрировали рост в присутствии антибиотика и считались резистентными к полимиксину B. Плиты инкубировали при 37 ° C в течение 18 часов. Нажмите здесь, чтобы просмотреть увеличенную версию этого рисунка.

Рисунок 3
Рисунок 3: Измерение метаболизма цитрата с использованием минимальной цитратной среды. Способность использовать цитрат в качестве единственного источника углерода определялась способностью изолята расти на минимальных цитратных средах. Классический штамм WT O395 не увеличивался на минимальных носителях цитрата (отрицательный). Рост наблюдался всеми штаммами WT El Tor (C6706 и N16961), а представитель ElTor (MQ1795 и BAA-2163), которые продемонстрировали способность использовать цитрат в качестве единственного источника углерода (положительный). Плиты инкубировали при 37 ° С в течение 18 ч. Нажмите здесь, чтобы просмотреть увеличенную версию этого рисунка.

Рисунок 4
Рисунок 4: Измерение HapR-регулируемого гидролиза протеолитического казеина с использованием молочной агаровой среды. Гидролиз казеина через HapR-регулируемую протеазную активность определяли визуальной зоной зазора, окружающей точку инокуляции на молочный агар. Штаммы, содержащие нефункциональный HapR, такой как классический штамм W39 WT и штамм WT El Tor N16961, не вызывали зоны зазора, окружающей точку инокуляции ( hapR-отрицательный ). WT El Tor деформация C6706 и репрезентативные варианты El Tor (MQ1795 и BAA-2163) содержат функциональный HapR, который можно визуализировать как зоны разного размера клиренса ( hapR -позитивный). Плиты инкубировали при 37 ° С в течение 18 ч. Нажмите здесь, чтобы просмотреть увеличенную версию этого рисунка.

Рисунок 5
Рисунок 5: Измерение гемолитической активности с использованием агаровых сред. Гемолитическую активность измеряли с использованием агаровых пластинок, дополненных кровью овец. Классический штамм WT O395 не секретирует ферменты, которые лизят эритроциты (γ-гемолитические). WT El Tor (N16961 и C6706) и репрезентативные варианты El Tor (MQ1795 и BAA-2163) выделяют гемолитические ферменты, что приводит к полупрозрачной зоне зазора, окружающей точку инокуляции (β-гемолитическую). Планшеты инкубировали при 37° C в течение 48 часов. Нажмите здесь, чтобы просмотреть увеличенную версию этого рисунка.

Рисунок 6
Рисунок 6: Определение подвижности с использованием подвижных агарных пластин. Зона подвижности обозначалась визуальным изменением цвета соли ТТК, которая превращается из прозрачного в красный при метаболизме, указывая, где двигались бактерии. Классический штамм WT O395 (10 мм) и штамп WT El Tor C6706 (15 мм) демонстрировали минимальную подвижность, в то время как деформация El Tor N16961 (21 мм) и репрезентативные варианты El Tor (MQ1795 (25 мм) и BAA-2163 (29 мм) ) Продемонстрировали гипермобильность относительно O395 и C6706. Плиты инкубировали при 37 ° С в течение 18 ч. Пожалуйста, нажмитеЗдесь, чтобы просмотреть увеличенную версию этого рисунка.

Рисунок 7
Рисунок 7: Анализ Voges-Proskauer. Производство ацетоина путем ферментации глюкозы определяли с использованием анализа Фогеса-Проскауэра. Классический штамм WT O395 и репрезентативные варианты El Tor (MQ1795 и BAA-2163) не продуцировали ацетоин в результате ферментации глюкозы (отрицательный). WT El Tor (N16961 и C6706) продуцировали побочный продукт ацетоина и могут быть визуализированы путем глубокого красного изменения цвета (положительного). Тубы инкубировали при комнатной температуре в течение 4 часов. Нажмите здесь, чтобы просмотреть увеличенную версию этого рисунка.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Из более чем 200 идентифицированных V. Холерные серогруппы, только O1 и O139 имеют эпидемический потенциал. Серогруппу O1 можно разделить на два биотипа: классический и El Tor. Однако появились гибридные штаммы, названные вариантами El Tor 13 , 17 , которые обладают биотипом El Tor и содержат классические характеристики 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 . Протоколы, описанные в этой рукописи, предназначены для предоставления исследователям, заинтересованным в характеристике и / или различении различных клинических и неклинических изолятов V. cholerae , с надежнымСистема идентификации нескольких анализов. Использование надежной системы идентификации нескольких анализов в качестве альтернативы - это улучшение по сравнению с ранее установленными системами идентификации одного анализа и трудоемкими генетическими экранами. Все генотипические и фенотипические анализы должны включать классический штамм WT O395 и WT El Tor C6706 и N16961 для сравнения ( таблица 1 ). В то время как классические штаммы биотипа El Tor включены для ссылки, изоляты, такие как MQ1795 и BAA-2163, включенные в наши исследования, могут отображать фенотипические профили из обоих биотипов ( Рисунок 2 , Рисунок 3 , Рисунок 4 , Рисунок 5 , Рисунок 6 , Рисунок 7 , Таблица 2 ), иллюстрирующая необходимость анализа множественных генотипических и фенотипических признаков для надежной характеристики. Все протоколы должны выполняться асептически26 при комнатной температуре, если не указано иное. V. Cholerae - это биологический фактор 2 (BSL-2), который является этиологическим агентом потенциально фатальной желудочно-кишечной болезни холеры; Надлежащее обращение и удаление всех материалов и отходов должны соблюдаться в соответствии с институциональными, местными, государственными и федеральными нормами.

Приготовление всех сред и реагентов должно проводиться с использованием реагентов аналитического сорта и сверхчистой воды, деионизированной до минимальной чувствительности 18 МОм-см. Перед обработкой необходимо подготовить среду и дать ей достаточно высохнуть (1-2 дня); Пластины считаются достаточно сухими, когда на поверхности агара нет остаточной жидкости. Из-за диапазона подвижности и зон зазора, окружающих рост бактерий, подвижность и молочные пластины должны быть приготовлены в больших чашках Петри (150 мм x 15 мм) до 50 мл на пластину и могут храниться до 1 недели, завернутых в пластик , LiD-сторона вниз при 4 ºC. Кроме того, концентрация агара пластин подвижности может регулироваться для замедления подвижности; Однако не рекомендуется превышать 3 г агара на 500 мл раствора, так как это значительно снижает общую подвижность, так что различия не будут наблюдаться. Все другие пластинчатые среды должны быть приготовлены примерно до 25 мл на пластину в чашках Петри стандартного размера (100 мм x 15 мм) и могут храниться до шести месяцев, завернутых в пластик, приподнятой стороной вниз при 4 ° С. Для приготовления пластин полимиксина В важно, чтобы расплавленная среда охлаждалась после автоклавирования до добавления полимиксина В, поскольку чрезмерное тепло может ухудшить антибиотики. Плиты Полимиксина В могут храниться до 3 месяцев, завернутых в пластик, приподнятой стороной вниз при 4 ºC. Анализы, обсуждаемые в этой рукописи, требуют дня для роста одной колонии (12-16 ч), дополнительного дня для роста ночных культур (12-16 ч) и третьего дня для рассмотрения генотипических (~ 4 ч для хромосомного DNИзоляция и ~ 3 ч для ПЦР) или фенотипические анализы (18-48 ч, таблица 2 ). Перед биохимическим анализом фенотипических анализов, описанных в этой рукописи, культуры должны быть промыты в 1x PBS, чтобы предотвратить перенос остаточных культуральных сред из результатов перекоса. Кроме того, полимиксин В, цитрат, протеазную активность, гемолиз и анализы моторики могут быть одновременно привиты с использованием однократной промывки в течение ночи. При обнаружении пятнистых сред может возникнуть брызги культур и может привести к перекрестному загрязнению между штаммами. Чтобы предотвратить брызги, избегайте полностью выталкивания культуры из пипетки, вместо этого прекратите выброс культуры на первой остановке пипетки. Кроме того, позвольте пятнам полностью поглощать поверхность агара перед инкубацией и старайтесь не прокалывать агар, что может повлиять на результаты. Фенотипические анализы, приводящие к появлению зон зазора ( Рисунок 4 ; Рисунок 5 ; Таблица 2) И / или подвижность ( рис. 6 , таблица 2 ), окружающие точку инокуляции, должны быть максимально разнесены, чтобы предотвратить сливание областей зазора или роста соответственно, на которые можно измерить соответствующие диаметры для сравнительного анализа. После указанного времени инкубации изоляты могут быть отображены и проанализированы относительно эталонных штаммов биотипа (WT classic O395, WT El Tor C6706 и WT El Tor N16961).

Генетические экраны на основе ПЦР посредством последовательности, описанной в этой рукописи, могут быть использованы для идентификации фона биотипа изолята по отношению к ctxB и tcpA после первичной амплификации ПЦР. Стандартные инструкции для секвенирования требуют определенного количества продукта ПЦР в зависимости от размера усиленной области (580 bp для ctxB и 1420 bp для tcpA ), а для настройки реакций могут быть установлены установленные протоколы. Вкратце, индивидуальный вперед и rРеакции секвенирования должны быть приготовлены с 3-5 пмоль праймера / реакции, и объем должен быть доведен до 20 мкл стерильной сверхчистой водой в 1,5 мл микроцентрифужной пробирке. Для помощи в разработке грунтовки для амплификации и секвенирования ПЦР можно использовать инструмент для проектирования грунтовки NCBI http://www.ncbi.nlm.nih.gov/tools/primer-blast/. Успешную амплификацию и секвенирование ctxB и tcpA проводили с использованием следующих праймеров (5 '→ 3'): ctxB - forward GGGAATGCTCCAAGATCATCGATGAGTAATAC, ctxB -реверсивный CATCATCGAACCACAAAAAAGCTTACTGAGG, tcpA -forward CCGCACCAGATCCACGTAGGTGGG, tcpA -реверс GTCGGTACATCACCTGCTGTGGGGGCAG. Следует отметить, что вся область кодирования ctxB сохраняется на обоих биотипах, кроме базовых позиций 115 и 203 (оба цитозина в классическом и тимине в El Tor). Кроме того, в tcpA несколько битовых изменений сохраняются среди биотипов, которые dIffer через два биотипа ( таблица 1 ), которые можно использовать для того, чтобы помочь различать биотипы.

Во многих лабораторных исследованиях с участием модельного организма V. Холеры, надлежащее техническое обслуживание и методы культивирования имеют решающее значение 27 . Темпы роста обычно используемых V. Контрольные штаммы биотипа холеры, такие как классический штамм O395 WT и штамм N16961 WT El Tor, могут дать полезную информацию о характеристике изолятов варианта El Tor ( рисунок 1 , таблица 2 ). Из-за различных темпов роста по V. Изолятов холеры , важно принимать показания по поглощению спектрофотометра каждый час, пока культуры не достигнут максимальной мутности в течение поздней стационарной фазы. Фаза смерти от середины до конца может не отображаться из-за плато в мутности, вызванного избытком клеточного мусора. Разведение 1: 4 культуры до стерильного L B, чтобы получить полную кривую роста и поддерживать точность инструмента, как пик показаний поглощения при OD 600 ≈ 1,0. При выполнении кривых роста на нескольких штаммах показания оптической плотности должны быть рассчитаны приблизительно на 5 минут для каждого штамма, чтобы обеспечить согласованность между показаниями. Понимание V. Частота роста биотипов холеры имеет решающее значение для многих исследований, включая исследования экспрессии генов вирулентности, анализ метаболических активностей и правильные условия культивирования и хранения. Для последующего анализа ночные культуры должны обрабатываться в позднем журнале до ранней стационарной фазы роста (12-16 ч), чтобы максимизировать рост клеток, но сохраняя клеточную целостность.

Условия культивирования для классических штаммов биотипа El Tor аналогичны, однако, анализ экспрессии гена вирулентности в V. Холеры требуют специфических для биотипов вирулентности условийRef "> 19. Два основных фактора вирулентности CT и TCP контролируются главным регулятором ToxT и оптимально экспрессируются в особых условиях роста, например, в условиях индукции El Tor, вызывающих вирулентность, ToxT может анализироваться путем обработки цельного клеточного экстракта ( WCE) или клеточный осадок в течение 3,5 часов, тогда как экспрессию CT и TCP можно проанализировать, обработав бесклеточный супернатант и WCE через 7,5 часа, соответственно 8 , 20. Различные генотипические и фенотипические признаки, продемонстрированные во всей этой рукописи, показывают, как Разнообразные биотипы V. cholerae могут быть и иллюстрировать необходимость в альтернативе ранее использованной характеристике биотипа с одним анализом.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Авторам нечего раскрывать.

Acknowledgements

Исследования, поддержанные New Hampshire-INBRE через премию за институциональное развитие (IDeA), P20GM103506, из Национального института общих медицинских наук NIH.

Materials

Name Company Catalog Number Comments
1 kb DNA Ladder New England Biolabs N3232S https://www.neb.com/products/n3232-1-kb-dna-ladder
60% Glycerol Calbiochem 356352 http://www.emdmillipore.com/US/en/product/Glycerol%2C-Molecular-Biology-Grade---CAS-56-81-5---Calbiochem,EMD_BIO-356352
Agar Becto, Dickinson and Co. 214030 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=214030&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D214030%26typeOfSearch%3DproductSearch
Agar with brain-heart infusion Becto, Dickinson and Co. 237500 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=237500&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D237500%26typeOfSearch%3DproductSearch
Agarose Peqlab 732-2789 https://de.vwr.com/store/catalog/product.jsp?catalog_number=732-2789&_DARGS=/store/cms/de.vwr.com/de_DE/header_2016111711383215.jsp_AF&_dynSessConf=1766917479792147141&targetURL=/store/catalog/product.jsp%3Fcatalog_number%3D732-2789&lastLanguage=en&/vwr/userprofiling/EditPersonalInfoFormHandler.updateLocale=&_D%3AcurrentLanguage=+&currentLanguage=en&_D%3AlastLanguage=+&_D%3A/vwr/userprofiling/EditPersonalInfoFormHandler.updateLocale=+
Anhydrous K2HPO4 Fisher Scientific P288-500 https://www.fishersci.com/shop/products/potassium-phosphate-dibasic-anhydrous-crystalline-powder-certified-acs-fisher-chemical-5/p288500?searchHijack=true&searchTerm=P288500&searchType=RAPID
Blood Agar Plates Remel R01200 Store at 4 °C;  http://www.remel.com/Catalog/Item.aspx?name=Blood+Agar
Boric Acid Fisher Scientific A73-500 https://www.fishersci.com/shop/products/boric-acid-crystalline-certified-acs-fisher-chemical-6/a73500?searchHijack=true&searchTerm=A73500&searchType=RAPID
Bromothymol Blue Fisher Scientific B388-10 https://www.fishersci.com/shop/products/bromothymol-blue-certified-acs-fisher-chemical/b38810?searchHijack=true&searchTerm=B38810&searchType=RAPID
Cirtric acid ·H2O Fisher Scientific S72836-3 https://www.fishersci.com/shop/products/citric-acid-monohydrate-4/s728363#?keyword=s728363
Deoxynucleotide (dNTP) Solution Kit New England Biolabs N0446S Store at -20 °C;  https://www.neb.com/products/n0446-deoxynucleotide-solutionset
Disodium EDTA Fisher Scientific S311-500 https://www.fishersci.com/shop/products/ethylenediaminetetraacetic-acid-disodium-salt-dihydrate-crystalline-certified-acs-fisher-chemical-7/s311500?searchHijack=true&searchTerm=S311500&searchType=RAPID
DNA Clean & Concentrator™ -25 Kit Zymo Research D4007 http://www.zymoresearch.com/dna/dna-clean-up/zymoclean-gel-dna-recovery-kit
GelGreen Nucleic Acid Stain Biotium 41005 https://biotium.com/product/gelgreentm-nucleic-acid-gel-stain-10,000x-in-water/
Genesys 10SUV-VIS Spectrophotometer Thermo Scientific 840-208100 https://www.thermofisher.com/order/catalog/product/840-208100?ICID=search-840-208100
Gentra Puregene Yeast/Bact. Kit Qiagen 158567 https://www.qiagen.com/us/shop/sample-technologies/dna/dna-preparation/gentra-puregene-yeastbact-kit/#orderinginformation
HCl Fisher Scientific A144-212 Corrosive;  https://www.fishersci.com/shop/products/hydrochloric-acid-certified-acs-plus-fisher-chemical-10/a144212?searchHijack=true&searchTerm=A144212&searchType=RAPID
KCl Fisher Scientific P217-500 https://www.fishersci.com/shop/products/potassium-chloride-crystalline-certified-acs-fisher-chemical-4/p217500?searchHijack=true&searchTerm=P217500&searchType=RAPID
KH2PO4 Fisher Scientific P285-500 https://www.fishersci.com/shop/products/potassium-phosphate-monobasic-crystalline-certified-acs-fisher-chemical-5/p285500?searchHijack=true&searchTerm=P285500&searchType=RAPID
KOH Fisher Scientific P250-500 https://www.fishersci.com/shop/products/potassium-hydroxide-pellets-certified-acs-fisher-chemical-5/p250500?searchHijack=true&searchTerm=P250500&searchType=RAPID
Le Loop Decon Labs Inc. MP190-25 http://deconlabs.com/products/leloop/
Le Stab Decon Labs Inc. MP186-5 http://deconlabs.com/products/lestab/
MgSO4·7H2O Fisher Scientific M63-500 https://www.fishersci.com/shop/products/magnesium-sulfate-heptahydrate-crystalline-certified-acs-fisher-chemical-3/m63500?searchHijack=true&searchTerm=M63500&searchType=RAPID
Mini-Sub Cell GT Horizontal Electrophoresis System Bio Rad Labs 1704406 http://www.bio-rad.com/en-us/product/mini-sub-cell-gt-cell?WT.srch=1&WT.mc_id=aw-cbb-NA-sub_cell_systems_brand_gold&WT.knsh_id=7eb1981f-a011-42a3-aece-1236ff453373
MR-VP Broth Difco 216300 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=216300&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3Dmr-vp%2Bmedium%26typeOfSearch%3DproductSearch
Na2HPO4 Fisher Scientific S374-500 https://www.fishersci.com/shop/products/sodium-phosphate-dibasic-anhydrous-granular-powder-certified-acs-fisher-chemical-5/s374500?searchHijack=true&searchTerm=S374500&searchType=RAPID
NaCl Fisher Scientific S271-10 https://www.fishersci.com/shop/products/sodium-chloride-crystalline-certified-acs-fisher-chemical-6/s27110?searchHijack=true&searchTerm=S27110&searchType=RAPID
NaHCO3 Fisher Scientific S233-500 https://www.fishersci.com/shop/products/sodium-bicarbonate-powder-certified-acs-fisher-chemical-5/s233500?searchHijack=true&searchTerm=S233500&searchType=RAPID
NaNH4HPO4·4H2O Fisher Scientific S218-500 https://www.fishersci.com/shop/products/sodium-ammonium-phosphate-tetrahydrate-crystalline-certified-fisher-chemical/s218500?searchHijack=true&searchTerm=S218500&searchType=RAPID
NanoDrop Lite Spectrophtometer Thermo Scientific ND-LITE-PR https://www.thermofisher.com/order/catalog/product/ND-LITE-PR?ICID=search-ND-LITE-PR
Nonfat dry milk Nestle Carnation N/A N/A
Peptone Becto, Dickinson and Co. 211677 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=211677&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D211677%26typeOfSearch%3DproductSearch
Petri Dishes (100 mm x 15 mm) Fisher Scientific FB0875712 https://www.fishersci.com/shop/products/fisherbrand-petri-dishes-clear-lid-12/fb0875712#?keyword=FB0875712
Petri Dishes (150 mm x 15 mm) Fisher Scientific FB0875714 https://www.fishersci.com/shop/products/fisherbrand-petri-dishes-clear-lid-12/fb0875714?searchHijack=true&searchTerm=FB0875714&searchType=RAPID
Polymyxin B sulfate salt Sigma-Aldrich P1004-10MU Store at 2-4 °C; http://www.sigmaaldrich.com/catalog/product/sial/p1004?lang=en&region=US
Taq DNA Polymerase New England Biolabs M0273S Store at -20 °C; https://www.neb.com/products/m0273-taq-dna-polymerase-with-standard-taq-buffer
Taq Reaction Buffer New England Biolabs M0273S Store at -20 °C;  https://www.neb.com/products/m0273-taq-dna-polymerase-with-standard-taq-buffer
Thermal Cycler Bio-Rad C1000 Touch™  Bio Rad Labs 1840148 http://www.bio-rad.com/evportal/evolutionPortal.portal?_nfpb=true&_pageLabel=search_page&sfMode=search&sfStartNumber=1&clearQR=true&js=1&searchString=1840148&database=productskus+productcategories+productdetails+abdProductDetails+msds+literatures+inserts+faqs+downloads+webpages+assays+genes+pathways+plates+promotions&tabName=DIVISIONNAME
Triphenyltetrazolium chloride Alfa Aesar A10870 https://www.alfa.com/en/catalog/A10870/
Tris Base Fisher Scientific BP152-1 https://www.fishersci.com/shop/products/tris-base-white-crystals-crystalline-powder-molecular-biology-fisher-bioreagents-7/bp1521?searchHijack=true&searchTerm=BP1521&searchType=RAPID
Tryptone Becto, Dickinson and Co. 211705 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=211705&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D211705%26typeOfSearch%3DproductSearch
Yeast Extract Becto, Dickinson and Co. 212750 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=212750&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D212750%26typeOfSearch%3DproductSearch
α-napthol MP Biomedicals 204189 http://www.mpbio.com/product.php?pid=05204189

DOWNLOAD MATERIALS LIST

References

  1. Shimada, T., et al. Extended serotyping scheme for Vibrio cholerae. Curr. Microbiol. 28, (3), 175-178 (1994).
  2. Yamai, S., Tadayuki, O., Toshio, S., Yasuji, K. Distribution of serogroups of Vibrio cholerae non-O1 non-O139 with specific reference to their ability to produce cholera toxin, and addition of novel serogroups. Jpn. J. Infect. Dis. 71, (10), 1037-1045 (1997).
  3. Karaolis, D. K., Lan, R., Reeves, P. R. The sixth and seventh cholera pandemics are due to independent clones separately derived from environmental, nontoxigenic, non-O1 Vibrio cholerae. J. Bacteriol. 177, (11), 3191-3198 (1995).
  4. Albert, M. J., et al. Large epidemic of cholera-like disease in Bangladesh caused by Vibrio cholerae O139 synonym Bengal. Lancet. 342, (8868), 387 (1993).
  5. Barua, D. History of Cholera. Cholera. Barua, D., Greenough III, W. B. Plenum Publishing Corporation. 1-36 (1992).
  6. Morales, R., Delgado, G., Cravioto, A. Population Genetics of Vibrio cholerae. Vibrio cholerae-Genomics and Molecular Biology. Faruque, S. M., Nair, G. B. Caister Academic Press. 29-47 (2008).
  7. Samadi, A. R., Chowdhury, M. K., Huq, M. K., Khan, M. U. Seasonality of classical and El Tor cholera in Dhaka, Bangladesh: 17-year trends. Trans. R. Soc. Trop. Med. Hyg. 77, (6), 853-856 (1983).
  8. Son, M. S., Megli, C. J., Kovacikova, G., Qadri, F., Taylor, R. K. Characterization of Vibrio cholerae O1 El Tor biotype variant clinical isolates from Bangladesh and Haiti, including a molecular genetic analysis of virulence genes. J. Clin. Microbiol. 49, (11), 3739-3749 (2011).
  9. Ghosh-Banerjee, J., et al. Cholera toxin production by the El Tor variant of Vibrio cholerae O1 compared to prototype El Tor and classical biotypes. J. Clin. Microbiol. 48, (11), 4283-4286 (2010).
  10. Ansaruzzaman, M., et al. The Mozambique cholera vaccine demonstration project coordination group. Cholera in Mozambique, variant of Vibrio cholerae. Emerg. Infect. Dis. 10, (11), 2057-2059 (2004).
  11. Ansaruzzaman, M., et al. Genetic diversity of El Tor strains of Vibrio cholerae O1 with hybrid traits isolated from Bangladesh and Mozambique. Int. J. Med. Microbiol. 297, (6), 443-449 (2007).
  12. Lan, R., Reeves, P. R. Pandemic spread of cholera: genetic diversity and relationships within the seventh pandemic clone of Vibrio cholerae determined by amplified fragment length polymorphism. J. Clin. Microbiol. 40, (1), 172-181 (2002).
  13. Nair, G. B., Faruque, S. M., Bhuiyan, N. A., Kamruzzaman, M., Siddique, A. K., Sack, D. A. New variants of Vibrio cholerae O1 biotype El Tor with attributes of the classical biotype from hospitalized patients with acute diarrhea in Bangladesh. J. Clin. Microbiol. 40, (9), 3296-3299 (2002).
  14. Nair, G. B., et al. Isolation of Vibrio cholerae O1 strains similar to pre-seventh pandemic El Tor strains during an outbreak of gastrointestinal disease in an island resort in Fiji. J. Med. Microbiol. 55, (11), 1559-1562 (2006).
  15. Nair, G. B., Mukhopadhyay, A. K., Safa, A., Takeda, Y. Emerging hybrid variants of Vibrio cholerae O1. Vibrio cholerae—Genomics and Molecular Biology. Faruque, S. M., Nair, G. B. Horizon Scientific Press. 179-190 (2008).
  16. Safa, A., et al. Genetic characteristics of Matlab variants of Vibrio cholerae O1 that are hybrids between classical and El Tor biotypes. J. Med. Microbiol. 55, (11), 1563-1569 (2006).
  17. Nusrin, S., et al. Diverse CTX phages among toxigenic Vibrio cholerae O1 and O139 strains isolated between 1994 and 2002 in an area where cholera is endemic. J. Clin. Microbiol. 42, (12), 5854-5856 (2004).
  18. Carignan, B. M., Brumfield, K. D., Son, M. S. Single nucleotide polymorphisms in regulator-encoding genes have an additive effect on virulence gene expression in a Vibrio cholerae clinical isolate. mSphere. 1, (5), e00253 (2016).
  19. Iwanaga, M., Yamamoto, K., Higa, N., Ichinose, Y., Nakasone, N., Tanabe, M. Culture conditions for stimulating cholera toxin production by Vibrio cholerae O1 El Tor. Microbiol. Immunol. 30, (11), 1075-1083 (1986).
  20. DiRita, V. J., Claude, P., Georg, J., Mekalanos, J. J. Regulatory cascade controls virulence in Vibrio cholerae. Proc. Natl. Acad. Sci. USA. 88, (12), 5403-5407 (1991).
  21. Kovacikova, G., Lin, W., Skorupski, K. Duel regulation of genes involved in acetoin biosynthesis and motility/biofilm formation by the virulence activator AphA and the acetate-responsive Lys-R type regulator AlsR in Vibrio cholerae. Mol. Microbiol. 57, (2), 420-433 (2005).
  22. Vogel, H. J., Bonner, D. M. Acetylornithinase of Escherechia coli: partial purification and some properties. J. Biol. Chem. 218, (1), 97-106 (1956).
  23. Son, M. S., Taylor, R. K. Genetic screens and biochemical assays to characterize Vibrio cholerae O1 biotypes: classical and El Tor. Curr. Protoc. Microbiol. 6A.2.1-6A.2.17 (2011).
  24. Kovacikova, G., Skorupski, K. Regulation of virulence gene expression in Vibrio cholerae by quorum sensing: HapR functions at the aphA promoter. Mol. Microbiol. 46, (4), 1135-1147 (2002).
  25. Wang, Y., et al. The prevalence of functional quorum-sensing systems in recently emerged Vibrio cholerae toxigenic strains. Environ. Microbiol. Rep. 3, (2), 218-222 (2011).
  26. Sanders, E. R. Aseptic laboratory techniques. J. Vis. Exp. (63), e3064 (2012).
  27. Martinez, R. M., Megli, C. J., Taylor, R. K. Growth and laboratory maintenance of Vibrio cholerae. Curr. Protoc. 6A.1.1-6A.1.6 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics