Laboratorieteknikker anvendt til at opretholde og differentiere biotyper af * These authors contributed equally

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Dette manuskript beskriver egnede Vibrio cholerae vedligeholdelsesteknikker ud over en række biokemiske analyser, der kollektivt anvendes til hurtig og pålidelig differentiering mellem klinisk og miljømæssig V. Kolerae-biotyper i en laboratorieindstilling.

Cite this Article

Copy Citation | Download Citations

Brumfield, K. D., Carignan, B. M., Ray, J. N., Jumpre, P. E., Son, M. S. Laboratory Techniques Used to Maintain and Differentiate Biotypes of Vibrio cholerae Clinical and Environmental Isolates. J. Vis. Exp. (123), e55760, doi:10.3791/55760 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Den vandgram-negative bakterie Vibrio cholerae er det etiologiske middel af den smitsomme gastrointestinale sygdomskolera. På grund af den globale forekomst og sværhedsgrad af denne sygdom, V. Cholerae er blevet grundigt studeret i både miljø- og laboratorieindstillinger, hvilket kræver egentlig vedligeholdelses- og dyrkningsteknikker. Klassisk og El Tor er to hovedbiotyper, der komponerer V. Cholerae O1 serogruppe, der hver især viser unikke genotypiske og fænotypiske egenskaber, der tilvejebringer pålidelige mekanismer til biotype karakterisering og kræver forskellige dyrkningsbetingelser for virulens. Uanset biotype af årsagsspændingen for en given infektion eller udbrud indebærer standardbehandling af sygdommen rehydreringsterapi suppleret med et regime af antibiotika. Imidlertid kan biotypeklassificering være nødvendig for laboratorieundersøgelser og kan have bredere virkninger på det biomedicinske område.I begyndelsen af ​​2000 blev kliniske isolater identificeret, der udviser genotypiske og fænotypiske træk fra både klassiske og El Tor-biotyper. De nyligt identificerede hybrider, der betegnes El Tor-varianter, har forårsaget klinisk og miljømæssig isolatbiotypeidentifikation til at blive mere kompleks end tidligere traditionelle single-assayidentifikationsprotokoller. Ud over at beskrive V. Cholerae generelle vedligeholdelses- og dyrkningsteknikker beskriver dette manuskript en række genspecifikke ( ctxB og tcpA ) PCR-baserede genetiske skærmbilleder og fænotypiske analyser (polymyxin B-resistens, citratmetabolisme, proteolytisk aktivitet, hæmolytisk aktivitet, motilitet og glukosemetabolismen via Voges- Proskauer assay) kollektivt brugt til at karakterisere og / eller skelne mellem klassiske og El Tor biotyper. Sammen giver disse analyser en effektiv systematisk tilgang til at blive anvendt som et alternativ eller endvidere til dyre, arbejdskrævende eksperimenter i karakterenTion af V. Kolerae kliniske (og miljømæssige) isolater.

Introduction

Kolera er en sygdom i den distale tyndtarmen forårsaget af forbruget af forurenet mad eller vand, der indeholder den vandige Gram-negative bakterie Vibrio cholerae . Symptomer på kolera omfatter opkastning og ukontrollabel vandig diarré, hvilket fører til alvorlig dehydrering, som hvis den ikke behandles ordentligt, vil resultere i døden. V. Cholerae kan opdeles i over 200 serogrupper baseret på strukturen af ​​celleoverflade-lipopolysaccharid-O-antigenet. Imidlertid har kun 2 serogrupper, O1 og O139, vist epidemi eller pandemisk potentiale 1 , 2 . Desuden er serogruppe O139 primært isoleret til Sydøstasien 3 , 4 , mens serogruppe O1 er distribueret over hele verden. Desuden kan O1 serogruppen opdeles i 2 hovedbiotyper: klassisk og El Tor. Den klassiske biotype var ansvarlig for de første 6 kolera pandæmierS mellem 1817 og 1923. Den igangværende syvende pandemi er et resultat af El Tor-biotypen, som globalt har fordrevet den klassiske biotype i miljøet 5 , 6 , 7 . For nylig er der opstået stammer, som indeholder kendetegnende karakteristika for både klassiske og El Tor-biotyper 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 og er siden blevet betegnet El Tor-varianter 13 , 17 . Nogle El Tor varianter har vist forhøjede virulence evner med hurtigere og alvorlig sygdomsprogression end tidligere observeret og understregerBehovet for en mere omfattende tilgang til agentidentifikation og sygdomsforebyggelse og behandling 8 , 9 , 18 . Selvom biotypeidentifikation ikke umiddelbart diker behandling, kan yderligere fremskridt inden for vaccineudvikling og fremtidige terapeutiske midler drage fordel af biotypeforskel.

Den første serie af protokoller, der er angivet her, vil gøre det muligt for efterforskerne at opretholde V korrekt. Koleraestammer i en laboratorieindstilling. Konsistens og efterfølgende analyse kræver lagerforberedelse og vækst af isolater, som ikke er biotypeafhængige. For at optimere inducerende virulensgenekspression er der imidlertid behov for uafhængige biotype-specifikke dyrkningsteknikker 19 . Derudover er forberedelse til forskellige genetiske og biokemiske analyser skitseret i dette manuskript.

Kollatoksin (CT) og toksin co-reGuleret pilus (TCP) er to hovedvirulensfaktorer styret af master regulator ToxT i begge biotyper af V. Cholerae O1 serogruppe 20 . CT er et todelt toksin bestående af fem CtxB Underenheder omkring en enkelt CtxA underenhed, og er ansvarlig for det hurtige elektrolyttab forbundet med kolera. TCP er en type IV pilus kodet af tcp operonen ( tcpABQCRDSTEF ), og er involveret i vedhæftning og kolonisering af den distale tyndtarmen. TcpA er det første gen af tcp operonen, som koder for de enkelte pilinunderenheder, der er afgørende for opbygningen af ​​pilus 8 . Gensekvensen for ctxA er helt konserveret mellem klassiske og El Tor-biotyper, medens ctxB og tcpA adskiller sig over de to biotyper, men bevares inden for hver biotype 8 . CtxB er fuldstændigt konserveret mellem biotyper undtagen ved to basisposi(115 og 203). I El Tor-biotypen ligger thym i basepositioner 115 og 203, mens den klassiske biotype indeholder cytosin ved disse baser. TcpA er helt konserveret inden for hver biotype, men adskiller sig ved flere baser mellem biotyper. Disse genetiske skelner tjener som primære biotypeidentifikationsmarkører, og efter sekventering af polymerasekædereaktionsprodukt (PCR) amplifikationsprodukt, der indbefatter disse steder, kan isolationssekvenser sammenlignes med vildtype (WT) klassisk O395 eller WT El Tor N16961 for at bestemme biotype baggrunden Af henholdsvis CT og TCP i et givet V. cholerae- isolat.

Talrige protokoller er blevet udviklet til at karakterisere de fænotypiske sondringer mellem de klassiske og El Tor biotyper 21 , 22 , 23 . Polymyxin B er et peptidantibiotikum, der kompromitterer integriteten af ​​den ydre cellemembran i gram-negativ bacTeria og polymyxin B-resistens kan visualiseres gennem polymyxin B-resistensassayet 21 . Citrat er et primært substrat af Krebs cyklus, og evnen til at metabolisere citrat som en eneste carbonkilde kan bestemmes ved anvendelse af citratmetabolismassayet 22 . HapR koder for en global regulator og master quorum-sensing regulator i V. cholerae, HapR, der binder til forskellige promotor regioner og regulerer gen og operon udtryk 24 . Nogle patogene stammer af V. cholerae har en naturligt forekommende rammeforskydningsmutation i hapR- genet, som har forårsaget denne tæthedafhængige regulering af virulensgenekspression at gå tabt 24 , 25 . Måling af HapR-reguleret proteaseaktivitet ved anvendelse af mælkeagarmedier gør det muligt for forskeren at identificere, om et bestemt isolat indeholder en funktionel HapR 23 . DetHæmolyse assay tests for en stamme evne til at udskille hæmolytiske enzymer, der lyser røde blodlegemer; Graden af ​​hæmolyse kan visualiseres på blodagarpladerne 23 . Motilitet er ofte forbundet med virulens i V. cholerae og kan analyseres ved anvendelse af motilitetsagarplader 23 . Voges-Proskauer-analysen tester for en stamme evne til at fermentere glucose som en eneste carbonkilde og producere biproduktet acetoin 21 . Med fremkomsten af ​​El Tor-varianter er det vanskeligt at forudsige resultaterne af et givet fænotypisk assay uden omfattende genotypisk screening og før afledning af biotype-baggrunden af V. Cholerae-isolater, anbefales det at udføre denne samling af analyser 23 og sammenligne resultaterne med referencestammer som i tabel 2 .

Her har vi avanceret en række protokoller, der kollektivt udnytter aforemetNtioned genotypiske og fænotypiske analyser for en mere omfattende tilgang til karakterisering af V. Cholerae biotyper. Desuden har vi beskrevet de genotypiske og fænotypiske sondringer af kendt V. Cholerae El Tor-varianter (MQ1795 og BAA-2163) i sammenligning med almindeligt anvendte biotype-referencestammer (WT klassisk O395, WT El Tor C6706 og WT El Tor N16961; Tabel 1 ). Fremkomsten af ​​El Tor-varianter har fremlagt udfordringer for pålideligheden af ​​tidligere anvendte enkeltassaybiotype karakteriseringsprotokoller; Dette multiple assay identifikationssystem vil dog muliggøre mere pålidelig karakterisering af klinisk og miljømæssig V. Kolerae isolater.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Bemærk: Tidsovervejelser for hvert assay skal foretages, da individuelle medieforberedelser kræver forskellige tidspunkter. F.eks. Bør faste agarplademedier tillades at være tilstrækkeligt kølige og tørre (1-2 dage). Yderligere tidsovervejelser ( dvs. single colony og overnight culture growth) specificeres under hver protokol og findes i tabel 2 .

1. Forberedelse af medier

  1. 1x phosphatbufferet saltvand (PBS)
    1. Væg 4,0 g NaCl, 0,1 g KCl, 0,72 g Na2 HPO4 og 0,12 g KH2P04. Kombiner bestanddelene i en 1 L Erlenmeyer-kolbe, juster volumen til 500 ml med deioniseret vand, juster pH til 7,2 ved hjælp af en pH-meter, og tilsæt HCl dråbevis til opløsningen, og autoklaver eller filtrer steriliser ved hjælp af et 0,22 μm filter. 1x PBS kan opbevares ved stuetemperatur på ubestemt tid.
      FORSIGTIG: HCI er en koncentreret syre og skal håndteres i overensstemmelse medTil institutionelle, lokale, statslige og føderale regler. For passende håndteringsvejledninger henvises til sikkerhedsdatabladet fra producenten.
  2. Luria-Bertani (LB) bouillon
    1. Vægt 5,0 g trypton, 2,5 g gærekstrakt og 2,5 g NaCl. Kombiner bestanddelene i en 1 L flaske, juster volumen til 500 ml med deioniseret vand, autoklaver og opbevar ved stuetemperatur i op til 6 måneder. Ved klassisk biotype virulensinducerende tilstande skal pH justeres til 6,5 ved anvendelse af HCI forud for autoklavering.
  3. AKI-medium indeholdende 0,03% (vægt / volumen) NaHC03
    1. For komponent 1 (AKI-medium): veje 7,5 g pepton, 2,0 g gærekstrakt og 2,5 g NaCl. Kombiner bestanddelene i en 1 L flaske, juster volumen til 450 ml med deioniseret vand og autoklav. AKI-medium kan opbevares ved stuetemperatur i op til 6 måneder.
    2. For komponent 2 (NaHCO3): vejes 1,5 g NaHCO3 og juster lydstyrkenTil 50 ml med deioniseret vand i en steril vesikel. Filtrer steriliser NaHCO3 ved anvendelse af et 0,22 μm filter. NaHCO 3 skal fremstilles umiddelbart før brug.
    3. Aseptisk kombinere de to komponenter, der skaber et 1:10 forhold ved at filtrere komponent 2 i komponent 1 før brug.
  4. Luria-Bertani (LB) agarplader
    1. Vejes 5,0 g trypton, 2,5 g gærekstrakt, 2,5 g NaCl og 7,5 g agar. Kombiner bestanddelene i en 1 L Erlenmeyer kolbe, juster volumen til 500 ml med deioniseret vand, autoklaver og tilbered i standardstørrelse 100 mm x 15 mm sterile petriskåle. Forgyldt medie kan opbevares indpakket i plast i op til 6 måneder, op til låg ved 4 ° C.
  5. LB agarplader suppleret med polymyxin B
    1. For komponent 1 (LB agar): vejes 5,0 g trypton, 2,5 g gærekstrakt, 2,5 g NaCl og 7,5 g agar. Kombiner bestanddelene i en 1 L Erlenmeyer kolbe, juster volumen til 500 mL wiDeioniseret vand og autoklave.
    2. For komponent 2 (polymyxin B): Polymyxin B opløses i deioniseret vand i et sterilt 2 ml mikrocentrifugerør til en koncentration på 50.000 IE / μL og filtersteriliseres ved anvendelse af et 0,22 μm filter.
    3. Når komponent 1 er kølig til berøring, men endnu ikke størknet, tilsættes aseptisk 500 μl komponent 2 til komponent 1, hvilket skaber en slutkoncentration på 50 IE / μl og blandes grundigt. Forbered i standardstørrelser 100 mm x 15 mm sterile petriskåle ved at hælde blandet agarmedium i petriskålene. Forgyldt medie kan opbevares indpakket i plast i op til 3 måneder, op til låg ved 4 ° C.
  6. Minimale Citrat Medium Agarplader
    1. For komponent 1 (agar med bromthymolblåt): veje 7,5 g agar og 0,02 g bromthymolblåt. Kombiner bestanddelene i en 1 L Erlenmeyer kolbe, juster volumen til 450 ml med deioniseret vand og autoklaver blandingen.
    2. For komponent 2 (10x VBMM): veje 1.0 g MgSO4 7H20, 10,0 g citronsyreH20, 50,0 g vandfri K 2 HPO 4 og 17,5 g NaNH 4 HPO 4 4H 2 O. Kombiner bestanddelene i en 1 L Erlenmeyer kolbe, juster volumen til 500 ml Med deioniseret vand og autoklave eller filtersterilisere ved anvendelse af et 0,22 μm filter. 10x VBMM kan opbevares ved stuetemperatur i op til 6 måneder.
    3. Tilsæt 50 ml komponent 2 til komponent 1 og tilbered i standardstørrelser 100 mm x 15 mm sterile petriskåle ved at hælde blandet agarmedium i petriskålene. Forgyldt medie kan opbevares indpakket i plast i op til 6 måneder, op til låg ved 4 ° C.
  7. Mælke Agarplader
    1. For komponent 1 (mælk): veje 8,0 g øjeblikkelig ikke-fed tørmælk i en 1 L Erlenmeyer-kolbe, juster volumen til 200 ml med deioniseret vand og autoklav.
    2. For komponent 2 (agar med hjerne-hjerte infusion): veje 3,68 g hjerne-hjerte infusion og 6,0 g agar. Kombiner koncStituenter i en 500 ml Erlenmeyer kolbe, juster volumen til 200 ml med deioniseret vand og autoklav.
    3. Kombiner de to komponenter ved at hælde komponent 2 i komponent 1, efter autoklavering og bland grundigt. Tilbered i 150 mm x 15 mm sterile petriskåle. Mælkeplader kan opbevares i op til en uge indpakket i plastik, låg nedad ved 4 ° C. Tilbered i 150 mm x 15 mm sterile petriskåle ved at hælde blandet agarmedium i petriskålene.
  8. Motilitetsagarplader
    1. For komponent 1 (LB agar): vejes 5,0 g trypton, 2,5 g gærekstrakt, 2,5 g NaCl og 2,0 g agar. Kombiner bestanddelene i en 1 L Erlenmeyer kolbe, juster volumen til 500 ml med deioniseret vand og autoklav.
    2. For komponent 2 (1% (w / v) triphenyltetrazoliumchlorid; TTC): vejes 0,25 g TTC. Juster volumen til 25 ml med deioniseret vand i en steril vesikel og filtrer sterilisere ved hjælp af et 0,22 μm filter. Opbevares i op til 6 måneder ved stuetemperatur indpakketI folie for at minimere lyseksponering.
    3. Tilsæt 2,5 ml 1% (w / v) sterilt TTC til autoklaverede medier.
    4. Hæld medierne så tyk som muligt (≥50 ml / plade) i store 150 mm x 15 mm sterile petriskåle. Forgyldt medie kan opbevares indpakket i plast i op til en uge, op til låg ved 4 ° C. Tilbered i 150 mm x 15 mm sterile petriskåle ved at hælde blandet agarmedium i petriskålene.
  9. Voges-Proskauer (VP)
    1. For komponent 1 (Methyl Red-Voges-Proskauer bouillon; MR-VP): veje 1,7 g MR-VP-medium i en 500 ml Erlenmeyer-kolbe, juster volumen til 100 ml med deioniseret vand og autoklav. Steril MR-VP bouillon kan opbevares ved stuetemperatur i op til 6 måneder.
    2. For komponent 2 (5% (w / v) alfa (a) naphthol): veje 1,0 g a-naphthol i en steril vesikel og juster volumen til 20 ml med 95% ethanol. A-naphthol kan opbevares ved stuetemperatur i op til 1 uge indpakket i folie for at minimere lys eksponeringosure.
    3. For komponent 3 (40% (vægt / volumen) kaliumhydroxid; KOH): vejer 20,0 g KOH i en steril vesikel, juster volumen til 50 ml med sterilt deioniseret vand. KOH kan opbevares i op til 6 måneder ved stuetemperatur i en plastikbeholder.

2. Vedligeholdelse og vækst af V. Koleraestammer

  1. Forberedelse og brug af frosne lagerkulturer
    1. Pellet 1,8 ml væske natten over i 2 minutter ved centrifugering (≥8 600 xg) i et sterilt 2 ml mikrocentrifugerør, fjern supernatant og suspender cellepellet igen i 900 μl frisk LB-bouillon ved pipettering.
    2. Tilsæt 900 μL sterilt 60% (v / v) glycerol til kulturen og bland ved vortexing.
    3. Overfør blandingen til et sterilt 2 ml kryogent rør og opbevar på ubestemt tid ved -80 ° C.
    4. For at bruge, fjern en lille mængde frosset stamme ved hjælp af en steril inokuleringssløjfe og stribe for enkeltkolonier på LB agAr plader. Returner straks frosne lagre til -80 ° C efter brug for at forhindre kulturer i fuldstændig optøning. Inkubér pladerne låg-side ned i 12 til 16 timer ved 37 ° C.
  2. Vækst af overnattende kulturer i flydende medium
    1. Streak for enkeltkolonier (som pr. Afsnit 2.1.4) fra frosset stamme på LB agarplader. Inkubér pladerne låg-side ned i 12 til 16 timer ved 37 ° C.
    2. Inokuler 4 ml flydende LB bouillon i et sterilt 10 ml kulturrør med en enkelt koloni ved at røre overfladen af ​​den enkelte koloni med en steril applikatorstang og overføre kolonien ind i væskebølgen.
    3. Inkuber med beluftning i en shaker inkubator ved 225 rpm i 12 til 16 timer ved 37 ° C.
  3. Vækstkurve
    1. Forbered natten over kulturen i flydende LB bouillon som tidligere angivet i protokol 2.2.
    2. Lav en 1: 100 fortynding af natten overkultur ved at overføre 250 μl overnightkultur til 25 ml frisk LB bouillon i en steril 250 ml Erlenmeyer kolbe.
    3. Mål den optiske densitet af væskekulturerne ved 600 nm (OD 600 ) hver time, der begynder på tidspunktet for inokulationen (T 0 ).
    4. Inkubér en 1: 100 fortynding af natten over kultur med beluftning i en shaker-inkubator ved 225 omdr./min. I op til 30 timer ved 37 ° C eller indtil dyrkning når maksimal densitet.
    5. Tegn OD 600 vs Time og brug lineær regression for at bestemme den omtrentlige fordoblingstid for hver stamme.
  4. El Tor Biotype Virulence Inducerende Betingelser
    1. Streak for enkeltkolonier fra frosset stamme på LB agarplader. Inkubér plader lås-side ned, i 12 til 16 timer ved 37 ° C.
    2. Inokulere 10 ml AKI-medium indeholdende 0,03% (vægt / volumen) NaHC03 med en enkelt koloni.
    3. Inkuber kultur uden beluftning ved 37 ° C i 3,5 timer.
    4. Fjern 7 ml kultur og inkubér de resterende 3 ml cultuRe med beluftning i en shaker inkubator ved 225 rpm i yderligere 4 timer.
  5. Klassiske biotype virulensinducerende tilstande
    1. Streak for enkeltkolonier fra frosset stamme på LB agarplader. Inkubér pladerne låg-side ned i 12 til 16 timer ved 37 ° C.
    2. Inokuler 4 ml flydende LB bouillon (pH 6,5) med en enkelt koloni.
    3. Inkuber med beluftning i en shaker-inkubator ved 225 omdr./min. I 12 til 16 timer ved 30 ° C.
  6. Vask cellepellet i 1x PBS
    1. Pellet 1,8 ml natten overkultur i 2 minutter ved centrifugering (≥8.600 xg) i et sterilt 2 ml mikrocentrifugerør og fjern supernatanten under anvendelse af en pipette. Re-suspender cellepellet i 1,8 ml 1x PBS ved pipettering.
    2. Gentag vaskningsproceduren tre gange efterfulgt af en endelig resuspension i 1,8 ml 1x PBS.

3. Karakterisering V. Cholerae biotyper

  1. PCR-baserede genetiske skærme ved anvendelse af ctxB og tcpA
    1. Design et sæt primere, som annealerer ca. 50-70 bp opstrøms og nedstrøms for de translatoriske start- og stopsteder af henholdsvis ctxB og tcpA.
    2. Forbered natten over kulturen i flydende LB bouillon som tidligere angivet i protokol 2.2.
    3. Isolere kromosomalt DNA ved anvendelse af et kommercielt tilgængeligt kit designet til gramnegative bakterier. Oprenset kromosomalt DNA kan opbevares ubestemt ved -20 ° C. Kromosomal DNA-isolering under anvendelse af kommercielt tilgængelige kits tager normalt ca. 4 timer.
    4. Brug et mikrovolumen spektrofotometer for at sikre, at den kromosomale DNA-prøve er af høj kvalitet (A 260/280 > 1.8).
    5. For hvert kromosomalt DNA-isolat fremstilles polymerasekædereaktion (er) (PCR) på is i sterile 200 μl PCR-rør (r) og amplificerer områder af ctxB og tcpA under anvendelse af standard PCR-komponenter: Taq- polymerase og buFfer (eller ækvivalenter), dNTP-opløsning og frem / tilbage-primere. Brug standard PCR parametre (~ 3 timer). Brug for eksempel følgende protokol:
      1. Indledende denaturering ved 95 ° C i 120 s.
      2. Denaturer ved 95 ° C i 60 s.
      3. Anneal-primere ved 60 ° C i 45 s.
      4. Forlæng ved 72 ° C i 90 s.
      5. Gentag trin 3.1.5.2 til 3.1.5.4 i 34 cykler.
      6. Endelig forlængelse 72 ° C i 600 s.
      7. Uendelig hold ved 4 ° C.
    6. Farve 5 μl af det respektive PCR-produkt (er) ved anvendelse af et standard 6x DNA gelindladningsfarvestof og anbring ca. 10 μl 1 kb ladder og 10 μl PCR-produkt på en 1% agarosegel i 1x Tris-Borat-EDTA (TBE) puffer.
    7. Kør gelelektroforese ved 130 V, indtil farvestoffet når slutningen, men ikke af, af gelen (ca. 90 min). Konstant overvågning anbefales, da spænding og driftstider kan variere afhængigt af udstyret.
    8. Ved verifikation afVellykket PCR-amplifikation ved den forventede størrelse, rens det resterende 45 μl PCR-produkt (er) ved anvendelse af et kommercielt tilgængeligt DNA-ren og koncentratorkit.
    9. Sekvensrenset PCR-produkt (er) ved anvendelse af de samme primere, der anvendes til PCR-amplifikation, og udarbejder efter retningslinjer for lokal sekventeringsfacilitet.
    10. Sammenlign FASTA-formatet for gensekvenser fra hvert isolat til den offentliggjorte sekvens, der er tilgængelig på NCBI's websted (http://www.ncbi.nlm.nih.gov/gene/) ved at søge efter følgende tiltrædelsesnumre i søgefeltet.
    11. CtxB : (klassisk) region mellem VC0395_A1059 til VC0395_A1060 (El Tor) VC_1456
    12. TcpA : (klassisk) VC0395_A0353 (El Tor) VC_0828
  2. Fenotypiske assays for biotype klassificering via spotting
    1. Forbered natten over kulturen i flydende LB bouillon som tidligere angivet i protokol 2.2.
    2. Vask cellepellet (erne) som angivet i protokol 2.6.
    3. Brug en pipette tilPlacere 1 μl vasket kultur på respektive medium. For medievalg og inkubationsspecifikationer henvises til tabel 2.
  3. Motilitetsanalyse
    1. Forberede over natten kultur (er) i flydende LB bouillon som tidligere angivet i protokol 2.2.
    2. Vask cellepellet (erne) som angivet i protokol 2.6.
    3. Inokuler motilitetsagarplader ved at indsætte inokuleringsstik i den vaskede flydende kultur og "stikke" lodret ind i mediet. I mellem hver inokulering steriliserer trådstiften ved hjælp af en Bunsen-brænder, og når stakende agar skal det sikres, at inokuleringsstikket ikke bøjes, da dette kan ændre resultaterne.
    4. Inkubér plader lås-side op i 14 til 24 timer ved 37 ° C. Efter 14 timer overvåger motilitetspladerne tæt for at forhindre overvækst af kulturer.
  4. Voges-Proskauer (VP) Assay
    1. Forberede over natten kultur (er) i flydende LB bouillon som tidligere angivet i protokol 2.2.
    2. Inokulere 4Ml methylrød Voges-Proskauer eller MR-VP-bouillon ved pipettering af 10 μl tidligere fremstillet dagligt dyrkning i 4 ml MR-VP bouillon i et sterilt dyrkningsrør og inkubering med beluftning i en ryster-inkubator ved 225 rpm i 12-16 H ved 37 ° C.
    3. Tilsæt 150 μl 5% (w / v) a-naphthol og 50 μl 40% (vægt / volumen) KOH til 1 ml alikvoter af MR-VP overnight kultur i sterile kulturrør.
    4. Kortvarigt hvirvel og lad stå ved stuetemperatur i op til 4 timer, indtil farveændring udvikler sig.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

For korrekt vedligeholdelse og anvendelse af enhver bakteriestamme anbefales det at kende fordoblingstiden for den eller de pågældende belastninger. Heri er de varierende vækstrater for almindeligt anvendte V. Cholerae-stammer blev demonstreret gennem en vækstkurve, og omtrentlige fordoblingstider blev beregnet ved anvendelse af lineær regression. WT El Tor N16961 og El Tor variant MQ1795 viste kortere fordoblingstider (~ 1 h og ~ 1 h henholdsvis) end WT klassiske O395 (~ 2 h) ( Figur 1 , tabel 2 ).

V. cholerae genetisk manipulation og efterfølgende analyse er ofte afhængige af evnen til korrekt at skelne mellem biotyper. PCR-baserede genetiske skærme og fænotypiske analyser blev samlet implementeret som et pålideligt system til at skelne mellem biotype baggrunde af V. Kolerae kliniske og miljømæssige isolates; Til repræsentation, biotype reference stammer (WT klassisk O395, WT El Tor C6706 og WT El Tor N16961) og repræsentative El Tor varianter (MQ1795 og BAA-2163) blev inkluderet ( tabel 1 ). WT klassisk O395 demonstrerede klassiske ctxB- og tcpA- sekvenser. Omvendt demonstrerede WT El Tor stammerne N16961 og C6706 El Tor ctxB og tcpA sekvenser. Interessant nok indeholdt MQ1795 og BAA-2163 den klassiske biotype ctxB- underenhed, der var sammenlignelig med O395, men begge El Tor-varianter indeholdt tcpA'en, der var indicativ for El Tor-biotype-baggrunden ( tabel 1 ). WT klassisk biotype stamme O395 viste følsomhed over for polymyxin B, mens WT El Tor biotype stammer (C6706 og N16961) viste resistens og udviste vækst på LB agarplader suppleret med polymyxin B. De repræsentative El Tor variantstammer (MQ1795 og BAA-2163) viste Lignende resistens over for antibiotika i forhold til WT El Tor biotype straIns (C6706 og N16961) ( Figur 2 , tabel 2 ). WT klassisk biotypestamme O395 voksede ikke på minimalt citratmedium, mens WT El Tor-stammer (C6706 og N16961) var i stand til at udnytte citrat som en carbonkilde og udviser vækst på minimalt citratmedium. Repræsentative El Tor-variantbiotype-stammer (MQ1795 og BAA-2163) viste vækst, der var sammenlignelig med den for WT El Tor-biotype-stammerne (C6706 og N16961) ( Figur 3 , tabel 2 ). WT klassisk stamme O395 og WT El Tor stamme N16961 har en ikke-funktionel HapR og demonstrerede således ikke HapR-reguleret proteaseaktivitet; WT El Tor-stamme C6706 og repræsentative El Tor-varianter (MQ1795 og BAA-2163) er hapR- positive-visualiseret som en clearancezone, der kommer fra podningspunktet ( figur 4 , tabel 2 ). WT klassisk stamme O395 udskiller ikke hemolytiske enzymer og var derforE γ-hæmolytisk, mens WT El Tor-biotypestammer (C6706 og N16961) og repræsentative El Tor-variantstammer (MQ1795 og BAA-2163) udskiller hæmolytiske enzymer, der fuldstændigt lyser røde blodlegemer, der omgiver inokulationspunktet og viste β-hemolyse ( Figur 5 ; tabel 2 ). Motiliteten varierer over og inden for biotype stammer; WT El Tor stamme N16961 og El Tor varianter (MQ1795 og BAA-2163) viste imidlertid hypermotilitet sammenlignet med den relativt mindre motile WT klassiske stamme O395 og WT El Tor stamme C6706 ( Figur 6 , tabel 2 ). WT klassisk stamme O395 og repræsentative El Tor-varianter metaboliserede ikke glucose til fremstilling af acetoin, mens WT El Tor-biotypestammer producerede acetoin som et biprodukt af glucosefermentering som indikeret ved udvikling af en dyb rød farve under Voges-Proskauer-analysen ( Figur 7 ; Tabel 2 )

Strain CtxB- gen tcpA Reference
Base 115 Base 203 biotype biotype
O395 C C klassisk klassisk 8
C6706 T T El Tor El Tor 8
N16961 T T El Tor El Tor 8
MQ1795 C C klassisk El Tor 13
BAA-2163 C C klassisk El Tor 8

Tabel 1: Biotypeafhængige genetiske skillelinjer af Vibrio cholerae referencestammer. Vist i denne tabel er DNA-baseændringer og relative positioner i generne ctxB og tcpA . WT klassiske O395 og WT El Tor stammer N16961 og C6706 er almindeligt anvendte biotype reference stammer. MQ1795 og BAA-2163 er kendte El Tor-varianter.

assay Anvendelse Mellemvalg inkubation Forventede resultater
O395 C6706 N16961 MQ1795 BAA-2163
2.3) Vækstkurve 27 Bestemmer fordoblingstider for forskellige V. cholerae-stammer 1,2) Flydende LB-bouillon Op til 30 timer (37 ° C med beluftning) ~ 2 timer ND * ~ 1 time ~ 1 time ND *
3.1) PCR-baseret genetisk screening ved anvendelse af ctxB og tcpA 8 Differentierer mellem klassiske og El Tor biotype baggrunde af ctxB N / A N / A klassisk El Tor El Tor klassisk klassisk
Differentierer mellem klassiske og El Tor biotype baggrunde af tcpA N / A N / A klassisk El Tor El Tor El Tor El Tor
3.2) Polymyxin B-resistens 21 Følsomhed overfor antibiotika polymyxin B 1,5) LB agarplader suppleret med polymyxin B 18 timer (37 ° C) - + + + +
3.2) Citratmetabolisme 22 Evne til at metabolisere citrat som eneste kulstofkilde 1.6) Minimale citratmediumagarplader 24 timer (37 ° C) - + + + +
3.2) Kaseinhydrolyse 23 HapR-reguleret proteaseaktivitet 1.7) Mælkagarplader 18 timer (37 ° C) - - + + +
3.2) hæmolyse 23 Måler hæmolytisk aktivitet Blod agar plader 48 timer (37 ° C) Gamma Beta Beta Beta Beta
3.3) Motilitet 23 Måler grad af bevægelighed 1,8) Motilitetsagarplader 14-24 timer (37 ° C) 10 mm 15 mm 21 mm 25 mm 29 mm
3.4) Voges-Proskauer 21 Måler evne til at fermentere glocose og producere acetoin som et biprodukt 1,9) Flydende Voges-Proskauer medium Op til 4 timer (stuetemperatur) - + + - -
Bemærk: "ND *" betyder ikke bestemt; "+" Angiver et positivt resultat; "-" angiver et negativt resultat

Tabel 2: Sammendrag af genetiske og fænotypiske analyser anvendt til Vibrio cholerae Biotype Distinction. Denne tabel opsummerer de forskellige genetiske og fænotypiske analyser, anvendelser og forventede resultater, der kollektivt anvendes til at differentiere mellem klassiske og El Tor-biotyper anvendt i denne undersøgelse. Protokollnumre og referencer til specifikke protokoller er angivet i analysekolonnen. "ND *" betyder ikke bestemt; "+" Angiver et positivt resultat; "-" angiver et negativt resultat.

figur 1
Figur 1: V. Cholerae vækstkurve for WT klassisk O395, WT El Tor N16961 og El Tor Variant MQ1795. Væksthastigheder af biotype referencestammer (WT klassisk O395 og WT El Tor N16961) og repræsentativ El Tor Variant MQ1795, dyrket i LB bouillon med beluftning ved 37 ° C, blev analyseret ved måling af OD 600 eMeget time begynder ved T 0 . Vækstkurver blev udført på 8 uafhængige eksperimentelle replikater, hvor hver replik repræsenterer en uafhængig dyrkningshændelse for hvert forsøg. WT El Tor-stamme N16961 og El Tor-variant MQ1795 viste kortere fordoblingstider (~ 1 h og ~ 1 h henholdsvis) i forhold til WT klassisk stamme O395 (~ 2 timer), som observeret ved en længere fordoblingstid. Klik her for at se en større version af denne figur.

Figur 2
Figur 2: Bestemmelse af polymyxin B-resistens ved anvendelse af LB-agar suppleret med polymyxin B. Modstandsdygtighed overfor peptidantibiotikumpolymyxin B blev bestemt ved evnen til at vokse på LB-agar suppleret med 50 IE / μL polymyxin B. WT klassisk stamme O395 viste ingen vækst på agar supplTilsat polymyxin B og blev betragtet som følsomt for antibiotikumet. Mens WT El Tor-stammer (C6706 og N16961) og repræsentative El Tor-varianter (MQ1795 og BAA-2163) udviste vækst i nærvær af antibiotika og blev anset for resistente over for polymyxin B. Plader blev inkuberet ved 37 ° C i 18 timer. Klik her for at se en større version af denne figur.

Figur 3
Figur 3: Måling af citratmetabolisme ved anvendelse af minimal citratmedium. Evnen til at udnytte citrat som en eneste carbonkilde blev bestemt af isolatets evne til at vokse på minimal citratmedium. WT klassisk stamme O395 voksede ikke på minimalt citratmedium (negativt). Vækst var tydeligt af alle WT El Tor stammer (C6706 og N16961) og repræsentative ElTor-varianter (MQ1795 og BAA-2163), som demonstrerede evnen til at udnytte citrat som en eneste carbonkilde (positiv). Plader blev inkuberet ved 37 ° C i 18 timer. Klik her for at se en større version af denne figur.

Figur 4
Figur 4: Måling af HapR-reguleret proteolytisk kaseinhydrolyse ved anvendelse af mælkeagarmedie. Caseinhydrolyse gennem HapR-reguleret proteaseaktivitet blev bestemt ved en visuel zone for clearance, der omgiver podningspunktet på mælkeagar. Stammer indeholdende en ikke-funktionel HapR, såsom WT klassisk stamme O395 og WT El Tor stamme N16961, producerede ikke en zone for clearance, der omgiver inokulationspunktet ( hapR- negativt). WT El Tor stamme C6706 og repræsentative El Tor varianter (MQ1795 og BAA-2163) indeholder en funktionel HapR, som kan visualiseres som varierende mellemrums clearance ( hapR- positiv). Plader blev inkuberet ved 37 ° C i 18 timer. Klik her for at se en større version af denne figur.

Figur 5
Figur 5: Måling af hæmolytisk aktivitet ved anvendelse af blod agarmedier. Hemolytisk aktivitet blev målt under anvendelse af agarplader suppleret med fårens blod. WT klassisk stamme O395 udskiller ikke enzymer, der lyser røde blodlegemer (y-hæmolytisk). WT El Tor-stammer (N16961 og C6706) og repræsentative El Tor-varianter (MQ1795 og BAA-2163) udskiller hæmolytiske enzymer, hvilket resulterede i en gennemskinnelig zone for clearance, der omgiver inokulationspunktet (β-hæmolytisk). Plader blev inkuberet ved 37 ° C° C i 48 timer. Klik her for at se en større version af denne figur.

Figur 6
Figur 6: Bestemmelse af motilitet ved anvendelse af motilitetsagarplader. Zonen for bevægelighed blev indikeret ved en visuel farveændring af saltet TTC, der vender fra klart til rødt, når det metaboliseres, hvilket angiver, hvor bakterierne har flyttet. WT klassisk stamme O395 (10 mm) og WT El Tor stamme C6706 (15 mm) viste minimal bevægelighed, mens El Tor-stammen N16961 (21 mm) og repræsentative El Tor-varianter (MQ1795 (25 mm) og BAA-2163 (29 mm) ) Viste hypermotilitet i forhold til O395 og C6706. Plader blev inkuberet ved 37 ° C i 18 timer. Klik venligst påHer for at se en større version af denne figur.

Figur 7
Figur 7: Voges-Proskauer Assay. Acetoinproduktion via glucosefermentering blev bestemt under anvendelse af Voges-Proskauer-analysen. WT klassisk stamme O395 og repræsentative El Tor-varianter (MQ1795 og BAA-2163) producerede ikke acetoin som et resultat af glucosefermentering (negativ). WT El Tor stammer (N16961 og C6706) producerede biproduktet acetoin og kan visualiseres ved en dyb rød farveændring (positiv). Rør blev inkuberet ved stuetemperatur i 4 timer. Klik her for at se en større version af denne figur.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Af de over 200 identificerede V. Kolerae serogrupper, kun O1 og O139 har epidemisk potentiale. O1 serogruppen kan opdeles i to biotyper: klassisk og El Tor. Imidlertid er hybridstammer, betegnet El Tor-varianter 13 , 17 , fremkommet, der besidder El Tor-biotype-baggrunden, og har klassiske karakteristika 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 . Protokollerne beskrevet i dette manuskript er designet til at give efterforskere, der er interesserede i at karakterisere og / eller skelne forskellige kliniske og ikke-kliniske isolater af V. cholerae med en pålideligMulti-assay identifikationssystem. Anvendelse af et pålideligt multi-assay identifikationssystem som et alternativ er en forbedring i forhold til tidligere etablerede single-assay identifikationssystemer og arbejdskrævende genetiske skærme. Alle genotypiske og fænotypiske assays bør omfatte WT klassiske stamme O395 og WT El Tor stammer C6706 og N16961 til sammenligning ( Tabel 1 ). Mens de klassiske og El Tor-biotypestammer er medtaget som reference, kan isolater som MQ1795 og BAA-2163 inkluderet i vores undersøgelser vise fænotypiske profiler fra enten biotype ( Figur 2 , Figur 3 , Figur 4 , Figur 5 , Figur 6 , Figur 7 , tabel 2 ), der illustrerer behovet for analyse af multiple genotypiske og fænotypiske træk for pålidelig karakterisering. Alle protokoller bør udføres aseptiskeLy 26 ved stuetemperatur, medmindre andet er angivet. V. Cholerae er et biosikkerhedsniveau 2 (BSL-2) patogen, der er det etiologiske middel af den potentielt fatale gastrointestinale sygdomskolera; Korrekt håndtering og bortskaffelse af alle materialer og affaldsprodukter skal håndhæves efter institutionelle, lokale, statslige og føderale regler.

Forberedelse af alle medier og reagenser skal udføres ved hjælp af analysekvalitetsreagenser og ultrapure vand deioniseret til en mindste følsomhed på 18 MΩ-cm. Før behandling skal medierne fremstilles og tillades at tørre tilstrækkeligt (1-2 dage); Plader anses for at være tilstrækkeligt tørre, når der ikke er nogen resterende væske på overfladen af ​​agar. På grund af den bevægelige rækkevidde og zone for clearance omkring bakteriel vækst bør motilitet og mælkeplader fremstilles i store petriskåle (150 mm x 15 mm) op til 50 ml pr. Plade og kan opbevares i op til 1 uge pakket i plast , LiD-side ned ved 4 ºC. Derudover kan agarkoncentrationen af ​​bevægelsespladerne indstilles til at bremse bevægeligheden; Det anbefales dog ikke at overskride 3 g agar pr. 500 ml opløsning, da dette vil reducere den generelle motilitet væsentligt, således at forskelle ikke vil kunne observeres. Alle andre plademedier bør tilberedes til ca. 25 ml pr. Plade i standardstørrelser af petriskåle (100 mm x 15 mm) og kan opbevares i op til seks måneder indpakket i plast, låg nedad ved 4 ºC. Til fremstilling af polymyxin B-plader er det vigtigt at lade smeltede medier afkøle efter autoklavering før tilsætning af polymyxin B, da overdreven varme kan nedbryde antibiotika. Polymyxin B-plader kan opbevares i op til 3 måneder indpakket i plast, låg nedad ved 4 ºC. Analyser diskuteret i dette manuskript kræver en dag for enkeltkoloni vækst (12-16 timer), en ekstra dag til vækst af natten over kulturer (12-16 timer) og en tredje dag for overvejelser af genotypiske (~ 4 timer for kromosomal DNEn isolering og ~ 3 timer til PCR) eller fænotypiske analyser (18-48 timer, tabel 2 ). Forud for den biokemiske analyse af fænotypiske analyser, der er beskrevet i dette manuskript, skal kulturer vaskes i 1x PBS for at forhindre restkulturmedieoverførsel fra skævhedsresultater. Derudover kan polymyxin B, citrat, proteaseaktivitet, hæmolyse og motilitetsanalyser inokuleres samtidigt under anvendelse af en enkelt vasket overnightkultur. Ved spotting af pletterede medier kan splatter af kulturer forekomme og kan resultere i krydskontaminering mellem stammer. For at forhindre splatter, undgå fuldstændig udstødning af kulturen fra pipetten, i stedet for at stoppe kulturen ved det første stop af pipetten. Tillad også at pletter absorberes fuldt ud i agaroverfladen forud for inkubation, og pas på ikke at punktere agar, hvilket kan påvirke resultaterne. Fenotypiske analyser resulterende i clearancezoner ( Figur 4 ; Figur 5 ; Tabel 2) Og / eller bevægelighed ( figur 6 , tabel 2 ), der omgiver inokulationspunktet, bør maksimalt fordeles for at forhindre sammenlægning af områder med clearance eller vækst, hvorpå de respektive diametre kan måles til sammenlignende analyse. Efter angivne inkubationstider kan isolater afbildes og analyseres i forhold til biotype referencestammer (WT klassisk O395, WT El Tor C6706 og WT El Tor N16961).

De PCR-baserede genetiske skærme gennem sekventering skitseret i dette manuskript kan anvendes til at identificere isolatets biotype baggrund med hensyn til ctxB og tcpA efter initial PCR amplifikation. Standard sekventeringsretningslinjer kræver en bestemt mængde PCR-produkt, afhængigt af størrelsen af ​​den amplificerede region (580 bp for ctxB og 1420 bp for tcpA ), og til opstilling af reaktionerne kan etablerede protokoller følges. Kort sagt, individuelle fremadrettede og rEverse sekvenseringsreaktioner bør fremstilles med 3-5 pmol primer / reaktion, og volumenet bør indstilles til 20 μl med sterilt ultrapure vand i et 1,5 ml mikrocentrifugerør. For hjælp i primer design til både PCR amplifikation og sekventering kan NCBI primer design værktøj http://www.ncbi.nlm.nih.gov/tools/primer-blast/ udnyttes. Succesfuld amplifikation og sekventering af ctxB og tcpA er blevet udført under anvendelse af følgende primere (5 '→ 3'): ctxB- fremad GGGAATGCTCCAAGATCATCGATGAGTAATAC, ctxB- omvendt CATCATCGAACCACAAAAAAGCTTACTGAGG, tcpA- fremad CCGCACCAGATCCACGTAGGTGGG, tcpA- omvendt GTCGGTACATCACCTGCTGTGGGGGCAG. Det skal bemærkes, at hele kodningsområdet for ctxB er konserveret på tværs af begge biotyper bortset fra basispositioner 115 og 203 (både cytosin i klassisk og thymin i El Tor). Derudover bevares flere baseændringer i tcpA blandt de biotyper, der dIffer på tværs af de to biotyper ( tabel 1 ), som kan bruges til at skelne mellem biotyper.

I mange laboratorieundersøgelser, der involverer modelorganismen V. Koleraer, korrekt vedligeholdelse og dyrkningsteknikker er kritiske 27 . Vækstraten for almindeligt anvendte V. Cholerae biotype reference stammer, såsom WT klassisk stamme O395 og WT El Tor stamme N16961, kan tilvejebringe nyttig indsigt i karakteriseringen af ​​El Tor variant isolater ( Figur 1 , tabel 2 ). På grund af de varierende vækstrater på tværs af V. Kolerae-isolater, er det vigtigt at tage spektrofotometerabsorbansaflæsninger hver time, indtil kulturerne opnår maksimal turbiditet i den sentrale stationære fase. Mid-til-sen dødsfase må muligvis ikke visualiseres på grund af et plateau i turbiditet som følge af overskydende cellulært affald. En 1: 4 fortynding af kultur til sterilt L B bouillon bør udføres for at opnå en komplet vækstkurve og opretholde præcisionen af ​​instrumentet, da absorbansaflæsninger spids ved en OD 600 ≈ 1,0. Ved udførelse af vækstkurver på flere stammer skal absorbansaflæsninger være tidsindstillet ca. 5 minutter fra hinanden for hver stamme for at sikre sammenhæng mellem aflæsninger. Forståelse V. Cholerae-biotypevæksthastigheder er afgørende for mange undersøgelser, herunder virulensgenekspressionstest, analyse af metaboliske aktiviteter og passende dyrknings- og opbevaringsbetingelser. Til efterfølgende analyse bør natten over kulturer behandles i den sene logbog til tidlig stationær vækstfase (12-16 timer) for at maksimere cellevæksten, men alligevel opretholde cellulær integritet.

Kultiveringsbetingelser for klassiske og El Tor-biotypestammer er ens, men analyse af virulensgenekspression i V. Cholerae kræver biotype-specifikke virulensinducerende tilstandeRef "> 19. De to vigtigste virulensfaktorer CT og TCP styres af master regulator ToxT og udtrykkes optimalt under specifikke vækstbetingelser, for eksempel under El Tor-virulensfremkaldende tilstande. ToxT kan analyseres ved behandling af helcelleekstrakt ( WCE) eller cellepelleten ved 3,5 timer, mens CT og TCP-ekspression kan analyseres ved behandling af den cellefri supernatant og WCE i henholdsvis 7,5 h og 8,20. De forskellige genotypiske og fænotypiske træk, der er demonstreret i hele dette manuskript, angiver, hvordan Forskellige V. Cholerae-biotyper kan være og illustrere behovet for et alternativ til tidligere anvendte single-assay biotype karakterisering.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har intet at afsløre.

Acknowledgements

Forskning understøttet af New Hampshire-INBRE gennem en institutionel udviklingspris (IDeA), P20GM103506, fra National Institute of General Medical Sciences of the NIH.

Materials

Name Company Catalog Number Comments
1 kb DNA Ladder New England Biolabs N3232S https://www.neb.com/products/n3232-1-kb-dna-ladder
60% Glycerol Calbiochem 356352 http://www.emdmillipore.com/US/en/product/Glycerol%2C-Molecular-Biology-Grade---CAS-56-81-5---Calbiochem,EMD_BIO-356352
Agar Becto, Dickinson and Co. 214030 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=214030&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D214030%26typeOfSearch%3DproductSearch
Agar with brain-heart infusion Becto, Dickinson and Co. 237500 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=237500&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D237500%26typeOfSearch%3DproductSearch
Agarose Peqlab 732-2789 https://de.vwr.com/store/catalog/product.jsp?catalog_number=732-2789&_DARGS=/store/cms/de.vwr.com/de_DE/header_2016111711383215.jsp_AF&_dynSessConf=1766917479792147141&targetURL=/store/catalog/product.jsp%3Fcatalog_number%3D732-2789&lastLanguage=en&/vwr/userprofiling/EditPersonalInfoFormHandler.updateLocale=&_D%3AcurrentLanguage=+&currentLanguage=en&_D%3AlastLanguage=+&_D%3A/vwr/userprofiling/EditPersonalInfoFormHandler.updateLocale=+
Anhydrous K2HPO4 Fisher Scientific P288-500 https://www.fishersci.com/shop/products/potassium-phosphate-dibasic-anhydrous-crystalline-powder-certified-acs-fisher-chemical-5/p288500?searchHijack=true&searchTerm=P288500&searchType=RAPID
Blood Agar Plates Remel R01200 Store at 4 °C;  http://www.remel.com/Catalog/Item.aspx?name=Blood+Agar
Boric Acid Fisher Scientific A73-500 https://www.fishersci.com/shop/products/boric-acid-crystalline-certified-acs-fisher-chemical-6/a73500?searchHijack=true&searchTerm=A73500&searchType=RAPID
Bromothymol Blue Fisher Scientific B388-10 https://www.fishersci.com/shop/products/bromothymol-blue-certified-acs-fisher-chemical/b38810?searchHijack=true&searchTerm=B38810&searchType=RAPID
Cirtric acid ·H2O Fisher Scientific S72836-3 https://www.fishersci.com/shop/products/citric-acid-monohydrate-4/s728363#?keyword=s728363
Deoxynucleotide (dNTP) Solution Kit New England Biolabs N0446S Store at -20 °C;  https://www.neb.com/products/n0446-deoxynucleotide-solutionset
Disodium EDTA Fisher Scientific S311-500 https://www.fishersci.com/shop/products/ethylenediaminetetraacetic-acid-disodium-salt-dihydrate-crystalline-certified-acs-fisher-chemical-7/s311500?searchHijack=true&searchTerm=S311500&searchType=RAPID
DNA Clean & Concentrator™ -25 Kit Zymo Research D4007 http://www.zymoresearch.com/dna/dna-clean-up/zymoclean-gel-dna-recovery-kit
GelGreen Nucleic Acid Stain Biotium 41005 https://biotium.com/product/gelgreentm-nucleic-acid-gel-stain-10,000x-in-water/
Genesys 10SUV-VIS Spectrophotometer Thermo Scientific 840-208100 https://www.thermofisher.com/order/catalog/product/840-208100?ICID=search-840-208100
Gentra Puregene Yeast/Bact. Kit Qiagen 158567 https://www.qiagen.com/us/shop/sample-technologies/dna/dna-preparation/gentra-puregene-yeastbact-kit/#orderinginformation
HCl Fisher Scientific A144-212 Corrosive;  https://www.fishersci.com/shop/products/hydrochloric-acid-certified-acs-plus-fisher-chemical-10/a144212?searchHijack=true&searchTerm=A144212&searchType=RAPID
KCl Fisher Scientific P217-500 https://www.fishersci.com/shop/products/potassium-chloride-crystalline-certified-acs-fisher-chemical-4/p217500?searchHijack=true&searchTerm=P217500&searchType=RAPID
KH2PO4 Fisher Scientific P285-500 https://www.fishersci.com/shop/products/potassium-phosphate-monobasic-crystalline-certified-acs-fisher-chemical-5/p285500?searchHijack=true&searchTerm=P285500&searchType=RAPID
KOH Fisher Scientific P250-500 https://www.fishersci.com/shop/products/potassium-hydroxide-pellets-certified-acs-fisher-chemical-5/p250500?searchHijack=true&searchTerm=P250500&searchType=RAPID
Le Loop Decon Labs Inc. MP190-25 http://deconlabs.com/products/leloop/
Le Stab Decon Labs Inc. MP186-5 http://deconlabs.com/products/lestab/
MgSO4·7H2O Fisher Scientific M63-500 https://www.fishersci.com/shop/products/magnesium-sulfate-heptahydrate-crystalline-certified-acs-fisher-chemical-3/m63500?searchHijack=true&searchTerm=M63500&searchType=RAPID
Mini-Sub Cell GT Horizontal Electrophoresis System Bio Rad Labs 1704406 http://www.bio-rad.com/en-us/product/mini-sub-cell-gt-cell?WT.srch=1&WT.mc_id=aw-cbb-NA-sub_cell_systems_brand_gold&WT.knsh_id=7eb1981f-a011-42a3-aece-1236ff453373
MR-VP Broth Difco 216300 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=216300&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3Dmr-vp%2Bmedium%26typeOfSearch%3DproductSearch
Na2HPO4 Fisher Scientific S374-500 https://www.fishersci.com/shop/products/sodium-phosphate-dibasic-anhydrous-granular-powder-certified-acs-fisher-chemical-5/s374500?searchHijack=true&searchTerm=S374500&searchType=RAPID
NaCl Fisher Scientific S271-10 https://www.fishersci.com/shop/products/sodium-chloride-crystalline-certified-acs-fisher-chemical-6/s27110?searchHijack=true&searchTerm=S27110&searchType=RAPID
NaHCO3 Fisher Scientific S233-500 https://www.fishersci.com/shop/products/sodium-bicarbonate-powder-certified-acs-fisher-chemical-5/s233500?searchHijack=true&searchTerm=S233500&searchType=RAPID
NaNH4HPO4·4H2O Fisher Scientific S218-500 https://www.fishersci.com/shop/products/sodium-ammonium-phosphate-tetrahydrate-crystalline-certified-fisher-chemical/s218500?searchHijack=true&searchTerm=S218500&searchType=RAPID
NanoDrop Lite Spectrophtometer Thermo Scientific ND-LITE-PR https://www.thermofisher.com/order/catalog/product/ND-LITE-PR?ICID=search-ND-LITE-PR
Nonfat dry milk Nestle Carnation N/A N/A
Peptone Becto, Dickinson and Co. 211677 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=211677&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D211677%26typeOfSearch%3DproductSearch
Petri Dishes (100 mm x 15 mm) Fisher Scientific FB0875712 https://www.fishersci.com/shop/products/fisherbrand-petri-dishes-clear-lid-12/fb0875712#?keyword=FB0875712
Petri Dishes (150 mm x 15 mm) Fisher Scientific FB0875714 https://www.fishersci.com/shop/products/fisherbrand-petri-dishes-clear-lid-12/fb0875714?searchHijack=true&searchTerm=FB0875714&searchType=RAPID
Polymyxin B sulfate salt Sigma-Aldrich P1004-10MU Store at 2-4 °C; http://www.sigmaaldrich.com/catalog/product/sial/p1004?lang=en&region=US
Taq DNA Polymerase New England Biolabs M0273S Store at -20 °C; https://www.neb.com/products/m0273-taq-dna-polymerase-with-standard-taq-buffer
Taq Reaction Buffer New England Biolabs M0273S Store at -20 °C;  https://www.neb.com/products/m0273-taq-dna-polymerase-with-standard-taq-buffer
Thermal Cycler Bio-Rad C1000 Touch™  Bio Rad Labs 1840148 http://www.bio-rad.com/evportal/evolutionPortal.portal?_nfpb=true&_pageLabel=search_page&sfMode=search&sfStartNumber=1&clearQR=true&js=1&searchString=1840148&database=productskus+productcategories+productdetails+abdProductDetails+msds+literatures+inserts+faqs+downloads+webpages+assays+genes+pathways+plates+promotions&tabName=DIVISIONNAME
Triphenyltetrazolium chloride Alfa Aesar A10870 https://www.alfa.com/en/catalog/A10870/
Tris Base Fisher Scientific BP152-1 https://www.fishersci.com/shop/products/tris-base-white-crystals-crystalline-powder-molecular-biology-fisher-bioreagents-7/bp1521?searchHijack=true&searchTerm=BP1521&searchType=RAPID
Tryptone Becto, Dickinson and Co. 211705 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=211705&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D211705%26typeOfSearch%3DproductSearch
Yeast Extract Becto, Dickinson and Co. 212750 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=212750&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D212750%26typeOfSearch%3DproductSearch
α-napthol MP Biomedicals 204189 http://www.mpbio.com/product.php?pid=05204189

DOWNLOAD MATERIALS LIST

References

  1. Shimada, T., et al. Extended serotyping scheme for Vibrio cholerae. Curr. Microbiol. 28, (3), 175-178 (1994).
  2. Yamai, S., Tadayuki, O., Toshio, S., Yasuji, K. Distribution of serogroups of Vibrio cholerae non-O1 non-O139 with specific reference to their ability to produce cholera toxin, and addition of novel serogroups. Jpn. J. Infect. Dis. 71, (10), 1037-1045 (1997).
  3. Karaolis, D. K., Lan, R., Reeves, P. R. The sixth and seventh cholera pandemics are due to independent clones separately derived from environmental, nontoxigenic, non-O1 Vibrio cholerae. J. Bacteriol. 177, (11), 3191-3198 (1995).
  4. Albert, M. J., et al. Large epidemic of cholera-like disease in Bangladesh caused by Vibrio cholerae O139 synonym Bengal. Lancet. 342, (8868), 387 (1993).
  5. Barua, D. History of Cholera. Cholera. Barua, D., Greenough III, W. B. Plenum Publishing Corporation. 1-36 (1992).
  6. Morales, R., Delgado, G., Cravioto, A. Population Genetics of Vibrio cholerae. Vibrio cholerae-Genomics and Molecular Biology. Faruque, S. M., Nair, G. B. Caister Academic Press. 29-47 (2008).
  7. Samadi, A. R., Chowdhury, M. K., Huq, M. K., Khan, M. U. Seasonality of classical and El Tor cholera in Dhaka, Bangladesh: 17-year trends. Trans. R. Soc. Trop. Med. Hyg. 77, (6), 853-856 (1983).
  8. Son, M. S., Megli, C. J., Kovacikova, G., Qadri, F., Taylor, R. K. Characterization of Vibrio cholerae O1 El Tor biotype variant clinical isolates from Bangladesh and Haiti, including a molecular genetic analysis of virulence genes. J. Clin. Microbiol. 49, (11), 3739-3749 (2011).
  9. Ghosh-Banerjee, J., et al. Cholera toxin production by the El Tor variant of Vibrio cholerae O1 compared to prototype El Tor and classical biotypes. J. Clin. Microbiol. 48, (11), 4283-4286 (2010).
  10. Ansaruzzaman, M., et al. The Mozambique cholera vaccine demonstration project coordination group. Cholera in Mozambique, variant of Vibrio cholerae. Emerg. Infect. Dis. 10, (11), 2057-2059 (2004).
  11. Ansaruzzaman, M., et al. Genetic diversity of El Tor strains of Vibrio cholerae O1 with hybrid traits isolated from Bangladesh and Mozambique. Int. J. Med. Microbiol. 297, (6), 443-449 (2007).
  12. Lan, R., Reeves, P. R. Pandemic spread of cholera: genetic diversity and relationships within the seventh pandemic clone of Vibrio cholerae determined by amplified fragment length polymorphism. J. Clin. Microbiol. 40, (1), 172-181 (2002).
  13. Nair, G. B., Faruque, S. M., Bhuiyan, N. A., Kamruzzaman, M., Siddique, A. K., Sack, D. A. New variants of Vibrio cholerae O1 biotype El Tor with attributes of the classical biotype from hospitalized patients with acute diarrhea in Bangladesh. J. Clin. Microbiol. 40, (9), 3296-3299 (2002).
  14. Nair, G. B., et al. Isolation of Vibrio cholerae O1 strains similar to pre-seventh pandemic El Tor strains during an outbreak of gastrointestinal disease in an island resort in Fiji. J. Med. Microbiol. 55, (11), 1559-1562 (2006).
  15. Nair, G. B., Mukhopadhyay, A. K., Safa, A., Takeda, Y. Emerging hybrid variants of Vibrio cholerae O1. Vibrio cholerae—Genomics and Molecular Biology. Faruque, S. M., Nair, G. B. Horizon Scientific Press. 179-190 (2008).
  16. Safa, A., et al. Genetic characteristics of Matlab variants of Vibrio cholerae O1 that are hybrids between classical and El Tor biotypes. J. Med. Microbiol. 55, (11), 1563-1569 (2006).
  17. Nusrin, S., et al. Diverse CTX phages among toxigenic Vibrio cholerae O1 and O139 strains isolated between 1994 and 2002 in an area where cholera is endemic. J. Clin. Microbiol. 42, (12), 5854-5856 (2004).
  18. Carignan, B. M., Brumfield, K. D., Son, M. S. Single nucleotide polymorphisms in regulator-encoding genes have an additive effect on virulence gene expression in a Vibrio cholerae clinical isolate. mSphere. 1, (5), e00253 (2016).
  19. Iwanaga, M., Yamamoto, K., Higa, N., Ichinose, Y., Nakasone, N., Tanabe, M. Culture conditions for stimulating cholera toxin production by Vibrio cholerae O1 El Tor. Microbiol. Immunol. 30, (11), 1075-1083 (1986).
  20. DiRita, V. J., Claude, P., Georg, J., Mekalanos, J. J. Regulatory cascade controls virulence in Vibrio cholerae. Proc. Natl. Acad. Sci. USA. 88, (12), 5403-5407 (1991).
  21. Kovacikova, G., Lin, W., Skorupski, K. Duel regulation of genes involved in acetoin biosynthesis and motility/biofilm formation by the virulence activator AphA and the acetate-responsive Lys-R type regulator AlsR in Vibrio cholerae. Mol. Microbiol. 57, (2), 420-433 (2005).
  22. Vogel, H. J., Bonner, D. M. Acetylornithinase of Escherechia coli: partial purification and some properties. J. Biol. Chem. 218, (1), 97-106 (1956).
  23. Son, M. S., Taylor, R. K. Genetic screens and biochemical assays to characterize Vibrio cholerae O1 biotypes: classical and El Tor. Curr. Protoc. Microbiol. 6A.2.1-6A.2.17 (2011).
  24. Kovacikova, G., Skorupski, K. Regulation of virulence gene expression in Vibrio cholerae by quorum sensing: HapR functions at the aphA promoter. Mol. Microbiol. 46, (4), 1135-1147 (2002).
  25. Wang, Y., et al. The prevalence of functional quorum-sensing systems in recently emerged Vibrio cholerae toxigenic strains. Environ. Microbiol. Rep. 3, (2), 218-222 (2011).
  26. Sanders, E. R. Aseptic laboratory techniques. J. Vis. Exp. (63), e3064 (2012).
  27. Martinez, R. M., Megli, C. J., Taylor, R. K. Growth and laboratory maintenance of Vibrio cholerae. Curr. Protoc. 6A.1.1-6A.1.6 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics