Laboratoriumtechnieken die gebruikt worden om biotypes van te houden en te onderscheiden * These authors contributed equally

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Dit manuscript beschrijft de juiste Vibrio cholerae onderhoudstechnieken naast een reeks biochemische analyses, collectief gebruikt voor snelle en betrouwbare differentiatie tussen klinische en milieuvriendelijke V. Cholerae biotypen in een laboratorium omgeving.

Cite this Article

Copy Citation | Download Citations

Brumfield, K. D., Carignan, B. M., Ray, J. N., Jumpre, P. E., Son, M. S. Laboratory Techniques Used to Maintain and Differentiate Biotypes of Vibrio cholerae Clinical and Environmental Isolates. J. Vis. Exp. (123), e55760, doi:10.3791/55760 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

De aquatische Gram-negatieve bacterie Vibrio cholerae is het etiologische middel van de infectieuze gastro-intestinale ziekte cholera. Vanwege de wereldwijde prevalentie en ernst van deze ziekte, V. Cholerae is uitgebreid bestudeerd in zowel milieu- als laboratoriuminstellingen, waarbij de juiste onderhouds- en cultuurtechnieken nodig zijn. Klassieke en El Tor zijn twee hoofdbiotypes die de V componeren. Cholerae O1 serogroep, die elk unieke genotypische en fenotypische eigenschappen tonen die betrouwbare mechanismen voor biotype karakterisering verschaffen, en vereisen duidelijke virulentie-inducerende kweekomstandigheden. Ongeacht het biotype van de causatieve stam voor een gegeven infectie of uitbraak, omvat de standaardbehandeling voor de ziekte rehydratietherapie, aangevuld met een antibiotica regime. Biotype classificatie kan echter nodig zijn voor laboratoriumstudies en kunnen bredere effecten hebben op het biomedische gebied.In het begin van 2000 werden klinische isolaten geïdentificeerd die genotypische en fenotypische eigenschappen uit zowel klassieke als El Tor-biotypes vertoonden. De nieuw geïdentificeerde hybriden, aangeduid als El Tor varianten, hebben de biotype-identificatie van klinische en milieu-isolatie complexer geworden dan eerdere traditionele identiteitsprotocollen met een enkelvoudige test. Naast het omschrijven van V. Cholerae algemene onderhouds- en cultuurtechnieken beschrijft dit manuscript een reeks genspecifieke ( ctxB en tcpA ) PCR gebaseerde genetische schermen en fenotypische analyses (polymyxine B resistentie, citraat metabolisme, proteolytische activiteit, hemolytische activiteit, motiliteit en glucose metabolisme via Voges- Proskauer assay) collectief gebruikt om te karakteriseren en / of te onderscheiden tussen klassieke en El Tor biotypes. Samen vormen deze analyses een efficiënte systematische aanpak die als alternatief kan worden gebruikt, of bovendien dure, arbeidsintensieve experimenten in de characterizaVerdeling van V. Cholerae klinische (en milieu) isolaten.

Introduction

Cholera is een ziekte van de distale dunne darm, veroorzaakt door de consumptie van verontreinigd voedsel of water dat de aquatische Gram-negatieve bacterie Vibrio cholerae bevat . Symptomen van cholera omvatten braken en onbeheersbare waterige diarree, wat leidt tot ernstige uitdroging, die, indien niet goed behandeld, tot de dood zal leiden. V. Cholerae kan worden verdeeld in meer dan 200 serogroepen op basis van de structuur van het lipopolysaccharide O-antigen van het celoppervlak. Echter, slechts 2 serogroepen, O1 en O139, hebben epidemie of pandemische potentieel 1 , 2 getoond. Bovendien is serogroep O139 voornamelijk geïsoleerd voor Zuidoost-Azië 3 , 4 , terwijl serogroep O1 wereldwijd wordt verspreid. Bovendien kan de O1 serogroep worden verdeeld in 2 hoofdbiotypes: klassiek en El Tor. Het klassieke biotype was verantwoordelijk voor de eerste 6 cholera pandemieS tussen 1817 en 1923. De lopende zevende pandemie is een gevolg van het El Tor biotype, dat het klassieke biotype wereldwijd in de omgeving 5 , 6 , 7 heeft verplaatst. Recent zijn er stammen ontstaan ​​die onderscheidende kenmerken bevatten van zowel klassieke als El Tor biotypen 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 en zijn sindsdien El Tor varianten 13 , 17 genoemd . Sommige El Tor varianten hebben verhoogde virulentiecapaciteiten aangetoond met een snellere en ernstige ziekteprogressie dan eerder waargenomen, onderstrepenDe behoefte aan een meer omvattende aanpak van agentidentificatie en preventie en behandeling van ziekte 8 , 9 , 18 . Terwijl de identificatie van biotype de behandeling niet onmiddellijk dicteert, kunnen verdere ontwikkelingen in vaccinontwikkeling en toekomstige therapeutische middelen profiteren van biotype onderscheid.

De eerste reeks protocollen die hier worden vermeld, zullen de onderzoekers in staat stellen V te behouden. Cholerae stammen in een laboratorium omgeving. Consistentie en daaropvolgende analyse vereist voorraadbereiding en groei van isolaten, die niet biotype afhankelijk zijn. Om de virulentie-expressie optimaal te stimuleren, zijn echter onafhankelijke biotype-specifieke cultiveringsmethoden vereist. 19 . Daarnaast worden voorbereidingen voor diverse genetische en biochemische analyses beschreven in dit manuscript.

Cholera toxine (CT) en de toxine co-reGeulate pilus (TCP) zijn twee belangrijkste virulentie factoren die worden geregeld door de master regulator ToxT in beide biotypen van de V. Cholerae O1 serogroep 20 . CT is een twee-deeltjes toxine samengesteld uit vijf CtxB Subeenheden die een enkele CtxA subeenheid omringen en verantwoordelijk zijn voor het snelle elektrolytverlies geassocieerd met cholera. TCP is een type IV pilus gecodeerd door de tcp operon ( tcpABQCRDSTEF ), en is betrokken bij de bevestiging en kolonisatie van de distale dunne darm. TcpA is het eerste gen van de tcp operon die codeert voor de individuele pilin subunits die essentieel zijn voor de constructie van de pilus 8 . De gensequentie voor ctxA is volledig geconserveerd tussen klassieke en El Tor- biotypen , terwijl ctxB en tcpA verschillen over de twee biotypes, maar worden bewaard binnen elk biotype 8 . CtxB is volledig bewaard tussen biotypes, behalve bij twee basisposi(115 en 203). In het El Tor biotype woont thymine bij basisposities 115 en 203, terwijl het klassieke biotype cytosine bij deze basen bevat. TcpA is volledig bewaard binnen elk biotype, maar verschilt op meerdere bases tussen biotypes. Deze genetische onderscheidingen dienen als primaire biotype identificatiemarkers, en na sequencing van het polymerase kettingreactie (PCR) amplificatieproduct omvattende deze sites kunnen isolate sequenties worden vergeleken met wildtype (WT) klassieke O395 of WT El Tor N16961 om de biotype achtergrond te bepalen Van respectievelijk CT en TCP, in een gegeven V. cholerae isolaat.

Er zijn veel protocollen ontwikkeld om de fenotypische onderscheidingen te karakteriseren tussen de klassieke en El Tor biotypes 21 , 22 , 23 . Polymyxine B is een peptide antibioticum dat de integriteit van het buitenste celmembraan in Gram-negatieve bac compromiseertTeria en polymyxine B resistentie kunnen worden weergegeven door middel van de polymyxine B resistentie assay 21 . Citraat is een primaire substraat van de Kreb-cyclus, en het vermogen om citraat te metaboliseren als enige koolstofbron kan worden bepaald met behulp van de citraatmetabolisme-analyse 22 . HapR codeert voor een globale regulator en de master quorum sensing regulator in V. cholerae, HapR, die bindt aan verschillende promotor regio's en regelt gen- en operon expressie 24 . Sommige pathogene stammen van V. cholerae hebben een natuurlijk voorkomende frame-shift mutatie in het hapR gen dat heeft geleid tot deze dichtheidsafhankelijke regulering van de virulentie genuitdrukking 24 , 25 verloren gaan. Het meten van HapR-gereguleerde protease-activiteit met behulp van melkagaremedia laat de onderzoeker toe om te bepalen of een specifiek isolaat een functionele HapR 23 bevat . DeHemolyse assay tests voor het vermogen van een stam hemolytische enzymen af ​​te scheiden die rode bloedcellen lichten; De mate van hemolyse kan worden weergegeven op bloed agarplaten 23 . Motiliteit wordt vaak geassocieerd met virulentie in V. cholerae en kan geanalyseerd worden met behulp van motiliteitsagarplaten 23 . De Voges-Proskauer test test voor het vermogen van glucose om glucose als een koolstofbron te fermenteren en de bijproduct acetoïne 21 te produceren. Met de opkomst van El Tor varianten is het moeilijk om de resultaten van een gegeven fenotypische test te voorspellen zonder uitgebreid genotype screening en voordat de biotype achtergrond van V wordt afgetrokken. Cholerae isolaten, wordt het aanbevolen dit samenstel van analyses 23 uit te voeren en de resultaten te vergelijken met referentiestammen zoals in Tabel 2 .

Hierin hebben we een reeks protocollen geavanceerd, die collectief gebruik maken van de aforemNtioned genotypische en fenotypische analyses voor een meer uitgebreide aanpak om V te karakteriseren. Cholerae biotypes. Verder hebben we de genotypische en fenotypische onderscheidingen van bekende V beschreven. Cholerae El Tor varianten (MQ1795 en BAA-2163), in vergelijking met veelgebruikte biotype referentiestammen (WT klassieke O395, WT El Tor C6706 en WT El Tor N16961; Tabel 1 ). De opkomst van El Tor varianten heeft uitdagingen voorgedragen aan de betrouwbaarheid van eerder gebruikte single-assay biotype karakterisering protocollen; Dit multiple assay identificatie systeem zal echter toelaten voor betrouwbare karakterisering van klinische en milieu V. Cholerae isolaten.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Opmerking: Tijdsoverwegingen voor elke analyse moeten worden gemaakt omdat individuele mediapreparaten verschillende tijden vereisen. Bijvoorbeeld, solide agarplaatmedia mogen voldoende koelen en drogen (1-2 dagen). Extra tijdsoverwegingen ( dwz enkele kolonie en overnachtende cultuurgroei) worden onder elk protocol gespecificeerd en worden in tabel 2 gevonden.

1. Voorbereiding van media

  1. 1x fosfaatbufferde zoutoplossing (PBS)
    1. Weeg 4,0 g NaCl, 0,1 g KCl, 0,72 g Na 2 HPO 4 en 0,12 g KH 2 PO 4 . Combineer de bestanddelen in een 1 L Erlenmeyer-fles, doseer het volume tot 500 ml met gedeïoniseerd water, stel de pH aan op 7.2 met behulp van een pH-meter en voeg HCl druppelsgewijs toe aan de oplossing en autoklaaf of filtersteriliseer met een 0,22 μm filter. 1x PBS kan voor onbepaalde tijd bij kamertemperatuur worden opgeslagen.
      VOORZICHTIG: HC1 is een geconcentreerd zuur en moet volgens de behandeling worden behandeldNaar institutionele, lokale, staats- en federale regelgeving. Voor de juiste gebruiksaanwijzingen verwijzen wij u naar het veiligheidsinformatieblad dat door de fabrikant is verstrekt.
  2. Luria-Bertani (LB) bouillon
    1. Weeg 5,0 g trypton, 2,5 g gist extract en 2,5 g NaCl. Combineer de bestanddelen in een 1 liter fles, doseer het volume tot 500 ml met gedeïoniseerd water, autoclaaf, en houd deze bij maximaal 6 maanden op kamertemperatuur. Voor klassieke biotype virulentie-inducerende omstandigheden, pas de pH aan op 6,5 met behulp van HCI voorafgaand aan autoclaving.
  3. AKI-medium dat 0,03% (w / v) NaHC03 bevat
    1. Voor component 1 (AKI medium): weeg 7,5 g pepton, 2,0 g gist extract en 2,5 g NaCl. Combineer de bestanddelen in een 1 liter fles, stel het volume in op 450 ml met gedeïoniseerd water en autoclaaf. AKI-medium kan maximaal 6 maanden bij kamertemperatuur worden opgeslagen.
    2. Voor Component 2 (NaHCO 3 ): weeg 1,5 g NaHCO 3 en stel het volume aanTot 50 ml met gedeïoniseerd water in een steriele vesikel. Filter NaHCO 3 steriliseren met een 0,22 μm filter. NaHCO 3 moet onmiddellijk voor gebruik worden bereid.
    3. Combineer de twee componenten aseptisch en creëer een 1:10 verhouding door Component 2 te filteren in component 1 voorafgaand aan gebruik.
  4. Luria-Bertani (LB) Agarplaten
    1. Weeg 5,0 g trypton, 2,5 g gist extract, 2,5 g NaCl en 7,5 g agar. Combineer de bestanddelen in een 1 L Erlenmeyer-fles, zet het volume op 500 ml met gedeïoniseerd water, autoclaaf, en berei het in standaardmaat 100 mm x 15 mm steriele Petri-afwas. Plated media kunnen voor maximaal 6 maanden in plastic verpakt worden, met deksel omhoog bij 4 ° C.
  5. LB-agarplaten, aangevuld met polymyxine B
    1. Voor component 1 (LB agar): weeg 5,0 g trypton, 2,5 g gist extract, 2,5 g NaCl en 7,5 g agar. Combineer de bestanddelen in een 1 L Erlenmeyer fles, stel het volume in op 500 mL wiGedioniseerd water en autoclaaf.
    2. Voor component 2 (polymyxine B): ontleed polymyxine B in gedeïoniseerd water in een steriele 2 ml microcentrifugebuis tot een concentratie van 50.000 IE / μL en filtersteriliseer met behulp van een 0,22 μm filter.
    3. Zodra Component 1 koel is, maar nog niet gestolde, voegt 500 μL component 2 tot component 1 aseptisch een eindconcentratie van 50 IE / μL toe en meng het grondig. Bereid u voor in standaardmaat 100 mm x 15 mm steriele Petri-schotels door het mixen van gemengd agar media in de Petri-schotels. Geplateerde media kunnen gedurende maximaal 3 maanden in plastic verpakt worden, met deksel omhoog bij 4 ° C.
  6. Minimale Citraat Medium Agar Platen
    1. Voor component 1 (agar met bromothymol blauw): weeg 7,5 g agar en 0,02 g bromothymol blauw. Combineer de bestanddelen in een 1 L Erlenmeyer fles, stel het volume aan 450 ml met gedeïoniseerd water en autoclaaf het mengsel.
    2. Voor Component 2 (10x VBMM): weeg 1.0 g MgSO 4 7H 2 O, 10,0 g citroenzuurH 2 O, 50,0 g anhydride K 2 HPO 4 en 17,5 g NaNH 4 HPO 4 4H 2 O. Combineer de bestanddelen in een 1 L Erlenmeyer-fles, stel het volume in op 500 ml Met gedeïoniseerd water en autoclaaf of filtersteriliseren met behulp van een 0,22 μm filter. 10x VBMM kan worden opgeslagen bij kamertemperatuur tot 6 maanden.
    3. Voeg 50 ml Component 2 aan Component 1 toe en berei in standaardmaat 100 mm x 15 mm steriele Petri-schotels door gemengde agarmedia in de Petri-schalen te gieten. Plated media kunnen voor maximaal 6 maanden in plastic verpakt worden, met deksel omhoog bij 4 ° C.
  7. Melk-agarplaten
    1. Voor component 1 (melk): weeg 8,0 g onverzadigde droge melk in een 1 L Erlenmeyer-fles, stel het volume aan op 200 ml met gedeïoniseerd water en autoclaaf.
    2. Voor Component 2 (agar met hart-hart infusie): weeg 3,68 g hart-hart infusie en 6,0 g agar. Combineer de conStituenten in een 500 ml Erlenmeyer-fles, instel volume aan 200 ml met gedeïoniseerd water en autoclaaf.
    3. Combineer de twee componenten door Component 2 in component 1 te gieten, na autoclaving en grondig te mengen. Bereid u voor in 150 mm x 15 mm steriele Petrischalen. Melkplaten kunnen voor maximaal een week worden opgeslagen in plastic, dekselzijde omlaag bij 4 ° C. Bereid in 150 mm x 15 mm steriele Petrischalen door giet gemengd agar media in de petrischalen.
  8. Motiliteitsagarplaten
    1. Voor component 1 (LB agar): weeg 5,0 g trypton, 2,5 g gist extract, 2,5 g NaCl en 2,0 g agar. Combineer de bestanddelen in een 1 L Erlenmeyer-fles, stel het volume in op 500 ml met gedeïoniseerd water en autoclaaf.
    2. Voor component 2 (1% (w / v) trifenyltetrazoliumchloride; TTC): weeg 0,25 g TTC. Verstel volume tot 25 ml met gedeïoniseerd water in een steriele vesikel en filtersteriliseer met behulp van een 0,22 μm filter. Bewaar voor maximaal 6 maanden bij kamertemperatuur verpaktIn folie om de lichtblootstelling te minimaliseren.
    3. Voeg 2,5 ml 1% (w / v) steriele TTC toe aan autoclaafmedia.
    4. Giet de media zo dik mogelijk (≥50 ml / plaat) in grote 150 mm x 15 mm steriele Petri-schalen. Geplateerde media kunnen gedurende maximaal een week in plastic verpakt worden, met deksel omhoog bij 4 ° C. Bereid in 150 mm x 15 mm steriele Petrischalen door giet gemengd agar media in de petrischalen.
  9. Voges-Proskauer (VP)
    1. Voor component 1 (Methyl Red-Voges-Proskauer-bouillon; MR-VP): weeg 1,7 g MR-VP-medium in een 500 ml Erlenmeyer-fles, stel het volume aan op 100 ml met gedeïoniseerd water en autoclaaf. Steriele MR-VP bouillon kan maximaal 6 maanden bij kamertemperatuur worden opgeslagen.
    2. Voor component 2 (5% (w / v) alfa (α) naftol): weeg 1,0 g a-naftol in een steriele vesikel en stel het volume aan op 20 ml met 95% ethanol. Α-naftol kan bij kamertemperatuur worden opgeslagen gedurende maximaal 1 week verpakt in folie om lichtverlies te minimaliserenComposure.
    3. Voor component 3 (40% (w / v) kaliumhydroxide; KOH): weeg 20,0 g KOH in een steriele vesikel, stel het volume in op 50 ml met steriel gedeïoniseerd water. KOH kan voor maximaal 6 maanden bij kamertemperatuur in een plastic vat worden opgeslagen.

2. Onderhoud en groei van V. Cholerae stammen

  1. Voorbereiding en gebruik van bevroren voorraadculturen
    1. Pellet 1,8 ml vloeibare nachtkweek gedurende 2 minuten door centrifugeren (≥8.600 xg) in een steriele 2 ml microcentrifugebuis, verwijder supernatant en verwijder de celpellet opnieuw in 900 μL verse LB-bouillon door pipettering.
    2. Voeg 900 μL steriele 60% (v / v) glycerol aan de kweek toe en meng door vortexing.
    3. Breng het mengsel over op een steriele 2 ml cryogene buis en houd onbepaald bij -80 ° C.
    4. Om te gebruiken, verwijder een kleine hoeveelheid bevroren voorraad met een steriele inoculatielus en streep voor enkele kolonies op LB agAr borden. Onmiddellijk teruggekomen bevroren voorraad tot -80 ° C na gebruik om te voorkomen dat culturen volledig ontdooien. Incubeer de dekselzijde van de platen gedurende 12 tot 16 uur bij 37 ° C.
  2. Groei van overnachtingsculturen in vloeibaar medium
    1. Streak voor enkele kolonies (volgens punt 2.1.4) van bevroren voorraad op LB agarplaten. Incubeer de dekselzijde van de platen gedurende 12 tot 16 uur bij 37 ° C.
    2. Inoculeer 4 ml vloeibare LB bouillon in een steriele 10 ml kweekbuis met een enkele kolonie door het oppervlak van de enkele kolonie aan te raken met een steriele applicatiestok en de kolonie over te brengen in de vloeibare bouillon.
    3. Incubeer met beluchting in een shaker incubator bij 225 rpm gedurende 12 tot 16 uur bij 37 ° C.
  3. Groeikromme
    1. Bereid de nachtcultuur in vloeibare LB bouillon zoals eerder vermeld in protocol 2.2.
    2. Maak een 1: 100 verdunning van de nachtcultuur door 250 μl van de overnightcultuur naar 2 over te brengen5 ml verse LB bouillon in een steriele 250 ml Erlenmeyer fles.
    3. Meet de optische dichtheid van de vloeibare culturen bij 600 nm (OD 600 ) elk uur dat begint op het moment van inenting (T 0 ).
    4. Incubeer een 1: 100 verdunning van de nachtcultuur met beluchting in een shaker incubator bij 225 rpm gedurende maximaal 30 uur bij 37 ° C of totdat de kweek de maximale dichtheid bereikt.
    5. Graf de OD 600 vs. Time en gebruik lineaire regressie om de geschatte verdubbelingstijd voor elke stam te bepalen.
  4. El Tor Biotype Virulence Inducerende Voorwaarden
    1. Streak voor enkele kolonies van bevroren voorraad op LB agarplaten. Incubeer de deksel van de platen omlaag, gedurende 12 tot 16 uur bij 37 ° C.
    2. Inoculeer 10 ml AKI-medium dat 0,03% (w / v) NaHC03 bevat met een enkele kolonie.
    3. Incubeer cultuur zonder beluchting bij 37 ° C gedurende 3,5 uur.
    4. Verwijder 7 ml kweek en incubeer de resterende 3 ml cultuRe met beluchting in een shaker incubator bij 225 rpm gedurende nog eens 4 uur.
  5. Klassieke Biotype Virulentie Inducerende Voorwaarden
    1. Streak voor enkele kolonies van bevroren voorraad op LB agarplaten. Incubeer de dekselzijde van de platen gedurende 12 tot 16 uur bij 37 ° C.
    2. Inoculeer 4 ml vloeibare LB-bouillon (pH 6,5) met een enkele kolonie.
    3. Incubeer met beluchting in een shaker incubator bij 225 rpm gedurende 12 tot 16 uur bij 30 ° C.
  6. Was Cell Pellet in 1x PBS
    1. Pellet 1,8 ml nachtcultuur gedurende 2 minuten door centrifugeren (≥8 600 xg) in een steriele 2 ml microcentrifugebuis en verwijder het supernatant met behulp van een pipet. Celcellen opnieuw opschorten in 1,8 ml 1x PBS door pipettering.
    2. Herhaal de wasprocedure drie keer, gevolgd door een laatste resuspensie in 1,8 ml 1x PBS.

3. Karakterisering V. Cholerae biotypes

  1. PCR- gebaseerde genetische schermen met behulp van ctxB en tcpA
    1. Ontwerp een set primers, die ongeveer 50-70 bp stroomopwaarts en stroomafwaarts van de translatoire start- en stopplaatsen van respectievelijk ctxB en tcpA ontleden.
    2. Bereid de nachtcultuur in vloeibare LB bouillon zoals eerder vermeld in protocol 2.2.
    3. Chromosomaal DNA isoleren met behulp van een in de handel verkrijgbare kit die is ontworpen voor gram-negatieve bacteriën. Gezuiverd chromosomaal DNA kan onbepaald worden opgeslagen bij -20 ° C. Chromosomale DNA-isolatie onder gebruik van commercieel verkrijgbare kits duurt ongeveer 4 uur.
    4. Gebruik een microvolume spectrofotometer om ervoor te zorgen dat het chromosomale DNA-monster van hoge kwaliteit is (A 260/280 > 1.8).
    5. Voor elk chromosomaal DNA-isolaat bereidt u de polymerase kettingreactie (s) (PCR) op ijs in een steriele 200 μL PCR-buis (en) en amplificeer gebieden van ctxB en tcpA onder gebruikmaking van standaard PCR componenten: Taq polymerase en buFfer (of equivalenten), dNTP-oplossing en forward / reverse primers. Gebruik standaard PCR parameters (~ 3 uur). Gebruik bijvoorbeeld het volgende protocol:
      1. Aanvankelijke denaturatie bij 95 ° C gedurende 120 s.
      2. Denatureren bij 95 ° C gedurende 60 s.
      3. Anneal primers bij 60 ° C gedurende 45 s.
      4. Verleng bij 90 ° C bij 72 ° C.
      5. Herhaal stappen 3.1.5.2 tot en met 3.1.5.4 voor 34 cycli.
      6. Definitieve verlenging 72 ° C voor 600 s.
      7. Oneindig vasthouden bij 4 ° C.
    6. Verf 5 μL respectievelijk PCR-product (en) met behulp van een standaard 6x DNA geladige kleurstof, en laad ongeveer 10 μl 1 kb ladder en 10 μl PCR product op een 1% agarosegel in 1x Tris-Borate-EDTA (TBE) buffer.
    7. Loop gelelektroforese bij 130 V tot de kleurstof voor het einde bereikt, maar niet af, van de gel (ongeveer 90 minuten). Constante bewaking wordt aanbevolen, aangezien de spanning en de lopende tijden kunnen variëren afhankelijk van de apparatuur.
    8. Bij verificatie vanSuccesvolle PCR amplificatie met de verwachte grootte, zuiver het resterende 45 μl PCR product (en) met gebruik van een in de handel verkrijgbare DNA clean & concentrator kit.
    9. Sequentie schoongemaakt PCR product (en) met dezelfde primers gebruikt voor PCR amplificatie, en bereiden volgens lokale richtlijnen voor sequencing.
    10. Vergelijk het FASTA formaat van gensequenties van elk isolaat naar de gepubliceerde sequentie die beschikbaar is op de NCBI website (http://www.ncbi.nlm.nih.gov/gene/) door de volgende toetredingsnummers in het zoekvak te zoeken.
    11. CtxB : (klassiek) gebied tussen VC0395_A1059 naar VC0395_A1060 (El Tor) VC_1456
    12. TcpA : (klassiek) VC0395_A0353 (El Tor) VC_0828
  2. Fenotypische analyses voor biotype classificatie via spotting
    1. Bereid de nachtcultuur in vloeibare LB bouillon zoals eerder vermeld in protocol 2.2.
    2. Was de celpelletjes (s) zoals gespecificeerd in protocol 2.6.
    3. Gebruik een pipet naarPlaats 1 μl gewassen kweek op respectievelijk medium. Voor medium selectie en incubatie specificaties, zie tabel 2.
  3. Motiliteitsassay
    1. Bereid overnachtende cultuur (en) in vloeibare LB bouillon zoals eerder vermeld in protocol 2.2.
    2. Was de celpelletjes (s) zoals gespecificeerd in protocol 2.6.
    3. Inoculate motiliteitsagarplaten door inoculeren van steek in de gewassen vloeibare kweek te plaatsen en "verticaal" in de media te steken. Tussendoor elke inoculatie, steriliseer de draadstok met behulp van een Bunsen-brander, en als u de agar steekt, moet u ervoor zorgen dat de inoculerende steek niet buigt, omdat dit de resultaten kan veranderen.
    4. Incubeer de deksels van de platen gedurende 14 tot 24 uur bij 37 ° C. Na 14 uur bewaken de motiliteitsplaten nauw om de groei van culturen te voorkomen.
  4. Voges-Proskauer (VP) Assay
    1. Bereid overnachtende cultuur (en) in vloeibare LB bouillon zoals eerder vermeld in protocol 2.2.
    2. Inoculeer 4Ml methyl rode Voges-Proskauer, of MR-VP bouillon, door 10 μl van voorheen bereide nachtelijke cultuur te pipetten in 4 ml MR-VP bouillon in een steriele kweekbuis en incuberen met beluchting in een shaker incubator bij 225 rpm gedurende 12 tot 16 H bij 37 ° C.
    3. Voeg 150 μl 5% (w / v) a-naftol en 50 μl 40% (w / v) KOH toe aan 1 ml alikvoten MR-VP overnight cultuur in respectievelijk steriele cultuurbuizen.
    4. Kortom draaikolk en laat gedurende 4 uur op kamertemperatuur staan ​​tot de kleurverandering zich ontwikkelt.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Voor goed onderhoud en gebruik van bacteriestammen, wordt het aanbevolen de verdubbelingstijd van de betrokken stam (en) te kennen. Hierin worden de wisselende groeitempo's van veelgebruikte V. Choleraestammen werden aangetoond door middel van een groeicurve en de benaderende verdubbelingstijden werden berekend aan de hand van lineaire regressie. WT El Tor N16961 en El Tor variant MQ1795 vertoonden kortere verdubbelingstijden (~ 1 uur en ~ 1 uur respectievelijk) dan WT klassieke O395 (~ 2 uur) ( Figuur 1 , Tabel 2 ).

De genetische manipulatie van V. cholerae en de daaropvolgende analyse berusten vaak op het vermogen om goed te onderscheiden tussen biotypen. PCR-gebaseerde genetische schermen en fenotypische analyses werden collectief geïmplementeerd als een betrouwbaar systeem voor het onderscheiden van biotype achtergronden van V. Cholerae klinisch en milieu isolates; Voor representatie, biotype referentiestammen (WT klassieke O395, WT El Tor C6706 en WT El Tor N16961) en representatieve El Tor varianten (MQ1795 en BAA-2163) werden opgenomen ( Tabel 1 ). WT klassieke O395 demonstreerde klassieke ctxB en tcpA sequenties. Omgekeerd vertoonden de WT El Tor stammen N16961 en C6706 El Tor ctxB en tcpA sequenties. Interessant genoeg bevatte MQ1795 en BAA-2163 de klassieke biotype ctxB subeenheid vergelijkbaar met O395, maar beide El Tor varianten bevatte de tcpA die indicatief was voor de El Tor biotype achtergrond ( Tabel 1 ). WT klassieke biotype stam O395 vertoonde gevoeligheid voor polymyxine B, terwijl WT El Tor biotype stammen (C6706 en N16961) resistentie vertoonde en op LB agarplaten aangetoond werden die met polymyxine B werden aangevuld. De representatieve El Tor variantiestammen (MQ1795 en BAA-2163) aangetoond Soortgelijke weerstand tegen het antibioticum ten opzichte van de WT El Tor biotype straIns (C6706 en N16961) ( Figuur 2 ; Tabel 2 ). WT klassieke biotype stam O395 groeide niet op minimaal citraatmedium, terwijl WT El Tor stammen (C6706 en N16961) citraat konden gebruiken als koolstofbron en groeien op minimaal citraatmedium. Representatieve El Tor variant biotype stammen (MQ1795 en BAA-2163) aangetoond groei vergelijkbaar met die van de WT El Tor biotype stammen (C6706 en N16961) ( Figuur 3 , Tabel 2 ). WT klassieke stam O395 en WT El Tor stam N16961 beschikken over een niet-functionele HapR, en dus niet HapR-gereguleerde protease activiteit aan te tonen; WT El Tor stam C6706, en representatieve El Tor varianten (MQ1795 en BAA-2163) zijn hapR- positief-visualized als een zone van klaring die voortkomt uit het punt van inenting ( Figuur 4 , Tabel 2 ). WT klassieke stam O395 scheidt geen hemolytische enzymen en was daarvoorE-hemolytische, terwijl WT El Tor biotype stammen (C6706 en N16961) en representatieve El Tor variantstammen (MQ1795 en BAA-2163) hemolytische enzymen afscheiden die de rode bloedcellen helemaal lichten om het punt van inoculatie te omringen en β-hemolyse vertonen ( Figuur 5 ; tabel 2 ). Motiliteit varieert over en binnen, biotype stammen; Echter, WT El Tor stam N16961 en El Tor varianten (MQ1795 en BAA-2163) aangetoond hypermotiliteit in vergelijking met de relatief minder motiele WT klassieke stam O395 en WT El Tor stam C6706 ( Figuur 6 , Tabel 2 ). WT klassieke stam O395 en representatieve El Tor varianten metaboliseerden geen glucose om acetoïne te produceren, terwijl WT El Tor biotype stammen acetoïne produceerde als een bijproduct van glucosefermentatie, zoals aangegeven door de ontwikkeling van een dieprode kleur tijdens de Voges-Proskauer-analyse ( Figuur 7 , Tabel 2 ).

spanning CtxB gen TCPA Referentie
Basis 115 Basis 203 biotype biotype
O395 C C klassiek klassiek 8
C6706 T T El Tor El Tor 8
N16961 T T El Tor El Tor 8
MQ1795 C C klassiek El Tor 13
BAA-2163 C C klassiek El Tor 8

Tabel 1: Biotype afhankelijke genetische onderscheidingen van Vibrio cholerae referentiestammen. In deze tabel worden de DNA- basisveranderingen en relatieve posities in de genen ctxB en tcpA weergegeven . WT klassieke O395 en WT El Tor stammen N16961 en C6706 zijn veelgebruikte biotype referentiestammen. MQ1795 en BAA-2163 zijn El Tor-varianten bekend.

analyse Toepassing Medium Selectie Incubatie verwachte resultaten
O395 C6706 N16961 MQ1795 BAA-2163
2.3) Groeikromme 27 Bepaalt verdubbelingstijden van verschillende V. cholerae stammen 1.2) Vloeibare LB-bouillon Tot 30 uur (37 ° C met beluchting) ~ 2 uur ND * ~ 1 uur ~ 1 uur ND *
3.1) PCR-gebaseerd genetisch scherm met behulp van ctxB en tcpA 8 Onderscheid tussen klassieke en El Tor biotype achtergronden van ctxB N / A N / A klassiek El Tor El Tor klassiek klassiek
Onderscheid tussen klassieke en El Tor biotype achtergronden van tcpA N / A N / A klassiek El Tor El Tor El Tor El Tor
3.2) Polymyxin B Weerstand 21 Gevoeligheid voor het antibiotica polymyxine B 1,5) LB agarplaten aangevuld met polymyxine B 18 uur (37 ° C) - + + + +
3.2) Citraat Metabolisme 22 Vermogen om citraat te metaboliseren als enige koolstofbron 1,6) Minimale citraat medium agar platen 24 uur (37 ° C) - + + + +
3.2) Kaseïnehydrolyse 23 HapR-gereguleerde protease activiteit 1.7) Melk agarplaten 18 uur (37 ° C) - - + + +
3.2) hemolyse 23 Maatregelen hemolytische activiteit Bloed agar platen 48 uur (37 ° C) Gamma beta beta beta beta
3.3) Motiliteit 23 Maatregelen graad van beweeglijkheid 1.8) Motiliteitsagarplaten 14-24 uur (37 ° C) 10 mm 15 mm 21 mm 25 mm 29 mm
3.4) Voges-Proskauer 21 Maatregelen om glocose te fermenteren en acetoïne te produceren als bijproduct 1.9) Vloeistof Voges-Proskauer medium Tot 4 uur (kamertemperatuur) - + + - -
Opmerking: "ND *" betekent niet bepaald; "+" Wijst op een positief resultaat; "-" geeft een negatief resultaat aan

Tabel 2: Samenvatting van genetische en fenotypische assays gebruikt voor Vibrio cholerae Biotype onderscheid. Deze tabel geeft een samenvatting van de verschillende genetische en fenotypische analyses, toepassingen en verwachte resultaten die collectief gebruikt werden om te onderscheiden tussen klassieke en El Tor-biotypes die in deze studie werden gebruikt. Protocolnummers en verwijzingen naar specifieke protocollen worden aangegeven in de kolom Assay. "ND *" betekent niet bepaald; "+" Wijst op een positief resultaat; "-" geeft een negatief resultaat aan.

Figuur 1
Figuur 1: V. Cholerae groeikurwe van WT klassieke O395, WT El Tor N16961 en El Tor Variant MQ1795. Groeitempo's van biotype referentiestammen (WT klassieke O395 en WT El Tor N16961) en representatieve El Tor Variant MQ1795, gegroeid in LB bouillon met beluchting bij 37 ° C, werden geanalyseerd door het meten van de OD 600 eHeel uur vanaf T 0 . Groeikrommen werden uitgevoerd op 8 onafhankelijke experimentele replicaten, waarbij elke replicaat een onafhankelijk cultuurgebeurtenis voor elke proef vertegenwoordigt. WT El Tor-stam N16961 en El Tor variant MQ1795 aangetoond kortere verdubbelingstijden (~ 1 uur en ~ 1 uur respectievelijk) ten opzichte van WT klassieke stam O395 (~ 2 uur), zoals waargenomen door een langere verdubbelingstijd. Klik hier om een ​​grotere versie van deze figuur te bekijken.

Figuur 2
Figuur 2: Bepalen van resistentie tegen polymyxine B met behulp van LB-agar, aangevuld met polymyxine B. Weerstand tegen het peptide-antibiotica polymyxine B werd bepaald door het vermogen om te groeien op LB-agar aangevuld met 50 IE / μL polymyxine B. WT klassieke stam O395 liet geen groei zien op agar supplGemmenteerd met polymyxine B en werd beschouwd als gevoelig voor het antibioticum. Terwijl de WT El Tor stammen (C6706 en N16961) en representatieve El Tor varianten (MQ1795 en BAA-2163) groeien in aanwezigheid van het antibioticum en werden beschouwd als resistent tegen polymyxine B. Platen werden gedurende 18 uur bij 37 ° C geïncubeerd. Klik hier om een ​​grotere versie van deze figuur te bekijken.

Figuur 3
Figuur 3: Meten van Citraat Metabolisme Met Minimal Citraat Media. Het vermogen om citraat te gebruiken als enige koolstofbron, werd bepaald door het vermogen van het isolaat om te groeien op minimaal citraatmedium. WT klassieke stam O395 groeide niet op minimaal citraat media (negatief). De groei was duidelijk door alle WT El Tor stammen (C6706 en N16961) en representatieve ElTor varianten (MQ1795 en BAA-2163), die aantonen dat het mogelijk is citraat te gebruiken als enige koolstofbron (positief). Platen werden gedurende 18 uur bij 37 ° C geïncubeerd. Klik hier om een ​​grotere versie van deze figuur te bekijken.

Figuur 4
Figuur 4: Meten van HapR-gereguleerde Proteolytische Caseïne Hydrolyse Met Milk Agar Media. Caseïnehydrolyse door HapR-gereguleerde protease-activiteit werd bepaald door een visuele zone van klaring die het punt van inenting op melkagar omgaat. Stammen die een niet-functionele HapR bevatten, zoals WT klassieke stam O395 en WT El Tor stam N16961, produceerden geen zone van klaring die het punt van inenting ( hapR- negatief) omringde . WT El Tor stam C6706 en representatieve El Tor varianten (MQ1795 en BAA-2163) bevatten een functioneel HapR, dat kan worden weergegeven als variërende afmetingszones ( hapR- positief). Platen werden gedurende 18 uur bij 37 ° C geïncubeerd. Klik hier om een ​​grotere versie van deze figuur te bekijken.

Figuur 5
Figuur 5: Meten van hemolytische activiteit met behulp van Blood Agar Media. Hemolytische activiteit werd gemeten met behulp van agarplaten aangevuld met schapenbloed. WT klassieke stam O395 scheidt geen enzymen die rode bloedcellen lichten (y-hemolytische). WT El Tor stammen (N16961 en C6706) en representatieve El Tor varianten (MQ1795 en BAA-2163) scheiden hemolytische enzymen, wat resulteerde in een doorschijnende zone van klaring die het punt van inenting (β-hemolytische) omringde. Platen werden bij 37 geïncubeerd° C gedurende 48 uur. Klik hier om een ​​grotere versie van deze figuur te bekijken.

Figuur 6
Figuur 6: Bepalen van de motiliteit met behulp van motiliteitsagarplaten. De zone van motiliteit werd aangegeven door een visuele kleurverandering van de zout TTC die van helder naar rood verandert wanneer gemetaboliseerd, wat aangeeft waar de bacteriën zijn verplaatst. WT klassieke stam O395 (10 mm) en WT El Tor stam C6706 (15 mm) bleek minimale motiliteit, terwijl El Tor stam N16961 (21 mm) en representatieve El Tor varianten (MQ1795 (25 mm) en BAA-2163 (29 mm) ) Bleek hypermotiliteit ten opzichte van O395 en C6706. Platen werden gedurende 18 uur bij 37 ° C geïncubeerd. Klik opHier om een ​​grotere versie van deze figuur te bekijken.

Figuur 7
Figuur 7: Voges-Proskauer Assay. Acetoïne productie via glucose fermentatie werd bepaald met behulp van de Voges-Proskauer assay. WT klassieke stam O395 en representatieve El Tor varianten (MQ1795 en BAA-2163) produceerden geen acetoïne als gevolg van glucosefermentatie (negatief). WT El Tor stammen (N16961 en C6706) produceerden de bijproduct acetoïne en kunnen worden weergegeven door een dieprode kleurverandering (positief). Buizen werden gedurende 4 uur bij kamertemperatuur geïncubeerd. Klik hier om een ​​grotere versie van deze figuur te bekijken.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Van de meer dan 200 geïdentificeerde V. Cholerae serogroepen, alleen O1 en O139 hebben epidemische mogelijkheden. De O1 serogroep kan worden verdeeld in twee biotypes: klassiek en El Tor. Echter, hybride stammen, genaamd El Tor varianten 13 , 17 , zijn opgetreden die de El Tor biotype achtergrond bezitten en klassieke kenmerken 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 bezitten. De in dit manuscript beschreven protocollen zijn ontworpen om onderzoekers te geven die geïnteresseerd zijn in het karakteriseren en / of onderscheiden van verschillende klinische en niet-klinische isolaten van V. cholerae , met een betrouwbareMulti-assay identificatie systeem. Het gebruik van een betrouwbaar multi-assay identificatiesysteem als alternatief is een verbetering ten opzichte van eerder ingestelde identificatie systemen voor enkelvoudige test en arbeidsintensieve genetische schermen. Alle genotypische en fenotypische analyses moeten WT klassieke stam O395 en WT El Tor stammen C6706 en N16961 bevatten voor vergelijking ( Tabel 1 ). Terwijl de klassieke en El Tor biotype stammen als referentie worden opgenomen, kunnen isolaten, zoals MQ1795 en BAA-2163 in onze studies, fenotypische profielen van beide biotypen weergeven ( Figuur 2 , Figuur 3 , Figuur 4 , Figuur 5 , Figuur 6 , Figuur 7 ; Tabel 2 ), die de behoefte aan analyse illustreert van meerdere genotypische en fenotypische eigenschappen voor betrouwbare karakterisering. Alle protocollen dienen aseptisch te worden uitgevoerdLy 26 bij kamertemperatuur, tenzij anders vermeld. V. Cholerae is een pathogeen voor bioveiligheidsniveau 2 (BSL-2) die het etiologische middel is van de potentieel fatale maagdarmziekte cholera; Goede afhandeling en verwijdering van alle materialen en afvalstoffen moet worden afgedwongen per institutionele, plaatselijke, staats- en federale regelgeving.

Voorbereiding van alle media en reagentia moet worden uitgevoerd met behulp van analytische grade reagentia en ultrapure water gedeioniseerd tot een minimale gevoeligheid van 18 MΩ-cm. Voorafgaand aan de verwerking moet de media worden bereid en voldoende droog laten (1-2 dagen); Platen worden beschouwd als voldoende droog wanneer er geen residuele vloeistof aanwezig is op het oppervlak van de agar. Vanwege het beweeglijke bereik en de zones van de klaring die bacteriële groei omringen, moeten motiliteit en melkplaten worden bereid in grote Petrischalen (150 mm x 15 mm) tot 50 ml per plaat en kunnen worden opgeslagen voor maximaal 1 week verpakt in plastic , LiD-zijde omlaag bij 4 ºC. Bovendien kan de agarconcentratie van de motiliteitsplaten worden aangepast om de beweeglijkheid te vertragen; Het wordt echter niet aangeraden om 3 g agar per 500 ml oplossing te overschrijden, omdat dit de totale motiliteit aanzienlijk zal verminderen, zodat verschillen niet waarneembaar zijn. Alle andere plaatmedia moeten bereid worden tot ongeveer 25 ml per plaat in standaard Petri-afwasbakken (100 mm x 15 mm) en kunnen voor maximaal zes maanden worden opgeslagen in plastic, dekselzijde omlaag bij 4 ºC. Voor het bereiden van polymyxine B-platen is het belangrijk om na het autoclaven afgekoelde gesmolten media af te koelen alvorens polymyxine B toe te voegen, aangezien overmatige hitte antibiotica kan afbellen. Polymyxin B-platen kunnen tot 3 maanden worden opgeslagen in plastic, dekselzijde omlaag bij 4 ºC. Analyses die in dit manuscript zijn besproken, vereisen een dag voor eenmalige koloniegroei (12-16 uur), een extra dag voor de groei van nachtelijke culturen (12-16 uur) en een derde dag voor overwegingen van genotypische (~ 4 uur voor chromosomale DNEen isolatie en ~ 3 uur voor PCR) of fenotypische analyses (18-48 uur, Tabel 2 ). Voorafgaand aan de biochemische analyse van fenotypische analyses beschreven in dit manuscript, moeten culturen worden gewassen in 1x PBS om te voorkomen dat overblijvende kweekmedia overdracht van scheefresultaten wordt. Bovendien kunnen polymyxine B-, citraat-, protease-activiteit-, hemolyse- en motiliteitsbepalingen gelijktijdig geënt worden met een enkele gewassen nachtelijke kweek. Bij het spotten van geplateerde media kan splatter van culturen optreden en kan het leiden tot kruisbesmetting tussen stammen. Om splatter te vermijden, vermijd de kip volledig uit de pipet, maar stop de cultuur bij de eerste stop van de pipet. Daarnaast laten vlekken volledig in het agaroppervlak vóór de incubatie absorberen, en zorg ervoor dat de agar niet wordt gebogen, wat de resultaten kan beïnvloeden. Fenotypische analyses resulterend in zones van vrijwaring ( Figuur 4 ; Figuur 5 ; Tabel 2) En / of beweeglijkheid ( Figuur 6 , Tabel 2 ) die het punt van inoculatie omringen, dient maximaal op afstand te zijn om te voorkomen dat er sprake is van splitsingsruimten of groei, waarop de respectievelijke diameters kunnen worden gemeten voor vergelijkende analyse. Na aangegeven incubatietijden kunnen isolaten worden afgebeeld en geanalyseerd ten opzichte van de biotype referentiestammen (WT klassieke O395, WT El Tor C6706 en WT El Tor N16961).

De door PCR gebaseerde genetische schermen door sequentiebepaling in dit manuscript kunnen worden gebruikt om de biotype achtergrond van het isolaat te identificeren met betrekking tot ctxB en tcpA , na initiële PCR amplificatie. Standaard-sequentierichtlijnen vereisen een specifieke hoeveelheid PCR-product, afhankelijk van de grootte van het versterkte gebied (580 bp voor ctxB en 1420 bp voor tcpA ) en voor het opstellen van de reacties kunnen vastgestelde protocollen worden gevolgd. Kortom, individuele voorwaartse en rEverse sequencing reacties moeten worden bereid met 3-5 pmol primer / reactie, en het volume moet worden aangepast aan 20 μl met steriel ultrauw water in een 1,5 ml microcentrifuge buis. Voor hulp in primerontwerp voor zowel PCR amplificatie als sequentiebepaling, kan het NCBI primer design tool http://www.ncbi.nlm.nih.gov/tools/primer-blast/ worden gebruikt. Succesvolle amplificatie en sequentiebepaling van ctxB en tcpA is bereikt onder gebruikmaking van de volgende primers (5 '→ 3'): ctxB- voorwaartse GGGAATGCTCCAAGATCATCGATGAGTAATAC, ctxB- reverse CATCATCGAACCACAAAAAAGCTTACTGAGG, tcpA- voorwaartse CCGCACCAGATCCACGTAGGTGGG, tcpA- reverse GTCGGTACATCACCTGCTGTGGGGGCAG. Opgemerkt moet worden dat het gehele coderende gebied van ctxB wordt bewaard over beide biotypen, behalve voor basisposities 115 en 203 (zowel cytosine in klassiek als thymine in El Tor). Bovendien, in tcpA , worden meerdere basisveranderingen behouden onder de biotypen die dIffer over de twee biotypen ( tabel 1 ), die kan worden gebruikt om onderscheid te maken tussen biotypes.

In veel laboratoriumstudies waarbij het model organisme V. Cholerae, goede onderhouds- en cultuurtechnieken zijn kritisch 27 . De groeitempo's van veelgebruikte V. Cholerae biotype referentiestammen, zoals WT klassieke stam O395 en WT El Tor stam N16961, kan nuttig inzicht verschaffen in de karakterisering van El Tor variant isolaten ( Figuur 1 , Tabel 2 ). Door de wisselende groeipercentages over V. Cholerae-isolaten, is het belangrijk om elke uur de spectrofotometer absorptie-aflezingen te nemen tot de culturen tijdens de late stationaire fase maximale troebelheid bereiken. Mid-to-late doodsfase kan niet worden geconfronteerd door een plateau in de troebelheid die voortvloeit uit overmatig cellulair afval. Een verdunning van 1: 4 van de cultuur naar steriel L B bouillon moet worden uitgevoerd om een ​​volledige groeicurve te verkrijgen en de precisie van het instrument te handhaven, aangezien de absorptiewaarden piek bij een OD 600 ≈ 1.0 bedragen. Bij het uitvoeren van groeikurven op meerdere stammen moeten de afleesingen van de absorptie ongeveer 5 minuten apart voor elke stam worden getimd om de consistentie tussen de waarden te waarborgen. Begrip V. Cholerae biotype groeitempo's zijn cruciaal voor vele onderzoeken, waaronder virulentie genuitdrukkingsstudies, analyse van metabolische activiteiten en goede cultuur- en opslagomstandigheden. Voor de volgende analyse moeten overnachtende culturen worden verwerkt in het late logboek tot de vroege stationaire fase van de groei (12-16 uur) om de celgroei te maximaliseren, maar behoudt de cellulaire integriteit.

Kweekvoorwaarden voor klassieke en El Tor biotype stammen zijn vergelijkbaar, echter, analyse van virulentie gen expressie in V. Cholerae vereist biotype-specifieke virulentie-inducerende omstandighedenRef "> 19. De twee belangrijkste virulentiefactoren CT en TCP worden gecontroleerd door de master regulator ToxT, en worden optimaal uitgedrukt onder specifieke groeicondities, bijvoorbeeld onder El Tor virulentie inducerende omstandigheden ToxT kan worden geanalyseerd door het verwerken van gehele cel extract WCE), of de celpelletje, op 3,5 uur, terwijl CT- en TCP-expressie kan worden geanalyseerd door de celvrije supernatant en WCE na 7,5 uur respectievelijk 8 , 20 te verwerken. De verschillende genotypische en fenotypische eigenschappen die door dit manuscript worden aangetoond, geven aan hoe Diverse V. Cholerae biotypen kunnen zijn en illustreren de noodzaak van een alternatief voor eerder gebruikte single-assay biotype karakterisering.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs hebben niets te onthullen.

Acknowledgements

Onderzoek ondersteund door New Hampshire-INBRE via een Institutions Development Award (IDeA), P20GM103506, van het Nationaal Instituut voor Algemene Medische Wetenschappen van de NIH.

Materials

Name Company Catalog Number Comments
1 kb DNA Ladder New England Biolabs N3232S https://www.neb.com/products/n3232-1-kb-dna-ladder
60% Glycerol Calbiochem 356352 http://www.emdmillipore.com/US/en/product/Glycerol%2C-Molecular-Biology-Grade---CAS-56-81-5---Calbiochem,EMD_BIO-356352
Agar Becto, Dickinson and Co. 214030 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=214030&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D214030%26typeOfSearch%3DproductSearch
Agar with brain-heart infusion Becto, Dickinson and Co. 237500 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=237500&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D237500%26typeOfSearch%3DproductSearch
Agarose Peqlab 732-2789 https://de.vwr.com/store/catalog/product.jsp?catalog_number=732-2789&_DARGS=/store/cms/de.vwr.com/de_DE/header_2016111711383215.jsp_AF&_dynSessConf=1766917479792147141&targetURL=/store/catalog/product.jsp%3Fcatalog_number%3D732-2789&lastLanguage=en&/vwr/userprofiling/EditPersonalInfoFormHandler.updateLocale=&_D%3AcurrentLanguage=+&currentLanguage=en&_D%3AlastLanguage=+&_D%3A/vwr/userprofiling/EditPersonalInfoFormHandler.updateLocale=+
Anhydrous K2HPO4 Fisher Scientific P288-500 https://www.fishersci.com/shop/products/potassium-phosphate-dibasic-anhydrous-crystalline-powder-certified-acs-fisher-chemical-5/p288500?searchHijack=true&searchTerm=P288500&searchType=RAPID
Blood Agar Plates Remel R01200 Store at 4 °C;  http://www.remel.com/Catalog/Item.aspx?name=Blood+Agar
Boric Acid Fisher Scientific A73-500 https://www.fishersci.com/shop/products/boric-acid-crystalline-certified-acs-fisher-chemical-6/a73500?searchHijack=true&searchTerm=A73500&searchType=RAPID
Bromothymol Blue Fisher Scientific B388-10 https://www.fishersci.com/shop/products/bromothymol-blue-certified-acs-fisher-chemical/b38810?searchHijack=true&searchTerm=B38810&searchType=RAPID
Cirtric acid ·H2O Fisher Scientific S72836-3 https://www.fishersci.com/shop/products/citric-acid-monohydrate-4/s728363#?keyword=s728363
Deoxynucleotide (dNTP) Solution Kit New England Biolabs N0446S Store at -20 °C;  https://www.neb.com/products/n0446-deoxynucleotide-solutionset
Disodium EDTA Fisher Scientific S311-500 https://www.fishersci.com/shop/products/ethylenediaminetetraacetic-acid-disodium-salt-dihydrate-crystalline-certified-acs-fisher-chemical-7/s311500?searchHijack=true&searchTerm=S311500&searchType=RAPID
DNA Clean & Concentrator™ -25 Kit Zymo Research D4007 http://www.zymoresearch.com/dna/dna-clean-up/zymoclean-gel-dna-recovery-kit
GelGreen Nucleic Acid Stain Biotium 41005 https://biotium.com/product/gelgreentm-nucleic-acid-gel-stain-10,000x-in-water/
Genesys 10SUV-VIS Spectrophotometer Thermo Scientific 840-208100 https://www.thermofisher.com/order/catalog/product/840-208100?ICID=search-840-208100
Gentra Puregene Yeast/Bact. Kit Qiagen 158567 https://www.qiagen.com/us/shop/sample-technologies/dna/dna-preparation/gentra-puregene-yeastbact-kit/#orderinginformation
HCl Fisher Scientific A144-212 Corrosive;  https://www.fishersci.com/shop/products/hydrochloric-acid-certified-acs-plus-fisher-chemical-10/a144212?searchHijack=true&searchTerm=A144212&searchType=RAPID
KCl Fisher Scientific P217-500 https://www.fishersci.com/shop/products/potassium-chloride-crystalline-certified-acs-fisher-chemical-4/p217500?searchHijack=true&searchTerm=P217500&searchType=RAPID
KH2PO4 Fisher Scientific P285-500 https://www.fishersci.com/shop/products/potassium-phosphate-monobasic-crystalline-certified-acs-fisher-chemical-5/p285500?searchHijack=true&searchTerm=P285500&searchType=RAPID
KOH Fisher Scientific P250-500 https://www.fishersci.com/shop/products/potassium-hydroxide-pellets-certified-acs-fisher-chemical-5/p250500?searchHijack=true&searchTerm=P250500&searchType=RAPID
Le Loop Decon Labs Inc. MP190-25 http://deconlabs.com/products/leloop/
Le Stab Decon Labs Inc. MP186-5 http://deconlabs.com/products/lestab/
MgSO4·7H2O Fisher Scientific M63-500 https://www.fishersci.com/shop/products/magnesium-sulfate-heptahydrate-crystalline-certified-acs-fisher-chemical-3/m63500?searchHijack=true&searchTerm=M63500&searchType=RAPID
Mini-Sub Cell GT Horizontal Electrophoresis System Bio Rad Labs 1704406 http://www.bio-rad.com/en-us/product/mini-sub-cell-gt-cell?WT.srch=1&WT.mc_id=aw-cbb-NA-sub_cell_systems_brand_gold&WT.knsh_id=7eb1981f-a011-42a3-aece-1236ff453373
MR-VP Broth Difco 216300 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=216300&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3Dmr-vp%2Bmedium%26typeOfSearch%3DproductSearch
Na2HPO4 Fisher Scientific S374-500 https://www.fishersci.com/shop/products/sodium-phosphate-dibasic-anhydrous-granular-powder-certified-acs-fisher-chemical-5/s374500?searchHijack=true&searchTerm=S374500&searchType=RAPID
NaCl Fisher Scientific S271-10 https://www.fishersci.com/shop/products/sodium-chloride-crystalline-certified-acs-fisher-chemical-6/s27110?searchHijack=true&searchTerm=S27110&searchType=RAPID
NaHCO3 Fisher Scientific S233-500 https://www.fishersci.com/shop/products/sodium-bicarbonate-powder-certified-acs-fisher-chemical-5/s233500?searchHijack=true&searchTerm=S233500&searchType=RAPID
NaNH4HPO4·4H2O Fisher Scientific S218-500 https://www.fishersci.com/shop/products/sodium-ammonium-phosphate-tetrahydrate-crystalline-certified-fisher-chemical/s218500?searchHijack=true&searchTerm=S218500&searchType=RAPID
NanoDrop Lite Spectrophtometer Thermo Scientific ND-LITE-PR https://www.thermofisher.com/order/catalog/product/ND-LITE-PR?ICID=search-ND-LITE-PR
Nonfat dry milk Nestle Carnation N/A N/A
Peptone Becto, Dickinson and Co. 211677 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=211677&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D211677%26typeOfSearch%3DproductSearch
Petri Dishes (100 mm x 15 mm) Fisher Scientific FB0875712 https://www.fishersci.com/shop/products/fisherbrand-petri-dishes-clear-lid-12/fb0875712#?keyword=FB0875712
Petri Dishes (150 mm x 15 mm) Fisher Scientific FB0875714 https://www.fishersci.com/shop/products/fisherbrand-petri-dishes-clear-lid-12/fb0875714?searchHijack=true&searchTerm=FB0875714&searchType=RAPID
Polymyxin B sulfate salt Sigma-Aldrich P1004-10MU Store at 2-4 °C; http://www.sigmaaldrich.com/catalog/product/sial/p1004?lang=en&region=US
Taq DNA Polymerase New England Biolabs M0273S Store at -20 °C; https://www.neb.com/products/m0273-taq-dna-polymerase-with-standard-taq-buffer
Taq Reaction Buffer New England Biolabs M0273S Store at -20 °C;  https://www.neb.com/products/m0273-taq-dna-polymerase-with-standard-taq-buffer
Thermal Cycler Bio-Rad C1000 Touch™  Bio Rad Labs 1840148 http://www.bio-rad.com/evportal/evolutionPortal.portal?_nfpb=true&_pageLabel=search_page&sfMode=search&sfStartNumber=1&clearQR=true&js=1&searchString=1840148&database=productskus+productcategories+productdetails+abdProductDetails+msds+literatures+inserts+faqs+downloads+webpages+assays+genes+pathways+plates+promotions&tabName=DIVISIONNAME
Triphenyltetrazolium chloride Alfa Aesar A10870 https://www.alfa.com/en/catalog/A10870/
Tris Base Fisher Scientific BP152-1 https://www.fishersci.com/shop/products/tris-base-white-crystals-crystalline-powder-molecular-biology-fisher-bioreagents-7/bp1521?searchHijack=true&searchTerm=BP1521&searchType=RAPID
Tryptone Becto, Dickinson and Co. 211705 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=211705&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D211705%26typeOfSearch%3DproductSearch
Yeast Extract Becto, Dickinson and Co. 212750 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=212750&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D212750%26typeOfSearch%3DproductSearch
α-napthol MP Biomedicals 204189 http://www.mpbio.com/product.php?pid=05204189

DOWNLOAD MATERIALS LIST

References

  1. Shimada, T., et al. Extended serotyping scheme for Vibrio cholerae. Curr. Microbiol. 28, (3), 175-178 (1994).
  2. Yamai, S., Tadayuki, O., Toshio, S., Yasuji, K. Distribution of serogroups of Vibrio cholerae non-O1 non-O139 with specific reference to their ability to produce cholera toxin, and addition of novel serogroups. Jpn. J. Infect. Dis. 71, (10), 1037-1045 (1997).
  3. Karaolis, D. K., Lan, R., Reeves, P. R. The sixth and seventh cholera pandemics are due to independent clones separately derived from environmental, nontoxigenic, non-O1 Vibrio cholerae. J. Bacteriol. 177, (11), 3191-3198 (1995).
  4. Albert, M. J., et al. Large epidemic of cholera-like disease in Bangladesh caused by Vibrio cholerae O139 synonym Bengal. Lancet. 342, (8868), 387 (1993).
  5. Barua, D. History of Cholera. Cholera. Barua, D., Greenough III, W. B. Plenum Publishing Corporation. 1-36 (1992).
  6. Morales, R., Delgado, G., Cravioto, A. Population Genetics of Vibrio cholerae. Vibrio cholerae-Genomics and Molecular Biology. Faruque, S. M., Nair, G. B. Caister Academic Press. 29-47 (2008).
  7. Samadi, A. R., Chowdhury, M. K., Huq, M. K., Khan, M. U. Seasonality of classical and El Tor cholera in Dhaka, Bangladesh: 17-year trends. Trans. R. Soc. Trop. Med. Hyg. 77, (6), 853-856 (1983).
  8. Son, M. S., Megli, C. J., Kovacikova, G., Qadri, F., Taylor, R. K. Characterization of Vibrio cholerae O1 El Tor biotype variant clinical isolates from Bangladesh and Haiti, including a molecular genetic analysis of virulence genes. J. Clin. Microbiol. 49, (11), 3739-3749 (2011).
  9. Ghosh-Banerjee, J., et al. Cholera toxin production by the El Tor variant of Vibrio cholerae O1 compared to prototype El Tor and classical biotypes. J. Clin. Microbiol. 48, (11), 4283-4286 (2010).
  10. Ansaruzzaman, M., et al. The Mozambique cholera vaccine demonstration project coordination group. Cholera in Mozambique, variant of Vibrio cholerae. Emerg. Infect. Dis. 10, (11), 2057-2059 (2004).
  11. Ansaruzzaman, M., et al. Genetic diversity of El Tor strains of Vibrio cholerae O1 with hybrid traits isolated from Bangladesh and Mozambique. Int. J. Med. Microbiol. 297, (6), 443-449 (2007).
  12. Lan, R., Reeves, P. R. Pandemic spread of cholera: genetic diversity and relationships within the seventh pandemic clone of Vibrio cholerae determined by amplified fragment length polymorphism. J. Clin. Microbiol. 40, (1), 172-181 (2002).
  13. Nair, G. B., Faruque, S. M., Bhuiyan, N. A., Kamruzzaman, M., Siddique, A. K., Sack, D. A. New variants of Vibrio cholerae O1 biotype El Tor with attributes of the classical biotype from hospitalized patients with acute diarrhea in Bangladesh. J. Clin. Microbiol. 40, (9), 3296-3299 (2002).
  14. Nair, G. B., et al. Isolation of Vibrio cholerae O1 strains similar to pre-seventh pandemic El Tor strains during an outbreak of gastrointestinal disease in an island resort in Fiji. J. Med. Microbiol. 55, (11), 1559-1562 (2006).
  15. Nair, G. B., Mukhopadhyay, A. K., Safa, A., Takeda, Y. Emerging hybrid variants of Vibrio cholerae O1. Vibrio cholerae—Genomics and Molecular Biology. Faruque, S. M., Nair, G. B. Horizon Scientific Press. 179-190 (2008).
  16. Safa, A., et al. Genetic characteristics of Matlab variants of Vibrio cholerae O1 that are hybrids between classical and El Tor biotypes. J. Med. Microbiol. 55, (11), 1563-1569 (2006).
  17. Nusrin, S., et al. Diverse CTX phages among toxigenic Vibrio cholerae O1 and O139 strains isolated between 1994 and 2002 in an area where cholera is endemic. J. Clin. Microbiol. 42, (12), 5854-5856 (2004).
  18. Carignan, B. M., Brumfield, K. D., Son, M. S. Single nucleotide polymorphisms in regulator-encoding genes have an additive effect on virulence gene expression in a Vibrio cholerae clinical isolate. mSphere. 1, (5), e00253 (2016).
  19. Iwanaga, M., Yamamoto, K., Higa, N., Ichinose, Y., Nakasone, N., Tanabe, M. Culture conditions for stimulating cholera toxin production by Vibrio cholerae O1 El Tor. Microbiol. Immunol. 30, (11), 1075-1083 (1986).
  20. DiRita, V. J., Claude, P., Georg, J., Mekalanos, J. J. Regulatory cascade controls virulence in Vibrio cholerae. Proc. Natl. Acad. Sci. USA. 88, (12), 5403-5407 (1991).
  21. Kovacikova, G., Lin, W., Skorupski, K. Duel regulation of genes involved in acetoin biosynthesis and motility/biofilm formation by the virulence activator AphA and the acetate-responsive Lys-R type regulator AlsR in Vibrio cholerae. Mol. Microbiol. 57, (2), 420-433 (2005).
  22. Vogel, H. J., Bonner, D. M. Acetylornithinase of Escherechia coli: partial purification and some properties. J. Biol. Chem. 218, (1), 97-106 (1956).
  23. Son, M. S., Taylor, R. K. Genetic screens and biochemical assays to characterize Vibrio cholerae O1 biotypes: classical and El Tor. Curr. Protoc. Microbiol. 6A.2.1-6A.2.17 (2011).
  24. Kovacikova, G., Skorupski, K. Regulation of virulence gene expression in Vibrio cholerae by quorum sensing: HapR functions at the aphA promoter. Mol. Microbiol. 46, (4), 1135-1147 (2002).
  25. Wang, Y., et al. The prevalence of functional quorum-sensing systems in recently emerged Vibrio cholerae toxigenic strains. Environ. Microbiol. Rep. 3, (2), 218-222 (2011).
  26. Sanders, E. R. Aseptic laboratory techniques. J. Vis. Exp. (63), e3064 (2012).
  27. Martinez, R. M., Megli, C. J., Taylor, R. K. Growth and laboratory maintenance of Vibrio cholerae. Curr. Protoc. 6A.1.1-6A.1.6 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics