Techniques de laboratoire utilisées pour maintenir et différencier les biotypes de * These authors contributed equally

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Ce manuscrit décrit les bonnes techniques de maintenance de Vibrio cholerae en plus d'une série de tests biochimiques, utilisés collectivement pour une différenciation rapide et fiable entre V clinique et environnementale. Biotypes de cholérae en laboratoire.

Cite this Article

Copy Citation | Download Citations

Brumfield, K. D., Carignan, B. M., Ray, J. N., Jumpre, P. E., Son, M. S. Laboratory Techniques Used to Maintain and Differentiate Biotypes of Vibrio cholerae Clinical and Environmental Isolates. J. Vis. Exp. (123), e55760, doi:10.3791/55760 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

La bactérie aquale Gram négatif Vibrio cholerae est l'agent étiologique de la maladie gastro-intestinale infectieuse choléra. En raison de la prévalence et de la gravité mondiales de cette maladie, V. Cholerae a été largement étudié à la fois dans les environnements environnementaux et de laboratoire, nécessitant des techniques de maintenance et de culture appropriées. Classique et El Tor sont deux biotypes principaux qui composent le V. Le sérogroupe de cholerae O1, présentant chacun des caractéristiques génotypiques et phénotypiques uniques qui fournissent des mécanismes fiables pour la caractérisation du biotype et nécessitent des conditions de culture induisant une virulence distincte. Indépendamment du biotype de la souche causale pour une infection ou une flambée donnée, le traitement standard pour la maladie implique une thérapie de réhydratation complétée par un régime d'antibiotiques. Cependant, la classification des biotypes peut être nécessaire pour les études de laboratoire et peut avoir des impacts plus larges dans le domaine biomédical.Au début des années 2000, des isolats cliniques ont été identifiés et présentent des caractéristiques génotypiques et phénotypiques à la fois des biotypes classiques et El Tor. Les hybrides nouvellement identifiés, appelés les variantes El Tor, ont fait que l'identification des biotypes isolés cliniques et environnementaux devient plus complexe que les protocoles d'identification traditionnels précédents. En plus de décrire V. Cholerae, maintenance générale et techniques de culture, ce manuscrit décrit une série d'écrans génétiques et de tests phénotypiques spécifiques à la gène ( ctxB et tcpA ) (résistance au polymyxine B, métabolisme du citrate, activité protéolytique, activité hémolytique, motilité et métabolisme du glucose via Voges- Analyse Proskauer) utilisé collectivement pour caractériser et / ou distinguer les biotypes classiques et El Tor. Ensemble, ces tests fournissent une approche systématique efficace pour être utilisée comme alternative, ou en plus, à des expériences coûteuses et à forte intensité de main-d'œuvre dans la caractérisationTion de V. Isolats cliniques (et environnementaux) de cholerae .

Introduction

Le choléra est une maladie de l'intestin grêle distal causée par la consommation d'aliments contaminés ou d'eau contenant la bactérie Gram-négative Vibrio cholerae aquatique. Les symptômes du choléra incluent les vomissements et la diarrhée aqueuse incontrôlable, entraînant une déshydratation sévère qui, si elle n'est pas traitée correctement, entraînera la mort. V. Cholerae peut être divisé en plus de 200 sérogroupes basés sur la structure de l'antigène O de lipopolysaccharide de surface cellulaire. Cependant, seuls 2 sérogroupes, O1 et O139 ont montré un potentiel d'épidémie ou de pandémie 1 , 2 . En outre, le sérogroupe O139 a été principalement isolé dans le sud-est de l'Asie 3 , 4 , tandis que le sérogroupe O1 est distribué dans le monde entier. En outre, le sérogroupe O1 peut être divisé en 2 biotypes principaux: classique et El Tor. Le biotype classique était responsable de la première 6 pandémie de choléraS entre 1817 et 1923. La septième pandémie actuelle est le résultat du biotype El Tor, qui a déplacé globalement le biotype classique dans l'environnement 5 , 6 , 7 . Récemment, des souches ont eu des caractéristiques distinctives des biotypes classiques et El Tor 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 et ont été appelées variantes El Tor 13 , 17 . Certaines variantes d'El Tor ont démontré des capacités de virulence élevées avec une progression de la maladie plus rapide et plus sévère que celles observées précédemment, soulignantLa nécessité d'une approche plus complète de l'identification des agents et de la prévention et du traitement des maladies 8 , 9 , 18 . Bien que l'identification des biotypes ne dicte pas immédiatement le traitement, d'autres progrès dans le développement du vaccin et les futurs agents thérapeutiques peuvent bénéficier de la distinction du biotype.

La première série de protocoles répertoriés ici permettra aux enquêteurs de maintenir correctement V. Cholerae dans un milieu de laboratoire. La cohérence et l'analyse ultérieure nécessitent la préparation des stocks et la croissance des isolats, qui ne dépend pas du biotype. Cependant, pour induire de manière optimale l'expression du gène de la virulence, des techniques indépendantes de culture de biootype sont nécessaires 19 . En outre, la préparation de divers essais génétiques et biochimiques est présentée dans ce manuscrit.

La toxine du choléra (CT) et la toxine co-rePilus goudronné (TCP) sont deux principaux facteurs de virulence contrôlés par le régulateur principal ToxT dans les deux biotypes du V. Cholerae O1 serogroup 20 . CT est une toxine bipartite composée de cinq CtxB Sous-unités entourant une seule sous-unité CtxA, et est responsable de la perte rapide d'électrolyte associée au choléra. TCP est un pilus de type IV codé par l'opéron tcp ( tcpABQCRDSTEF ) et implique l'attachement et la colonisation de l'intestin grêle distal. TcpA est le premier gène de l'opéron tcp qui code les sous-unités individuelles de piline essentielles à la construction du pilus 8 . La séquence génétique pour ctxA est complètement conservée entre les biotypes classiques et El Tor, tandis que ctxB et tcpA diffèrent selon les deux biotypes mais sont conservés au sein de chaque biotype 8 . CtxB est complètement conservé entre les biotypes sauf à deux positions de baseTions (115 et 203). Dans le biotype El Tor, la thymine réside aux positions de base 115 et 203, tandis que le biotype classique contient de la cytosine à ces bases. TcpA est complètement conservé au sein de chaque biotype, mais diffère à plusieurs bases entre les biotypes. Ces distinctions génétiques servent de marqueurs d'identification de biotype primaires et, après séquençage du produit d'amplification de la réaction en chaîne par polymérase (PCR), y compris ces sites, les séquences isolées peuvent être comparées aux O395 ou WT El Tor N16961 de type sauvage (WT) pour déterminer l'arrière-plan du biotype De CT et TCP, respectivement, dans un isolât donné V. cholerae .

De nombreux protocoles ont été développés pour caractériser les distinctions phénotypiques entre les biotypes classiques et El Tor 21 , 22 , 23 . La polymyxine B est un antibiotique peptidique qui compromet l'intégrité de la membrane cellulaire externe dans un bac Gram négatifEt la résistance à la polymyxine B peuvent être visualisées à travers le test de résistance à la polymyxine B 21 . La citrate est un substrat primaire du cycle du Kreb et la capacité de métaboliser le citrate comme seule source de carbone peut être déterminée en utilisant le dosage du métabolisme citrate 22 . HapR code un régulateur global et le régulateur de détection de quorum maître dans V. cholerae, HapR, qui se lie à différentes régions de promoteur et régule l'expression de gène et d'opéron 24 . Certaines souches pathogènes de V. cholerae ont une mutation de changement de cadre naturelle dans le gène hapR qui a causé la perte de cette régulation dépendante de la densité de l'expression du gène de la virulence 24 , 25 . La mesure de l'activité de protease régulée par HapR en utilisant des milieux de gélose au lait permet au chercheur d'identifier si un isolât particulier contient un HapR 23 fonctionnel. leTests de dosage de l'hémolyse pour la capacité d'une souche à sécréter des enzymes hémolytiques qui lyse les globules rouges; Le degré d'hémolyse peut être visualisé sur les plaques d'agar sanguin 23 . La motilité est souvent associée à la virulence chez V. cholerae et peut être analysée à l'aide de plaques d'agarine de motilité 23 . Le test Voges-Proskauer teste la capacité d'une souche à fermenter le glucose en tant que seule source de carbone et produit le sous-produit acétoïne 21 . Avec l'émergence de variantes d'El Tor, il est difficile de prédire les résultats d'un dosage phénotypique donné sans dépistage génotypique étendu et avant de déduire le fond de biotype de V. Cholerae, il est recommandé d'effectuer cet assemblage des dosages 23 et de comparer les résultats aux souches de référence comme dans le tableau 2 .

Dans ce cas, nous avons avancé une série de protocoles, en utilisant collectivement ce qui précèdeDes tests génotypiques et phénotypiques pour une approche plus globale pour caractériser V. Biotypes de choléra. De plus, nous avons décrit les distinctions génotypiques et phénotypiques des V connus. Cholerae El Tor variantes (MQ1795 et BAA-2163), par rapport aux souches de référence de biotype couramment utilisées (WT classique O395, WT El Tor C6706 et WT El Tor N16961, tableau 1 ). L'émergence de variantes d'El Tor a présenté des défis à la fiabilité des protocoles de caractérisation de biotype à dosage unique précédemment employés; Cependant, ce système d'identification par dosage multiple permettra une caractérisation plus sûre des V cliniques et environnementales. Isolats de cholerae .

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Remarque: Les considérations de temps pour chaque essai doivent être effectuées car les préparations multimédias individuelles nécessitent des temps différents. Par exemple, les supports de plaque de gélose solide doivent être suffisamment frais et sécher (1-2 jours). Des considérations de temps supplémentaires ( c.-à-d. Une colonie unique et une croissance de la culture pendant la nuit) sont spécifiées dans chaque protocole et se trouvent dans le tableau 2 .

1. Préparation des médias

  1. 1x solution saline tamponnée au phosphate (PBS)
    1. Peser 4,0 g de NaCl, 0,1 g de KCl, 0,72 g de Na 2 HPO 4 et 0,12 g de KH 2 PO 4 . Mélanger les constituants dans un flacon Erlenmeyer de 1 L, ajuster le volume à 500 mL avec de l'eau désionisée, ajuster le pH à 7,2 en utilisant un pHmètre et ajouter HCl goutte à goutte à la solution, et autoclave ou filtrer stériliser à l'aide d'un filtre de 0,22 μm. 1x PBS peut être conservé à température ambiante indéfiniment.
      ATTENTION: Le HCl est un acide concentré et doit être manipulé selonAux règlements institutionnels, locaux, étatiques et fédéraux. Pour les directives de manutention appropriées, reportez-vous à la fiche de données de sécurité fournie par le fabricant.
  2. Luria-Bertani (LB) Bouillon
    1. Peser 5,0 g de triptonne, 2,5 g d'extrait de levure et 2,5 g de NaCl. Mélanger les constituants dans une bouteille de 1 L, ajuster le volume à 500 mL avec de l'eau désionisée, autoclave et conserver à température ambiante jusqu'à 6 mois. Pour les conditions classiques de la virulence du biotype, ajustez le pH à 6,5 en utilisant HCl avant l'autoclavage.
  3. AKI Medium contenant 0,03% (p / v) de NaHCO 3
    1. Pour le composant 1 (milieu AKI): peser 7,5 g de peptone, 2,0 g d'extrait de levure et 2,5 g de NaCl. Mélanger les constituants dans une bouteille de 1 L, régler le volume à 450 ml avec de l'eau désionisée et l'autoclave. Le milieu AKI peut être conservé à température ambiante jusqu'à 6 mois.
    2. Pour le composant 2 (NaHCO 3 ): peser 1,5 g de NaHC03 et régler le volumeÀ 50 ml avec de l'eau désionisée dans une vésicule stérile. Filtrer stériliser le NaHC03 en utilisant un filtre de 0,22 μm. Le NaHC03 doit être préparé immédiatement avant utilisation.
    3. Combinez aspechement les deux composants en créant un rapport 1:10 en filtrant le composant 2 dans le composant 1 avant utilisation.
  4. Plaques d'agartes Luria-Bertani (LB)
    1. Peser 5,0 g de triptonne, 2,5 g d'extrait de levure, 2,5 g de NaCl et 7,5 g d'agar. Mélanger les constituants dans un flacon Erlenmeyer de 1 L, régler le volume à 500 mL avec de l'eau désionisée, l'autoclave et préparer dans des boîtes de Petri stériles standard de 100 mm x 15 mm. Les supports plaqués peuvent être stockés en plastique jusqu'à 6 mois, le couvercle vers le haut à 4 ° C.
  5. LB Agar Plates Supplémentées avec Polymyxine B
    1. Pour la Composante 1 (agar LB): pesez 5,0 g de triptonne, 2,5 g d'extrait de levure, 2,5 g de NaCl et 7,5 g d'agar. Mélanger les constituants dans une fiole Erlenmeyer de 1 L, ajuster le volume à 500 mL wiEau désionisée et autoclave.
    2. Pour la Composante 2 (polymyxine B): dissoudre la polymyxine B dans de l'eau désionisée dans un tube de microcentrifugeuse stérile de 2 mL jusqu'à une concentration de 50 000 UI / μL et filtrer la stérilisation à l'aide d'un filtre de 0,22 μm.
    3. Une fois que le Composant 1 est frais au toucher, mais pas encore solidifié, ajouter soigneusement 500 μL de Composant 2 au Composant 1 en créant une concentration finale de 50 UI / μL et bien mélanger. Préparez dans des boîtes de Petri stériles standard de 100 mm x 15 mm en versant du mélange de milieu d'agar dans les boîtes de Petri. Les supports plaqués peuvent être stockés en plastique jusqu'à 3 mois, côté couvercle vers le haut à 4 ° C.
  6. Plaques d'agartes moyennes de citrate minimale
    1. Pour le composant 1 (agar avec du bleu de bromothymol): pèser 7,5 g d'agar et 0,02 g de bleu de bromothymol. Mélanger les constituants dans une fiole Erlenmeyer de 1 L, régler le volume à 450 mL avec de l'eau désionisée et autoclaver le mélange.
    2. Pour le composant 2 (10x VBMM): pesez 10,00 g de MgSO 4 7H 2 O, 10,0 g d'acide citrique H 2 O, 50,0 g de K 2 HPO 4 anhydre et 17,5 g de NaNH 4 HPO 4 4H 2 O. Mélanger les constituants dans un flacon Erlenmeyer 1 L, régler le volume à 500 ml Avec de l'eau désionisée et un autoclave ou filtre une stérilisation à l'aide d'un filtre de 0,22 μm. 10x VBMM peuvent être conservés à température ambiante jusqu'à 6 mois.
    3. Ajouter 50 ml du composant 2 au composant 1 et préparer dans des boîtes de Petri stériles de taille standard de 100 mm x 15 mm en versant des milieux de gélose mélangés dans les boîtes de Petri. Les supports plaqués peuvent être stockés en plastique jusqu'à 6 mois, le couvercle vers le haut à 4 ° C.
  7. Plaques Agar au lait
    1. Pour le Composant 1 (lait): pesez 8,0 g de lait sec non grasse instantané dans un flacon Erlenmeyer de 1 L, réglez le volume à 200 mL avec de l'eau désionisée et l'autoclave.
    2. Pour le composant 2 (agar avec infusion cérébrale): peser 3,68 g de perfusion cérébrale et 6,0 g d'agar. Combinez le conDans un flacon d'Erlenmeyer de 500 ml, ajustez le volume à 200 ml avec de l'eau désionisée et de l'autoclave.
    3. Combinez les deux composants en versant le Composant 2 dans le Composant 1, après l'autoclavage et bien mélanger. Préparez dans des boîtes de Petri stériles de 150 mm x 15 mm. Les plaques de lait peuvent être stockées jusqu'à une semaine en plastique, côté couvercle vers le bas à 4 ° C. Préparez dans des boîtes de Petri stériles de 150 mm x 15 mm en versant du mélange de milieu d'agar dans les boîtes de Petri.
  8. Plaques d'agate de motilité
    1. Pour le Composant 1 (agar LB): pesez 5,0 g de triptonne, 2,5 g d'extrait de levure, 2,5 g de NaCl et 2,0 g d'agar. Mélanger les constituants dans une fiole Erlenmeyer de 1 L, régler le volume à 500 mL avec de l'eau désionisée et l'autoclave.
    2. Pour le composant 2 (1% (p / v) de chlorure de triphényltétrazolium; TTC): pesez 0,25 g TTC. Réglez le volume à 25 mL avec de l'eau désionisée dans une vésicule stérile et filtrez-le en utilisant un filtre de 0,22 μm. Conserver jusqu'à 6 mois à la température ambiante emballéeEn aluminium pour minimiser l'exposition à la lumière.
    3. Ajouter 2,5 ml de TTC stérile à 1% (p / v) sur des supports autoclavés.
    4. Verser le milieu aussi épais que possible (≥50 mL / plaque) dans de grandes boîtes de Petri stériles de 150 mm x 15 mm. Les supports plaqués peuvent être stockés enveloppés en plastique jusqu'à une semaine, côté couvercle vers le haut à 4 ° C. Préparez dans des boîtes de Petri stériles de 150 mm x 15 mm en versant du mélange de milieu d'agar dans les boîtes de Petri.
  9. Voges-Proskauer (VP)
    1. Pour le composant 1 (bouillon Methyl Red-Voges-Proskauer, MR-VP): pesez 1,7 g de milieu MR-VP dans un flacon Erlenmeyer de 500 ml, réglez le volume à 100 ml avec de l'eau désionisée et de l'autoclave. Le bouillon stérile MR-VP peut être conservé à température ambiante jusqu'à 6 mois.
    2. Pour le composant 2 (5% (p / v) alpha (α) naphtol): peser 1,0 g d'α-naphtol dans une vésicule stérile et ajuster le volume à 20 ml avec de l'éthanol à 95%. L'α-naphtol peut être stocké à température ambiante pendant jusqu'à 1 semaine enveloppé en feuille pour minimiser l'exp.Osure.
    3. Pour le composant 3 (40% (p / v) d'hydroxyde de potassium, KOH): pesez 20,0 g de KOH dans une vésicule stérile, ajustez le volume à 50 ml avec de l'eau désionisée stérile. KOH peut être conservé jusqu'à 6 mois à température ambiante dans un récipient en plastique.

2. Entretien et croissance de V. Cholerae Strains

  1. Préparation et utilisation des cultures de stock congelées
    1. Pellet 1,8 ml de culture liquide pendant une nuit pendant 2 min par centrifugation (≥8,600 xg) dans un tube de microcentrifugeuse stérile de 2 mL, enlever le surnageant et remettre en suspension le culot cellulaire dans 900 μL de bouillon LB frais par pipettage.
    2. Ajouter 900 μL de glycerol stérile à 60% (v / v) à la culture et mélanger par vortexage.
    3. Transférer le mélange dans un tube cryogénique stérile de 2 ml et conserver indéfiniment à -80 ° C.
    4. Pour l'utilisation, enlever une petite quantité de produit congelé en utilisant une boucle d'inoculation stérile et une strie pour des colonies simples sur LB agAr plates. Retourner immédiatement le stock congelé à -80 ° C après utilisation pour empêcher les cultures de décongeler complètement. Incuber les plaques au couvercle vers le bas pendant 12 à 16 h à 37 ° C.
  2. Croissance des cultures de nuit en milieu liquide
    1. Séquence pour les colonies simples (selon la section 2.1.4) à partir du stock congelé sur des plaques d'agar LB. Incuber les plaques au couvercle vers le bas pendant 12 à 16 h à 37 ° C.
    2. Inoculer 4 mL de bouillon LB liquide dans un tube de culture stérile de 10 mL avec une seule colonie en touchant la surface de la colonie unique avec un bâton applicateur stérile et en transférant la colonie dans le bouillon liquide.
    3. Incuber avec une aération dans un incubateur à agitateur à 225 tr / min pendant 12 à 16 h à 37 ° C.
  3. Courbe de croissance
    1. Préparez une culture de nuit dans un bouillon LB liquide comme indiqué précédemment dans le protocole 2.2.
    2. Faire une dilution 1: 100 de la culture de nuit en transférant 250 μL de culture de nuit à 25 ml de bouillon LB frais dans un ballon Erlenmeyer stérile de 250 ml.
    3. Mesurer la densité optique des cultures liquides à 600 nm (OD 600 ) toutes les heures à partir du moment de l'inoculation (T 0 ).
    4. Incuber une dilution 1: 100 de culture pendant une nuit avec une aération dans un incubateur à agitateur à 225 tr / min pendant jusqu'à 30 h à 37 ° C, ou jusqu'à ce que la culture atteigne une densité maximale.
    5. Graphisez le OD 600 vs Time et utilisez une régression linéaire pour déterminer le temps de doublement approximatif pour chaque souche.
  4. El Tor Biotype Virulence Inducing Conditions
    1. Séquence pour les colonies simples à partir de stocks congelés sur des plaques d'agar LB. Incuber les plaques du couvercle vers le bas, pendant 12 à 16 h à 37 ° C.
    2. Inoculer 10 ml de milieu AKI contenant 0,03% (p / v) de NaHC03 avec une colonie unique.
    3. Incuber la culture sans aération à 37 ° C pendant 3,5 h.
    4. Retirer 7 mL de culture et incuber les 3 mL restants de cultuRe avec une aération dans un incubateur de secoueur à 225 tr / min pendant 4 h supplémentaires.
  5. Conditions classiques de l'induire de la virginité du biotype
    1. Séquence pour les colonies simples à partir de stocks congelés sur des plaques d'agar LB. Incuber les plaques au couvercle vers le bas pendant 12 à 16 h à 37 ° C.
    2. Inoculer 4 ml de bouillon LB liquide (pH 6,5) avec une seule colonie.
    3. Incuber avec une aération dans un incubateur à agitateur à 225 tr / min pendant 12 à 16 h à 30 ° C.
  6. Pellet de cellule de lavage dans 1x PBS
    1. Pellet 1,8 ml de culture pendant une nuit pendant 2 minutes par centrifugation (≥8 600 xg) dans un tube de microcentrifugeuse stérile de 2 ml et enlever le surnageant en utilisant une pipette. Remettre en suspension le culot cellulaire dans 1,8 mL 1x PBS par pipettage.
    2. Répéter la procédure de lavage trois fois suivie d'une resuspension finale dans 1,8 mL 1x PBS.

3. Caractérisation de V. Cholerae Biotypes

  1. PÉcrans génétiques à base de CR utilisant ctxB et tcpA
    1. Concevez un ensemble d'amorces qui recouvrent environ 50 à 70 pb en amont et en aval des sites de départ et d'arrêt translationnels de ctxB et tcpA respectivement.
    2. Préparez une culture de nuit dans un bouillon LB liquide comme indiqué précédemment dans le protocole 2.2.
    3. Isoler l'ADN chromosomique en utilisant un kit disponible dans le commerce conçu pour les bactéries Gram-négatives. L'ADN chromosomique purifié peut être conservé indéfiniment à -20 ° C. L'isolement chromosomique de l'ADN utilisant des kits disponibles dans le commerce prend généralement environ 4 h.
    4. Utilisez un spectrophotomètre à micro-volume pour s'assurer que l'échantillon d'ADN chromosomique est de haute qualité (A 260/280 > 1.8).
    5. Pour chaque isolat d'ADN chromosomique, préparez une (des) réaction (s) en chaîne par polymérase (PCR) sur de la glace dans un tube de PCR 200 μL stérile et amplifiez les régions de ctxB et tcpA en utilisant des composants de PCR standard: Taq polymerase and buFfer (ou équivalents), la solution dNTP et les amorces avant / inverses. Utilisez des paramètres de PCR standard (~ 3 h). Par exemple, utilisez le protocole suivant:
      1. Dénature initiale à 95 ° C pendant 120 s.
      2. Denature à 95 ° C pendant 60 s.
      3. Imbibes de recuit à 60 ° C pendant 45 s.
      4. Étendre à 72 ° C pendant 90 s.
      5. Répétez les étapes 3.1.5.2 à 3.1.5.4 pendant 34 cycles.
      6. Extension finale 72 ° C pour 600 s.
      7. Atteinte infinie à 4 ° C.
    6. Colorer 5 μL de produit (s) de PCR respectif en utilisant un colorant de chargement standard de gel d'ADN 6x et charger environ 10 μL d'échelle de 1 kb et 10 μL de produit de PCR sur un gel d'agarose à 1% dans 1x Tris-Borate-EDTA (TBE) tampon.
    7. Effectuez une électrophorèse sur gel à 130 V jusqu'à ce que le front de teinture atteigne la fin, mais pas éteint, du gel (environ 90 minutes). La surveillance constante est recommandée car la tension et les temps de fonctionnement peuvent varier en fonction de l'équipement.
    8. Lors de la vérification deUne amplification réussie par PCR à la taille attendue, purifie le (s) produit (s) de PCR de 45 μL restants en utilisant un kit de nettoyage et de concentrateur d'ADN disponible dans le commerce.
    9. Produit (s) de PCR nettoyé par séquence à l'aide des mêmes amorces utilisées pour l'amplification par PCR, et prépare selon les directives de l'installation de séquençage local.
    10. Comparez le format FASTA des séquences de gènes de chaque isolat à la séquence publiée disponible sur le site Web de NCBI (http://www.ncbi.nlm.nih.gov/gene/), en recherchant les numéros d'accession suivants dans la zone de recherche.
    11. CtxB : région (classique) entre VC0395_A1059 à VC0395_A1060 (El Tor) VC_1456
    12. TcpA : (classique) VC0395_A0353 (El Tor) VC_0828
  2. Essais phénotypiques pour la classification des biotypes via Spotting
    1. Préparez une culture de nuit dans un bouillon LB liquide comme indiqué précédemment dans le protocole 2.2.
    2. Laver la ou les pastilles cellulaires comme spécifié dans le protocole 2.6.
    3. Utilisez une pipette pourLocaliser 1 μL de culture lavée sur le milieu respectif. Pour les spécifications de sélection et d'incubation moyennes, se référer au tableau 2.
  3. Test de motilité
    1. Préparez une (ou des) culture (s) pendant la nuit dans un bouillon LB liquide comme indiqué précédemment dans le protocole 2.2.
    2. Laver la ou les pastilles cellulaires comme spécifié dans le protocole 2.6.
    3. Inoculer les plaques de gélose de motilité en insérant une cuvette d'inoculation dans la culture liquide lavée et à "couper le couteau" verticalement dans le milieu. Entre chaque inoculation, stériliser le coup de fil à l'aide d'un brûleur Bunsen, et en saisissant la gélose, assurez-vous que la piqûre d'inoculation ne se plie pas, car cela peut modifier les résultats.
    4. Incuber les plaques du couvercle vers le haut pendant 14 à 24 h à 37 ° C. Après 14 h, surveiller les plaques de motilité de manière étroite afin de prévenir le surcroît de culture.
  4. Ensemble Voges-Proskauer (VP)
    1. Préparez une (ou des) culture (s) pendant la nuit dans un bouillon LB liquide comme indiqué précédemment dans le protocole 2.2.
    2. Inoculer 4Ml de vermicelle de méthyle Voges-Proskauer, ou bouillon de MR-VP, en pipetant 10 μl de culture de nuit préalablement préparée dans 4 ml de bouillon MR-VP dans un tube de culture stérile et incuber avec une aération dans un incubateur à agitateur à 225 tr / min pendant 12 à 16 H à 37 ° C.
    3. Ajouter 150 μl de α-naphtol à 5% (p / v) et 50 μL de KOH à 40% (p / v) à 1 ml d'aliquotes de culture de nuit MR-VP dans des tubes de culture stériles, respectivement.
    4. En bref, tourbillonner et laisser reposer à température ambiante jusqu'à 4 h jusqu'à ce que le changement de couleur se développe.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Pour un entretien et une utilisation appropriés de toute souche bactérienne, il est recommandé de connaître le temps de doublement de la (les) souche (s) d'intérêt. Dans ce cas, les taux de croissance variables des V couramment utilisés. Les souches de cholerae ont été démontrées par une courbe de croissance, et les temps de doublement approximatifs ont été calculés en utilisant une régression linéaire. WT El Tor N16961 et El Tor variante MQ1795 ont démontré des temps de doublement plus courts (~ 1 h et ~ 1 h respectivement) que WT classique O395 (~ 2 h) ( Figure 1 , Tableau 2 ).

La manipulation génétique de V. cholerae et l'analyse ultérieure reposent souvent sur la capacité de distinguer correctement les biotypes. Les écrans génétiques à base de PCR et les essais phénotypiques ont été mis en œuvre collectivement en tant que système fiable pour distinguer les fonds biotypiques de V. Cholerae clinique et environnementale iSolates; Pour la représentation, des souches de référence de biotype (WT classique O395, WT El Tor C6706 et WT El Tor N16961) et des variantes représentatives El Tor (MQ1795 et BAA-2163) ont été incluses ( tableau 1 ). WT classique O395 a démontré les séquences classiques ctxB et tcpA. À l'inverse, les souches N16961 et C6706 de WT El Tor ont démontré les séquences de El Tor ctxB et tcpA. Il est intéressant de noter que MQ1795 et BAA-2163 contiennent la sous-unité classique biotype ctxB comparable à O395, mais les deux variantes El Tor contiennent le tcpA indicatif du fond de biotype El Tor ( tableau 1 ). La souche O395 de biotype classique de WT a montré une sensibilité à la polymyxine B, tandis que les souches de biotype de WT El Tor (C6706 et N16961) présentaient une résistance et présentaient une croissance sur des plaques d'agar LB complétées par de la polymyxine B. Les souches représentatives de El Tor (MQ1795 et BAA-2163) ont démontré Une résistance similaire à l'antibiotique par rapport à la couche de biotype WT El TorIns (C6706 et N16961) ( figure 2 ; tableau 2 ). La souche de biotype classique WT O395 n'a pas augmenté sur des milieux de citrate minimaux, tandis que les souches de WT El Tor (C6706 et N16961) ont pu utiliser le citrate comme source de carbone et présenter une croissance sur des milieux de citrate minimaux. Les souches de biotype variant El Tor (MQ1795 et BAA-2163) ont démontré une croissance comparable à celle des souches de biotype WT El Tor (C6706 et N16961) ( figure 3 , tableau 2 ). La souche classique WT O395 et la souche WT El Tor N16961 possèdent un HapR non fonctionnel et ne démontrent donc pas l'activité de protease régulée par HapR; La souche C6706 de WT El Tor et les variantes représentatives de El Tor (MQ1795 et BAA-2163) sont affichées positivement comme une zone de dégagement émanant du point d'inoculation ( figure 4 , tableau 2 ). La souche classique O395 de WT ne sécrète pas les enzymes hémolytiques et est pour celaE γ-hémolytique, tandis que les souches de biotypes de WT El Tor (C6706 et N16961) et les souches représentatives de El Tor (MQ1795 et BAA-2163) sécrètent des enzymes hémolytiques qui lyse complètement les globules rouges entourant le point d'inoculation et présentent une β-hémolyse ( figure 5 ; tableau 2 ). La motilité varie à travers, et à l'intérieur, des souches de biotypes; Cependant, la souche WT El Tor N16961 et les variantes El Tor (MQ1795 et BAA-2163) ont démontré une hyper-motilité par rapport à la souche classique WT classique O395 et WT El Tor C6706 ( figure 6 , tableau 2 ). La souche classique OT95 de WT et les variantes représentatives d'El Tor n'ont pas métabolisé le glucose pour produire de l'acétoïne, tandis que les souches de biotype de WT El Tor ont produit de l'acétoone comme sous-produit de la fermentation du glucose, comme indiqué par le développement d'une couleur rouge foncé lors de l'analyse de Voges-Proskauer ( figure 7 ; Tableau 2 ).

Souche CtxB Gene TcpA Référence
Base 115 Base 203 Biotype Biotype
O395 C C classique classique 8
C6706 T T El Tor El Tor 8
N16961 T T El Tor El Tor 8
MQ1795 C C classique El Tor 13
BAA 2163 C C classique El Tor 8

Tableau 1: Distinctions génétiques dépendantes du biotype des souches de référence Vibrio cholerae . On montre dans ce tableau les changements de base d'ADN et les positions relatives dans les gènes ctxB et tcpA . WT classique O395 et WT El Tor souches N16961 et C6706 sont des souches de référence de biotype couramment utilisées. MQ1795 et BAA-2163 sont des variantes El Tor connues.

Essai Application Sélection moyenne Incubation Résultats attendus
O395 C6706 N16961 MQ1795 BAA-2163
2.3) Courbe de croissance 27 Détermine le doublement des différentes variantes de V. cholerae 1.2) Bouillon liquide LB Jusqu'à 30 h (37 ° C avec aération) ~ 2 h ND * ~ 1 h ~ 1 h ND *
3.1) Écran génétique à base de PCR utilisant ctxB et tcpA 8 Différents styles de biotype classique et El Tor de ctxB N / A N / A classique El Tor El Tor classique classique
Différents styles de biotype classique et El Tor de tcpA N / A N / A classique El Tor El Tor El Tor El Tor
3.2) Polymyxine B Résistance 21 Sensibilité à l'antibiotique polymyxine B 1.5) Plaques d'agar LB complétées par de la polymyxine B 18 h (37 ° C) - + + + +
3.2) Metabolisme des citrates 22 Capacité de métaboliser le citrate comme seule source de carbone 1.6) Plaques de gélose moyenne citrate minimale 24 h (37 ° C) - + + + +
3.2) Hydrolyse de la caséine 23 Activité de protease régulée par HapR 1.7) Plaques d'agar de lait 18 h (37 ° C) - - + + +
3.2) Hémolyse 23 Mesure l'activité hémolytique Plaques d'agar de sang 48 h (37 ° C) Gamma Bêta Bêta Bêta Bêta
3.3) Motilité 23 Mesure le degré de motilité 1.8) Plaques de gélose Motility 14-24 h (37 ° C) 10 mm 15 mm 21 mm 25 mm 29 mm
3.4) Voges-Proskauer 21 Mesure la capacité de ferment le glocose et produit de l'acétoone comme sous-produit 1.9) Liquide Voges-Proskauer moyen Jusqu'à 4 h (température ambiante) - + + - -
Remarque: "ND *" indique non déterminé; "+" Désigne un résultat positif; "-" désigne un résultat négatif

Tableau 2: Résumé des essais génétiques et phénotypiques utilisés pour Rong > Vibrio cholerae Biotype Distinction. Ce tableau récapitule les diverses analyses génétiques et phénotypiques, les applications et les résultats attendus collectivement utilisés pour différencier les biotypes classiques et El Tor utilisés dans cette étude. Les numéros de protocole et les références à des protocoles spécifiques sont indiqués dans la colonne Assay. "ND *" indique Non déterminé; "+" Désigne un résultat positif; "-" désigne un résultat négatif.

Figure 1
Figure 1: V. Cholerae Growth Curve of WT Classical O395, WT El Tor N16961 et El Tor Variant MQ1795. Les taux de croissance des souches de référence de biotype (WT classiques O395 et WT El Tor N16961) et la variante représentative El Tor MQ1795, cultivées dans du bouillon LB avec une aération à 37 ° C, ont été analysées en mesurant la DO 600 eTrès heure commençant à T 0 . Les courbes de croissance ont été réalisées sur 8 répétitions expérimentales indépendantes, chaque répétition représentant un événement de culture indépendant pour chaque essai. WT El Tor souche N16961 et El Tor variante MQ1795 ont démontré des temps de doublement plus courts (~ 1 h et ~ 1 h respectivement) par rapport à la souche classique O395 de WT (~ 2 h), comme cela a été observé par un temps de doublement plus long. Cliquez ici pour voir une version plus grande de ce chiffre.

Figure 2
Figure 2: Détermination de la résistance à la polymyxine B à l'aide d'un agarre LB additionné de polymyxine B. La résistance à l'antibiotique peptidique polymyxine B a été déterminée par la capacité de croissance sur une grappe de LB additionnée de 50 UI / μL de polymyxine B. La souche classique O395 de WT n'a montré aucune croissance sur l'agar SupplA été émise avec de la polymyxine B et a été considérée comme sensible à l'antibiotique. Alors que les souches de WT El Tor (C6706 et N16961) et les variantes représentatives de El Tor (MQ1795 et BAA-2163) présentaient une croissance en présence de l'antibiotique et étaient considérées comme résistantes à la polymyxine B. Les plaques ont été incubées à 37 ° C pendant 18 h. Cliquez ici pour voir une version plus grande de ce chiffre.

figure 3
Figure 3: Mesurer le métabolisme des citrates à l'aide de médias de citrate minimaux. La capacité d'utiliser le citrate comme seule source de carbone a été déterminée par la capacité de l'isolat à se développer sur des milieux de citrate minimaux. La souche classique O395 de WT n'a pas augmenté sur des milieux citrate minimaux (négatifs). La croissance était évidente par toutes les souches de WT El Tor (C6706 et N16961) et représentative ElTor variantes (MQ1795 et BAA-2163), qui a démontré la capacité d'utiliser le citrate comme une seule source de carbone (positive). Les plaques ont été incubées à 37 ° C pendant 18 h. Cliquez ici pour voir une version plus grande de ce chiffre.

Figure 4
Figure 4: Mesure de l'hydrolyse de la caséine protéolytique régulée par HapR à l'aide de milieux Agar de lait. L'hydrolyse de la caséine par l'intermédiaire de l'activité protéase régulée par HapR a été déterminée par une zone visuelle de dégagement entourant le point d'inoculation sur la gélose au lait. Les souches contenant un HapR non fonctionnel, telles que la souche classique WT O395 et la souche WT El Tor N16961, n'ont pas produit une zone de dégagement entourant le point d'inoculation ( hapR négatif). WT El Tor souche C6706 et variantes représentatives de El Tor (MQ1795 et BAA-2163) contiennent un HapR fonctionnel, qui peut être visualisé comme des zones de dégagement variable ( hapR -positive). Les plaques ont été incubées à 37 ° C pendant 18 h. Cliquez ici pour voir une version plus grande de ce chiffre.

Figure 5
Figure 5: Mesure de l'activité hémolytique à l'aide de l'Agar Agar sanguin. L'activité hémolytique a été mesurée en utilisant des plaques de gélose complétées par du sang de mouton. WT la souche classique O395 ne sécrète pas les enzymes qui lysent les globules rouges (γ-hémolytiques). Les souches de WT El Tor (N16961 et C6706) et les variantes représentatives de El Tor (MQ1795 et BAA-2163) sécrètent des enzymes hémolytiques, ce qui a entraîné une zone de dégagement translucide entourant le point d'inoculation (β-hémolytique). Les plaques ont été incubées à 37° C pendant 48 h. Cliquez ici pour voir une version plus grande de ce chiffre.

Figure 6
Figure 6: Détermination de la motilité à l'aide de plaques Agar de motilité. La zone de motilité a été indiquée par un changement de couleur visuel du TTC de sel qui passe du clair au rouge lorsqu'il est métabolisé, indiquant où les bactéries se sont déplacées. La souche classique WT O395 (10 mm) et la souche WT El Tor C6706 (15 mm) ont démontré une motilité minimale, tandis que la souche El Tor N16961 (21 mm) et les variantes représentatives El Tor (MQ1795 (25 mm) et BAA-2163 (29 mm) ) A démontré une hyper-motilité par rapport à O395 et C6706. Les plaques ont été incubées à 37 ° C pendant 18 h. Cliquez s'il vous plaitIci pour voir une version plus grande de ce chiffre.

Figure 7
Figure 7: essai Voges-Proskauer. La production d'acétole par fermentation de glucose a été déterminée à l'aide du dosage Voges-Proskauer. WT classique souche O395 et représentatif El Tor variantes (MQ1795 et BAA-2163) n'a pas produit d'acétole en raison de la fermentation du glucose (négatif). WT El Tor (N16961 et C6706) ont produit le sous-produit acétomin et peuvent être visualisés par un changement de couleur rouge profond (positif). Les tubes ont été incubés à température ambiante pendant 4 h. Cliquez ici pour voir une version plus grande de ce chiffre.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Parmi les plus de 200 V identifiés. Sérogroupes de cholerae , seuls O1 et O139 ont un potentiel épidémique. Le sérogroupe O1 peut être divisé en deux biotypes: classique et El Tor. Cependant, des souches hybrides, appelées les variantes 13 , 17 d' El Tor, ont émergé et possèdent les antécédents de biotype El Tor, et portent les caractéristiques classiques 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 . Les protocoles décrits dans ce manuscrit sont conçus pour fournir aux enquêteurs, intéressés à caractériser et / ou à distinguer divers isolats cliniques et non cliniques de V. cholerae , avec une fiabilitéSystème d'identification multi-tests. L'utilisation d'un système d'identification multi-tests fiables comme alternative est une amélioration par rapport aux systèmes d'identification à un seul test précédemment établis et aux écrans génétiques intensifs en main-d'œuvre. Tous les essais génotypiques et phénotypiques devraient inclure les souches WT classique O395 et WT El Tor C6706 et N16961 pour comparaison ( tableau 1 ). Bien que les souches de biotypes classiques et El Tor soient incluses à titre de référence, des isolats, tels que MQ1795 et BAA-2163 inclus dans nos études, peuvent afficher des profils phénotypiques à partir du biotype ( figure 2 , figure 3 , figure 4 , figure 5 , figure 6 , Figure 7 , tableau 2 ), illustrant la nécessité d'analyser des traits génotypiques et phénotypiques multiples pour une caractérisation fiable. Tous les protocoles devraient être effectués de manière aseptiqueLy 26 à température ambiante sauf indication contraire. V. Cholerae est un agent pathogène de niveau de biosécurité 2 (BSL-2) qui est l'agent étiologique de la maladie gastro-intestinale potentiellement fatale choléra; La manipulation et l'élimination appropriées de tous les matériaux et produits de déchets doivent être appliquées selon les réglementations institutionnelles, locales, fédérales et fédérales.

La préparation de tous les supports et réactifs doit être effectuée à l'aide de réactifs analytiques et d'eau ultrapure désionisée à une sensibilité minimale de 18 MΩ-cm. Avant le traitement, les supports doivent être préparés et autorisés à sécher suffisamment (1-2 jours); Les plaques sont jugées suffisamment sèches lorsqu'aucun liquide résiduel n'est présent sur la surface de la gélose. En raison de la portée mobile et des zones de dégagement entourant la croissance bactérienne, la motilité et les plaques de lait doivent être préparées dans de grandes boîtes de Petri (150 mm x 15 mm) jusqu'à 50 mL par plaque et peuvent être stockées jusqu'à 1 semaine en plastique , LiD-côté vers le bas à 4 ºC. En outre, la concentration en gélose des plaques de motilité peut être ajustée pour ralentir la motilité; Cependant, il n'est pas recommandé de dépasser 3 g d'agar par solution de 500 ml, car cela réduira considérablement la motilité globale de sorte que les différences ne seront pas observables. Tous les autres supports de plaques doivent être préparés à environ 25 mL par plaque dans des boîtes de Petri de taille standard (100 mm x 15 mm) et peuvent être conservés jusqu'à six mois en plastique, côté couvercle vers le bas à 4 ºC. Pour la préparation de plaques de polymyxine B, il est important de laisser refroidir les milieux fondus après autoclavage avant d'ajouter la polymyxine B, car une chaleur excessive peut dégrader les antibiotiques. Les plaques de polymyxine B peuvent être stockées jusqu'à 3 mois en plastique, côté couvercle vers le bas à 4 ºC. Les essais analysés dans ce manuscrit exigent un jour pour une croissance de colonie unique (12-16 h), un jour supplémentaire pour la croissance des cultures de nuit (12-16 h) et un troisième jour pour des considérations de génotypie (~ 4 h pour DN chromosomiqueUn isolement et ~ 3 h pour la PCR) ou des essais phénotypiques (18 à 48 h, tableau 2 ). Avant l'analyse biochimique des analyses phénotypiques décrites dans ce manuscrit, les cultures doivent être lavées dans 1x PBS pour empêcher le report des médias de culture résiduelle des résultats d'inclinaison. En outre, les essais de polymyxine B, de citrate, d'activité protéase, d'hémolyse et de motilité peuvent être inoculés simultanément en utilisant une seule culture lavée pendant la nuit. Lors du repérage de milieux plaqués, des éclaboussures de cultures peuvent se produire et peuvent entraîner une contamination croisée entre les souches. Pour éviter les éclaboussures, évitez d'éjecter complètement la culture de la pipette, arrête d'éjecter la culture au premier arrêt de la pipette. En outre, permettre aux taches d'absorber complètement dans la surface de la gélose avant l'incubation, et prenez soin de ne pas creuser la gélose, ce qui peut affecter les résultats. Dosages phénotypiques entraînant des zones de dégagement ( Figure 4 ; Figure 5 ; Tableau 2) Et / ou la motilité ( Figure 6 ; Tableau 2 ) entourant le point d'inoculation, devraient être espacés au maximum pour empêcher la fusion des zones de dégagement ou de croissance, respectivement, sur lesquelles les diamètres respectifs peuvent être mesurés pour une analyse comparative. Après les temps d'incubation indiqués, les isolats peuvent être imagés et analysés par rapport aux souches de référence biotypes (WT classique O395, WT El Tor C6706 et WT El Tor N16961).

Les écrans génétiques à base de PCR par séquençage décrits dans ce manuscrit peuvent être utilisés pour identifier le fond de biotype de l'isolat par rapport à CtxB et tcpA , suite à une amplification PCR initiale. Les directives de séquençage standard nécessitent une quantité spécifique de produit de PCR en fonction de la taille de la région amplifiée (580 pb pour ctxB et 1420 pb pour tcpA ) et pour la mise en place des réactions, les protocoles établis peuvent être suivis. En bref, l'individu avance et rDes réactions de séquençage en sens inverse doivent être préparées avec 3-5 pmol d'amorce / réaction et le volume doit être ajusté à 20 μl avec de l'eau ultrapure stérile dans un tube de microcentrifugeuse de 1,5 mL. Pour l'aide à la conception d'amorces à la fois pour l'amplification et le séquençage par PCR, l'outil de conception d'amorces NCBI http://www.ncbi.nlm.nih.gov/tools/primer-blast/ peut être utilisé. L'amplification et le séquençage réussis de ctxB et tcpA ont été réalisés en utilisant les amorces suivantes (5 '→ 3'): ctxB- en avant GGGAATGCTCCAAGATCATCGATGAGTAATAC, ctxB -recultat CATCATCGAACCACAAAAAAGCTTACTGAGG, tcpA -forward CCGCACCAGATCCACGTAGGTGGG, tcpA -reverse GTCGGTACATCACCTGCTGTGGGGGGAGG. Il convient de noter que la région de codage entière de ctxB est conservée dans les deux biotypes à l'exception des positions de base 115 et 203 (à la fois la cytosine dans la classique et la thymine chez El Tor). En outre, dans tcpA , des changements de base multiples sont conservés parmi les biotypes qui dIffer à travers les deux biotypes ( tableau 1 ), qui peut être utilisé pour aider à distinguer les biotypes.

Dans de nombreuses études de laboratoire impliquant l'organisme modèle V. Cholerae, les techniques de maintenance et de culture appropriées sont critiques 27 . Les taux de croissance des V couramment utilisés. Les souches de référence de biotype de cholerae , telles que la souche classique WT O395 et la souche WT El Tor N16961, peuvent fournir un aperçu utile de la caractérisation des isolats de variantes El Tor ( figure 1 , tableau 2 ). En raison des taux de croissance variables dans V. Cholerae, il est important de prendre des lectures d'absorbance du spectrophotomètre toutes les heures jusqu'à ce que les cultures atteignent la turbidité maximale pendant la phase stationnaire tardive. La phase de décès moyen-tardif peut ne pas être visualisée en raison d'un plateau de turbidité résultant d'excès de débris cellulaires. Une dilution 1: 4 de culture à une L stérile Le bouillon B doit être effectué pour obtenir une courbe de croissance complète et maintenir la précision de l'instrument, car les lectures d'absorbance atteignent un pic de DO 600 ≈ 1,0. Lorsque vous effectuez des courbes de croissance sur de multiples souches, les lectures d'absorbance doivent être programmées à environ 5 minutes d'intervalle pour chaque souche pour assurer la cohérence entre les lectures. Comprendre V. Les taux de croissance des biotypes de cholerae sont cruciaux pour de nombreuses recherches, y compris les études d'expression des gènes de virulence, l'analyse des activités métaboliques et les conditions de culture et de stockage appropriées. Pour une analyse ultérieure, les cultures du jour au lendemain devraient être traitées dans le stade tardif de la phase de croissance stationnaire (12-16 h) afin de maximiser la croissance cellulaire tout en maintenant l'intégrité des cellules.

Les conditions de culture pour les souches de biotypes classiques et El Tor sont similaires, cependant, l'analyse de l'expression du gène de la virulence dans V. Cholerae nécessite des conditions inductrices de virulence spécifique au biotypeLes principaux facteurs de virulence CT et TCP sont contrôlés par le régulateur maître ToxT et sont exprimés de manière optimale dans des conditions de croissance spécifiques; par exemple, dans des conditions inductrices de virulence d'El Tor, ToxT peut être analysée en traitant l'extrait cellulaire entier ( WCE), ou la pastille cellulaire, à 3,5 h, tandis que l'expression CT et TCP peut être analysée en traitant le surnageant sans cellule et WCE à 7,5 h, respectivement 8 , 20. Les traits génotypiques et phénotypiques variés démontrés tout au long de ce manuscrit indiquent comment Des biotypes variés de V. Cholerae peuvent être, et illustrent la nécessité d'une alternative à la caractérisation biotype d'un seul essai précédemment utilisée.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Les auteurs n'ont rien à dévoiler.

Acknowledgements

Recherche soutenue par New Hampshire-INBRE grâce à un Prix de développement institutionnel (IDeA), P20GM103506, de l'Institut national des sciences médicales générales du NIH.

Materials

Name Company Catalog Number Comments
1 kb DNA Ladder New England Biolabs N3232S https://www.neb.com/products/n3232-1-kb-dna-ladder
60% Glycerol Calbiochem 356352 http://www.emdmillipore.com/US/en/product/Glycerol%2C-Molecular-Biology-Grade---CAS-56-81-5---Calbiochem,EMD_BIO-356352
Agar Becto, Dickinson and Co. 214030 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=214030&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D214030%26typeOfSearch%3DproductSearch
Agar with brain-heart infusion Becto, Dickinson and Co. 237500 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=237500&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D237500%26typeOfSearch%3DproductSearch
Agarose Peqlab 732-2789 https://de.vwr.com/store/catalog/product.jsp?catalog_number=732-2789&_DARGS=/store/cms/de.vwr.com/de_DE/header_2016111711383215.jsp_AF&_dynSessConf=1766917479792147141&targetURL=/store/catalog/product.jsp%3Fcatalog_number%3D732-2789&lastLanguage=en&/vwr/userprofiling/EditPersonalInfoFormHandler.updateLocale=&_D%3AcurrentLanguage=+&currentLanguage=en&_D%3AlastLanguage=+&_D%3A/vwr/userprofiling/EditPersonalInfoFormHandler.updateLocale=+
Anhydrous K2HPO4 Fisher Scientific P288-500 https://www.fishersci.com/shop/products/potassium-phosphate-dibasic-anhydrous-crystalline-powder-certified-acs-fisher-chemical-5/p288500?searchHijack=true&searchTerm=P288500&searchType=RAPID
Blood Agar Plates Remel R01200 Store at 4 °C;  http://www.remel.com/Catalog/Item.aspx?name=Blood+Agar
Boric Acid Fisher Scientific A73-500 https://www.fishersci.com/shop/products/boric-acid-crystalline-certified-acs-fisher-chemical-6/a73500?searchHijack=true&searchTerm=A73500&searchType=RAPID
Bromothymol Blue Fisher Scientific B388-10 https://www.fishersci.com/shop/products/bromothymol-blue-certified-acs-fisher-chemical/b38810?searchHijack=true&searchTerm=B38810&searchType=RAPID
Cirtric acid ·H2O Fisher Scientific S72836-3 https://www.fishersci.com/shop/products/citric-acid-monohydrate-4/s728363#?keyword=s728363
Deoxynucleotide (dNTP) Solution Kit New England Biolabs N0446S Store at -20 °C;  https://www.neb.com/products/n0446-deoxynucleotide-solutionset
Disodium EDTA Fisher Scientific S311-500 https://www.fishersci.com/shop/products/ethylenediaminetetraacetic-acid-disodium-salt-dihydrate-crystalline-certified-acs-fisher-chemical-7/s311500?searchHijack=true&searchTerm=S311500&searchType=RAPID
DNA Clean & Concentrator™ -25 Kit Zymo Research D4007 http://www.zymoresearch.com/dna/dna-clean-up/zymoclean-gel-dna-recovery-kit
GelGreen Nucleic Acid Stain Biotium 41005 https://biotium.com/product/gelgreentm-nucleic-acid-gel-stain-10,000x-in-water/
Genesys 10SUV-VIS Spectrophotometer Thermo Scientific 840-208100 https://www.thermofisher.com/order/catalog/product/840-208100?ICID=search-840-208100
Gentra Puregene Yeast/Bact. Kit Qiagen 158567 https://www.qiagen.com/us/shop/sample-technologies/dna/dna-preparation/gentra-puregene-yeastbact-kit/#orderinginformation
HCl Fisher Scientific A144-212 Corrosive;  https://www.fishersci.com/shop/products/hydrochloric-acid-certified-acs-plus-fisher-chemical-10/a144212?searchHijack=true&searchTerm=A144212&searchType=RAPID
KCl Fisher Scientific P217-500 https://www.fishersci.com/shop/products/potassium-chloride-crystalline-certified-acs-fisher-chemical-4/p217500?searchHijack=true&searchTerm=P217500&searchType=RAPID
KH2PO4 Fisher Scientific P285-500 https://www.fishersci.com/shop/products/potassium-phosphate-monobasic-crystalline-certified-acs-fisher-chemical-5/p285500?searchHijack=true&searchTerm=P285500&searchType=RAPID
KOH Fisher Scientific P250-500 https://www.fishersci.com/shop/products/potassium-hydroxide-pellets-certified-acs-fisher-chemical-5/p250500?searchHijack=true&searchTerm=P250500&searchType=RAPID
Le Loop Decon Labs Inc. MP190-25 http://deconlabs.com/products/leloop/
Le Stab Decon Labs Inc. MP186-5 http://deconlabs.com/products/lestab/
MgSO4·7H2O Fisher Scientific M63-500 https://www.fishersci.com/shop/products/magnesium-sulfate-heptahydrate-crystalline-certified-acs-fisher-chemical-3/m63500?searchHijack=true&searchTerm=M63500&searchType=RAPID
Mini-Sub Cell GT Horizontal Electrophoresis System Bio Rad Labs 1704406 http://www.bio-rad.com/en-us/product/mini-sub-cell-gt-cell?WT.srch=1&WT.mc_id=aw-cbb-NA-sub_cell_systems_brand_gold&WT.knsh_id=7eb1981f-a011-42a3-aece-1236ff453373
MR-VP Broth Difco 216300 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=216300&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3Dmr-vp%2Bmedium%26typeOfSearch%3DproductSearch
Na2HPO4 Fisher Scientific S374-500 https://www.fishersci.com/shop/products/sodium-phosphate-dibasic-anhydrous-granular-powder-certified-acs-fisher-chemical-5/s374500?searchHijack=true&searchTerm=S374500&searchType=RAPID
NaCl Fisher Scientific S271-10 https://www.fishersci.com/shop/products/sodium-chloride-crystalline-certified-acs-fisher-chemical-6/s27110?searchHijack=true&searchTerm=S27110&searchType=RAPID
NaHCO3 Fisher Scientific S233-500 https://www.fishersci.com/shop/products/sodium-bicarbonate-powder-certified-acs-fisher-chemical-5/s233500?searchHijack=true&searchTerm=S233500&searchType=RAPID
NaNH4HPO4·4H2O Fisher Scientific S218-500 https://www.fishersci.com/shop/products/sodium-ammonium-phosphate-tetrahydrate-crystalline-certified-fisher-chemical/s218500?searchHijack=true&searchTerm=S218500&searchType=RAPID
NanoDrop Lite Spectrophtometer Thermo Scientific ND-LITE-PR https://www.thermofisher.com/order/catalog/product/ND-LITE-PR?ICID=search-ND-LITE-PR
Nonfat dry milk Nestle Carnation N/A N/A
Peptone Becto, Dickinson and Co. 211677 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=211677&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D211677%26typeOfSearch%3DproductSearch
Petri Dishes (100 mm x 15 mm) Fisher Scientific FB0875712 https://www.fishersci.com/shop/products/fisherbrand-petri-dishes-clear-lid-12/fb0875712#?keyword=FB0875712
Petri Dishes (150 mm x 15 mm) Fisher Scientific FB0875714 https://www.fishersci.com/shop/products/fisherbrand-petri-dishes-clear-lid-12/fb0875714?searchHijack=true&searchTerm=FB0875714&searchType=RAPID
Polymyxin B sulfate salt Sigma-Aldrich P1004-10MU Store at 2-4 °C; http://www.sigmaaldrich.com/catalog/product/sial/p1004?lang=en&region=US
Taq DNA Polymerase New England Biolabs M0273S Store at -20 °C; https://www.neb.com/products/m0273-taq-dna-polymerase-with-standard-taq-buffer
Taq Reaction Buffer New England Biolabs M0273S Store at -20 °C;  https://www.neb.com/products/m0273-taq-dna-polymerase-with-standard-taq-buffer
Thermal Cycler Bio-Rad C1000 Touch™  Bio Rad Labs 1840148 http://www.bio-rad.com/evportal/evolutionPortal.portal?_nfpb=true&_pageLabel=search_page&sfMode=search&sfStartNumber=1&clearQR=true&js=1&searchString=1840148&database=productskus+productcategories+productdetails+abdProductDetails+msds+literatures+inserts+faqs+downloads+webpages+assays+genes+pathways+plates+promotions&tabName=DIVISIONNAME
Triphenyltetrazolium chloride Alfa Aesar A10870 https://www.alfa.com/en/catalog/A10870/
Tris Base Fisher Scientific BP152-1 https://www.fishersci.com/shop/products/tris-base-white-crystals-crystalline-powder-molecular-biology-fisher-bioreagents-7/bp1521?searchHijack=true&searchTerm=BP1521&searchType=RAPID
Tryptone Becto, Dickinson and Co. 211705 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=211705&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D211705%26typeOfSearch%3DproductSearch
Yeast Extract Becto, Dickinson and Co. 212750 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=212750&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D212750%26typeOfSearch%3DproductSearch
α-napthol MP Biomedicals 204189 http://www.mpbio.com/product.php?pid=05204189

DOWNLOAD MATERIALS LIST

References

  1. Shimada, T., et al. Extended serotyping scheme for Vibrio cholerae. Curr. Microbiol. 28, (3), 175-178 (1994).
  2. Yamai, S., Tadayuki, O., Toshio, S., Yasuji, K. Distribution of serogroups of Vibrio cholerae non-O1 non-O139 with specific reference to their ability to produce cholera toxin, and addition of novel serogroups. Jpn. J. Infect. Dis. 71, (10), 1037-1045 (1997).
  3. Karaolis, D. K., Lan, R., Reeves, P. R. The sixth and seventh cholera pandemics are due to independent clones separately derived from environmental, nontoxigenic, non-O1 Vibrio cholerae. J. Bacteriol. 177, (11), 3191-3198 (1995).
  4. Albert, M. J., et al. Large epidemic of cholera-like disease in Bangladesh caused by Vibrio cholerae O139 synonym Bengal. Lancet. 342, (8868), 387 (1993).
  5. Barua, D. History of Cholera. Cholera. Barua, D., Greenough III, W. B. Plenum Publishing Corporation. 1-36 (1992).
  6. Morales, R., Delgado, G., Cravioto, A. Population Genetics of Vibrio cholerae. Vibrio cholerae-Genomics and Molecular Biology. Faruque, S. M., Nair, G. B. Caister Academic Press. 29-47 (2008).
  7. Samadi, A. R., Chowdhury, M. K., Huq, M. K., Khan, M. U. Seasonality of classical and El Tor cholera in Dhaka, Bangladesh: 17-year trends. Trans. R. Soc. Trop. Med. Hyg. 77, (6), 853-856 (1983).
  8. Son, M. S., Megli, C. J., Kovacikova, G., Qadri, F., Taylor, R. K. Characterization of Vibrio cholerae O1 El Tor biotype variant clinical isolates from Bangladesh and Haiti, including a molecular genetic analysis of virulence genes. J. Clin. Microbiol. 49, (11), 3739-3749 (2011).
  9. Ghosh-Banerjee, J., et al. Cholera toxin production by the El Tor variant of Vibrio cholerae O1 compared to prototype El Tor and classical biotypes. J. Clin. Microbiol. 48, (11), 4283-4286 (2010).
  10. Ansaruzzaman, M., et al. The Mozambique cholera vaccine demonstration project coordination group. Cholera in Mozambique, variant of Vibrio cholerae. Emerg. Infect. Dis. 10, (11), 2057-2059 (2004).
  11. Ansaruzzaman, M., et al. Genetic diversity of El Tor strains of Vibrio cholerae O1 with hybrid traits isolated from Bangladesh and Mozambique. Int. J. Med. Microbiol. 297, (6), 443-449 (2007).
  12. Lan, R., Reeves, P. R. Pandemic spread of cholera: genetic diversity and relationships within the seventh pandemic clone of Vibrio cholerae determined by amplified fragment length polymorphism. J. Clin. Microbiol. 40, (1), 172-181 (2002).
  13. Nair, G. B., Faruque, S. M., Bhuiyan, N. A., Kamruzzaman, M., Siddique, A. K., Sack, D. A. New variants of Vibrio cholerae O1 biotype El Tor with attributes of the classical biotype from hospitalized patients with acute diarrhea in Bangladesh. J. Clin. Microbiol. 40, (9), 3296-3299 (2002).
  14. Nair, G. B., et al. Isolation of Vibrio cholerae O1 strains similar to pre-seventh pandemic El Tor strains during an outbreak of gastrointestinal disease in an island resort in Fiji. J. Med. Microbiol. 55, (11), 1559-1562 (2006).
  15. Nair, G. B., Mukhopadhyay, A. K., Safa, A., Takeda, Y. Emerging hybrid variants of Vibrio cholerae O1. Vibrio cholerae—Genomics and Molecular Biology. Faruque, S. M., Nair, G. B. Horizon Scientific Press. 179-190 (2008).
  16. Safa, A., et al. Genetic characteristics of Matlab variants of Vibrio cholerae O1 that are hybrids between classical and El Tor biotypes. J. Med. Microbiol. 55, (11), 1563-1569 (2006).
  17. Nusrin, S., et al. Diverse CTX phages among toxigenic Vibrio cholerae O1 and O139 strains isolated between 1994 and 2002 in an area where cholera is endemic. J. Clin. Microbiol. 42, (12), 5854-5856 (2004).
  18. Carignan, B. M., Brumfield, K. D., Son, M. S. Single nucleotide polymorphisms in regulator-encoding genes have an additive effect on virulence gene expression in a Vibrio cholerae clinical isolate. mSphere. 1, (5), e00253 (2016).
  19. Iwanaga, M., Yamamoto, K., Higa, N., Ichinose, Y., Nakasone, N., Tanabe, M. Culture conditions for stimulating cholera toxin production by Vibrio cholerae O1 El Tor. Microbiol. Immunol. 30, (11), 1075-1083 (1986).
  20. DiRita, V. J., Claude, P., Georg, J., Mekalanos, J. J. Regulatory cascade controls virulence in Vibrio cholerae. Proc. Natl. Acad. Sci. USA. 88, (12), 5403-5407 (1991).
  21. Kovacikova, G., Lin, W., Skorupski, K. Duel regulation of genes involved in acetoin biosynthesis and motility/biofilm formation by the virulence activator AphA and the acetate-responsive Lys-R type regulator AlsR in Vibrio cholerae. Mol. Microbiol. 57, (2), 420-433 (2005).
  22. Vogel, H. J., Bonner, D. M. Acetylornithinase of Escherechia coli: partial purification and some properties. J. Biol. Chem. 218, (1), 97-106 (1956).
  23. Son, M. S., Taylor, R. K. Genetic screens and biochemical assays to characterize Vibrio cholerae O1 biotypes: classical and El Tor. Curr. Protoc. Microbiol. 6A.2.1-6A.2.17 (2011).
  24. Kovacikova, G., Skorupski, K. Regulation of virulence gene expression in Vibrio cholerae by quorum sensing: HapR functions at the aphA promoter. Mol. Microbiol. 46, (4), 1135-1147 (2002).
  25. Wang, Y., et al. The prevalence of functional quorum-sensing systems in recently emerged Vibrio cholerae toxigenic strains. Environ. Microbiol. Rep. 3, (2), 218-222 (2011).
  26. Sanders, E. R. Aseptic laboratory techniques. J. Vis. Exp. (63), e3064 (2012).
  27. Martinez, R. M., Megli, C. J., Taylor, R. K. Growth and laboratory maintenance of Vibrio cholerae. Curr. Protoc. 6A.1.1-6A.1.6 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics